• No results found

A COMPARATIVE STUDY ON THE TOLUENE DEGRADING BACTERIA ISOLATED FROM POLLUTED ENVIRONMENTS

N/A
N/A
Protected

Academic year: 2020

Share "A COMPARATIVE STUDY ON THE TOLUENE DEGRADING BACTERIA ISOLATED FROM POLLUTED ENVIRONMENTS"

Copied!
21
0
0

Loading.... (view fulltext now)

Full text

(1)

A COMPARATIVE STUDY ON THE TOLUENE DEGRADING

BACTERIA ISOLATED FROM POLLUTED ENVIRONMENTS

D.V. Varshini and *Dr. V. Judia Harriet Sumathy

PG & Research Department of Biotechnology Women’s Christian College Chennai – 600 006.

ABSTRACT

Humans are primarily exposed to various types of Pollutants and one such pollutant is Toluene. It is moderately toxic when ingested or inhaled and slightly hazardous when absorbed through skin. Toluene can enter human body from the air, water or soil. When toluene is inhaled, it is directly taken into the blood from the lungs. When toluene is ingested, it is absorbed from the GI tract into the bloodstream. Small amount of toluene accumulates in fat tissue with daily exposure and majority of toluene is removed from the body within a day. Toluene leaves the body unchanged during respiration and excretion or it is converted into a less harmful chemical such as hippuric acid. Bioremediation is the best practice of using living organisms to

detoxify the polluted environment. There are three different types of bioremediation namely (a) Microbial bioremediation, (b) Phytoremediation and (c) Mycoremediation. The process of using microbes to degrade environmental contaminants to non harmful or less harmful products is termed as microbial biodegradation which can occur aerobically or anaerobically. Aerobic degradation occurs when the pollutant is oxidised using oxygen, nitrogen, iron, sulphate and manganese by the microbes and the pollutant acts as electron donor. Anaerobic degradation occurs when the pollutant is reduced by the microbes. The oxidative microbes degrade toluene via hydroxylation of the aromatic ring to a mixture of catechols and cresols. The present research work is a Comparative study of bacteria isolated from polluted environments that are capable of degrading toluene.

KEYWORDS: Humans, Pollutants, Toulene, Bioremediation and Comparative Study.

Volume 6, Issue 9, 1025-1045. Research Article ISSN 2277– 7105

*Corresponding Author

Dr. V. Judia Harriet

Sumathy

PG & Research Department

of Biotechnology Women’s

Christian College Chennai –

600 006.

Article Received on 29 June 2017,

Revised on 20 July 2017, Accepted on 10 August 2017

(2)

INTRODUCTION

Toluene is produced during the process of making gasoline and other fuels from crude oil and also as a by-product in the manufacture of styrene. Worldwide annual production of toluene was estimated to be 10 million tons (George and Florence, 1994). Toluene is extensively used in industrial activities such as in the production of thinners, pesticides, cigarettes, polymers, gums, oils, resins and as a non-clinical thermometer liquid. It is used as a solvent in carbon nanotubes and used as cement for polystyrene kits. In biochemistry experiments, it is used in the disruption of RBC in order to extract haemoglobin (W. Smith et al., 1945).

Toluene can be released in the environment where it is produced or used. It is also released in the environment because of oil spills and pipeline disruption. It is found in air when there is a heavy vehicular traffic (Angela Woods et al., 2011). Higher levels of toluene in indoor air can be found where paint thinners, solvents or tobacco products are used. Toluene enters surface waters and ground water from solvent, petroleum product spills, underground storage tanks. It can enter a soil and water when toluene-containing products are placed in landfills or waste disposal sites (B. Tury, 2003).

Toluene has a serious health effect on the nervous system (brain and nerves). Acute and chronic effects are observed when humans are exposed to toluene (Casey Hubert et al.,

1999). Some of the common symptoms observed are listed below.

 Unconsciousness

 Cognitive impairment

 Vision and hearing loss

 Loss of coordination

 Loss of muscle control

 Loss of memory

(3)

above 1000 ppm in the air, it results in loss of consciousness and coma (Jacob H. Jacob et al., 2015).

High levels of toluene exposure during pregnancy may lead to retardation of growth and mental abilities in children. Other health effects include damage to liver, kidney and respiratory system. According to EPA, exposure to high levels of toluene in occupational settings was found to have an increase in leukemia (Gericke et al., 2001). Continuous exposure to toluene can exert mutagenic effects on human cells due to covalent binding to DNA. It is also a human neurotoxin and may cause leukoencephalopathy at the long exposure time. Toluene causes death by interfering with the respiration pattern and heart beat. Toluene is of lesser risk to non-human species such as fish and wildlife. This is because toluene is volatile and evaporates into the atmosphere. When there is a concentrated spill in land or water, the plants, fishes (space between the and plants) and birds are affected. At higher concentrations, toluene is dangerous to aquatic life and fouling to shoreline (Rabus R and

Widdel F, 1995).

Toluene is released into the atmosphere from the volatilization of petroleum fuels, thinners and from motor vehicle exhaust. Some amount is discharged into waterways or spilled on land during storage, transport and disposal of fuels. Toluene is occasionally detected in drinking water but the levels are generally less than 3 µg/L. In case of soil, the average concentration is over 70µg/kg. Removal of toluene from soil, surface water and underground water is of greater importance in order to restore soil and water qualities (M. Gopinath and

R. Dhanasekar, 2012). Toluene is an aromatic hydrocarbon and its structure is shown in

Figure 1. Its natural source includes tolu tree. Toluene is alkyl benzene having one methyl group added to the benzene ring. It’s IUPAC name is Methylbenzene. The physical and chemical properties of toluene are mentioned in Table 1.

(4)
[image:4.595.79.514.89.324.2]

Table 1: Physical and Chemical properties of Toluene.

Chemical formula C7H8

Physical state and appearance Liquid

Odour Benzene-like, pungent,sweet. Molecular weight 92.14 g/mol

Water solubility (mg/L) 515

Colour Colourless

Boiling point 110.6°C

Melting point -95°C

Critical temperature 318.6°C Vapour pressure 3.8 kPa (at 25°C)

Corrosivity Non corrosive in the presence of glass Polymerization Will not occur

Polarity Non polar

Degradability Aerobic and anaerobic Flammability Highly flammable Maximum contaminant level (MCL) (mg/L) 1

MATERIALS AND METHODOLOGY

Soil samples were collected from mechanic sheds in Medavakkam and Kolathur. Water samples were collected from Coovum River, Ennore and Besant Nagar Beach (Figure 2). The samples were collected in a sterile container and they were stored air tight. The soil samples were taken from a depth of 10-15cms and the samples were cleaned by removing large stones and pebbles.

Figure 2: a) Kolathur b) Medavakkam c) Ennore d) Coovum e) Besant nagar – sample collection sites.

Toluene was purified using membrane filter technique. The pore size of the filter used was 0.4µm. It was stored in a brown bottle to prevent evaporation. The soil and marine microbes were enriched in nutrient broth medium. Following this it was further enriched with Minimal Salt Medium and Minimal Salt Agar which contains toluene as carbon source.

SERIAL DILUTION

The incubated tubes were taken for serial dilution. 9ml of saline was added to the 10 sterilized test tubes. 1ml from the incubated test tubes was added to the first test tube which

e

d

b

[image:4.595.87.511.476.544.2]
(5)

gives 1:10 dilution. The tube was mixed well and 1ml from the 1:10 dilution was transferred to the second tube which gives 1:100 dilutions. This was continued till the 8th tube and 1ml from the 8th tube was discarded. Dilutions such as 105, 106 and 107 were chosen for Streak plating and the selected colonies were subjected to Gram Staining.

BIOCHEMICAL CHARACTERIZATION

Biochemical tests for identification of microbes are a set of biochemical tests which allows preliminary identification of microorganism. Biochemical tests are more specific than staining techniques. These tests involve chemicals and each genus of microbes have specific results with these chemicals. Catalase Test, Indole Test, Methyl Red Test, Voges

Proskauer Test, Citrate Utilization Test, Triple Sugar Iron Test and Urease Test are the

Biochemical Tests performed in the present study.

THIN LAYER CHROMATOGRAPHY

The solvent Petroleum ether : Acetone (9:1) was used as a mobile phase for the compound in the sample to be identified. Silica slurry coated TLC plate was used as a stationary phase. A line was drawn at the bottom of the TLC plate and the sample was placed using the capillary tube over the line marked. The TLC plate was placed in a beaker containing the mobile phase and was left undisturbed for the solvent to reach the top of the TLC plate. The TLC plate was removed and air dried. The pigment was identified by observing under UV trans-illuminator. The Retention Factor () of the compound was calculated using the formula,

Rϝ = Distance travelled by the compound ________________________________

Distance travelled by the solvent front

GAS CHROMATOGRAPHY - MASS SPECTROSCOPY (GC-MS) (PERFORMED AT YAZH XENOMICS)

(6)

15 minutes. The mass spectrometer operated in a full scan mode in the range of m/z 50-550 and by electron impact ionization energy of 70 eV.

RESULTS AND DISCUSSION ENRICHMENT OF SAMPLE

[image:6.595.145.450.286.382.2]

The soil and water samples were enriched in nutrient broth. After 24 hours of incubation, turbidity was observed in all the five flasks indicating the growth of bacteria (Figure 3 and Table 2). The growth of bacteria in nutrient medium aided in increasing the number of bacteria present in the sample because addition of sample directly in a harsh medium containing toluene reduces the chances of growth of the bacteria.

Figure 3: Sample enriched in Nutrient Broth.

Table 2: Growth of bacteria in nutrient broth.

S.NO. SAMPLE RESULT

1. Coovum Growth of bacteria 2. Besant Nagar Growth of bacteria 3. Ennore Growth of bacteria 4. Medavakkam Growth of bacteria 5. Kolathur Growth of bacteria

MINIMAL SALT MEDIUM

(7)
[image:7.595.178.418.71.227.2]

Figure 4: Growth in MSM supplemented with 1% Toluene.

Table 3: Growth of bacteria in MSM with 1% Toluene.

S.NO. SAMPLE RESULT

1. Coovum No growth observed 2. Besant Nagar No growth observed 3. Ennore No growth observed 4. Medavakkam Growth observed 5. Kolathur Growth observed

SERIAL DILUTION

[image:7.595.210.386.505.641.2]

Serial dilution was performed using the tubes which showed turbidity and the dilutions 10-5, 10-6 and 10-7 were used for spread plate technique (Figure 5). These dilutions were selected as they would reduce the number of bacteria in the sample. This helped in obtaining isolated colonies by spread and streak plate technique.

Figure 5: Serial dilution using soil sample.

MINIMAL SALT AGAR

(8)
[image:8.595.200.395.126.322.2]

were brown, white, cream and creamy white whose colony was pin pointed in nature while the other colonies were mucoid in nature.

Figure 6: Colonies on MSM agar plate with 1% toluene.

SUBCULTURE OF THE ISOLATED BACTERIA

Subculture of the colonies on nutrient agar yielded four distinct bacteria (Figure 7). One of the bacteria produced distinct green pigment which resembled pyocyanin indicating the possibility for Pseudomonas spp. (Figure 7a). The bacteria were designated as a, b, c and d. These sub cultures were stored in the refrigerator for further use in biochemical and morphological tests.

Figure 7: Subculture of four colonies obtained in MSM plate.

CONCENTRATION AND DEGRADATION STUDIES

[image:8.595.234.363.501.632.2]
(9)
[image:9.595.164.433.168.319.2]

colony producing bacteria was able to degrade 2% toluene. The bacteria were allowed to grow in the medium containing toluene for 10-15 days to obtain maximum degradation (Figure 8 and Table 4). The growth of bacteria was visually observed by the turbidity in the tubes and degradation of toluene to catechol was confirmed by TLC and GC – MS.

Figure 8: Growth of bacteria in 2% toluene.

Table 4: Concentration and degradation studied using the bacterial isolates.

S.NO BACTERIA RESULT

1. Bacteria ‘a’ Growth in 1% toluene 2. Bacteria ‘b’ Growth in 1% toluene 3. Bacteria ‘c’ Growth in 2% toluene 4. Bacteria ‘d’ Growth in 1% toluene

GRAM STAINING

All the isolated bacteria were Gram negative and rod shaped (Figure 9 and Table 5). The Gram negative nature of the bacteria was further confirmed by growing the bacteria on MacConkey agar plate.

[image:9.595.200.396.562.700.2]
(10)
[image:10.595.252.343.336.437.2]

Table 5: Gram staining of the isolated bacteria.

S.NO. BACTERIA RESULT

1. Bacteria ‘a’ Gram negative, rod shaped 2. Bacteria ‘b’ Gram negative, rod shaped 3. Bacteria ‘c’ Gram negative, rod shaped 4. Bacteria ‘d’ Gram negative, rod shaped

SELECTIVE AND DIFFERENTIAL MEDIA

MacConkey agar is mainly used for isolating Gram negative bacteria since it contains crystal violet which inhibits the growth of Gram positive bacteria. This medium also acts as a differential medium by differentiating Gram negative Lactose fermenting and Non lactose fermenting bacteria. The isolated bacterium ‘a’ produced a NLF (Non Lactose Fermenting) colony which was yellow in colour. The bacteria ‘b’, ‘c’ and ‘d’ produced pink colonies which indicated that they were LF (Lactose Fermenting) (Figure 10 and Table 6).

Figure 10: LF and NLF colonies on MacConkey agar plate.

Table 6: Lactose fermentation of the isolated bacteria.

S.NO. BACTERIA RESULT

1. Bacteria ‘a’ Non lactose fermenting 2. Bacteria ‘b’ Lactose fermenting 3. Bacteria ‘c’ Lactose fermenting 4. Bacteria ‘d’ Lactose fermenting

BIOCHEMICAL TEST

[image:10.595.162.436.497.573.2]
(11)

BACTERIUM ‘a’

[image:11.595.106.486.169.390.2]

The bacterium ‘a’ showed positive results for Citrate utilization test, Oxidase test and Catalase test. Indole, MR, VP and Urease tests were negative for this bacterium. The TSI slant and butt were alkaline without gas production (Figure 11 and Table 7).

Figure 11: Biochemical test results for bacterium ‘a’.

Table 7: Biochemical tests for bacterium ‘a’.

S.NO. BIOCHEMICAL TEST RESULT

1. Indole test Negative 2. Methyl red test Negative 3. Voges Proskauer test Negative 4. Citrate utilization test Positive 5. Urease test Negative 6. Triple sugar iron agar test K/K, no gas 7. Oxidase test Positive 8. Catalase test Positive

BACTERIUM ‘b’

[image:11.595.146.452.448.582.2]
(12)
[image:12.595.122.474.69.262.2] [image:12.595.123.475.316.455.2]

Figure 12: Biochemical test results for bacterium ‘b’.

Table 8: Biochemical tests for bacterium ‘b’.

S.NO. BIOCHEMICAL TEST RESULT

1. Indole test Negative 2. Methyl red test Positive 3. Voges Proskauer test Negative 4. Citrate utilization test Positive 5. Urease test Negative

6. Triple sugar iron agar test A/A, H2S production

7. Oxidase test Positive 8. Catalase test Positive

BACTERIUM ‘c’

[image:12.595.103.490.563.748.2]
(13)
[image:13.595.128.467.84.226.2]

Table 9: Biochemical tests for bacterium ‘c’.

S.NO. BIOCHEMICAL TEST RESULT

1. Indole test Positive 2. Methyl red test Positive 3. Voges Proskauer test Negative 4. Citrate utilization test Positive 5. Urease test Negative

6. Triple sugar iron agar test A/A, gas production 7. Oxidase test Negative

8. Catalase test Positive

BACTERIUM ‘d’

[image:13.595.126.468.86.224.2]

The bacterium ‘d’ exhibited positive results for Indole, MR, Citrate utilization test and Catalase tests. It was negative for Oxidase, VP and Urease tests. TSI slant showed acid slant and butt with gas production (Figure 14 and Table 10).

Figure 14: Biochemical test results for bacterium ‘d’.

Table 10: Biochemical tests for bacterium ‘d’.

S.NO. BIOCHEMICAL TEST RESULT

1. Indole test Positive 2. Methyl red test Positive 3. Voges Proskauer test Negative 4. Citrate utilization test Positive 5. Urease test Negative

6. Triple sugar iron agar test A/A, gas production 7. Oxidase test Negative

[image:13.595.111.486.332.560.2]
(14)
[image:14.595.132.465.141.221.2]

With the help of biochemical tests performed above, the isolated bacteria identified are as follows (Table 11).

Table 11: Results of Biochemical tests

S.NO. ISOLATED BACTERIUM RESULT

1. Bacterium ‘a’ Pseudomonas spp.

2. Bacterium ‘b’ Pseudomonas spp.

3. Bacterium ‘c’ Citrobacter spp.

4. Bacterium ‘d’ Citrobacter spp.

THIN LAYER CHROMATOGRAPHY

Thin layer chromatography of the samples was done to identify the degradation of toluene. Catechol was used as the standard and the unknown values were spotted. Here in (Figure 15 A) S indicated standard catechol, T1 was degradation of 1% toluene using bacterium ‘a’, T2

was degradation of 1% toluene using bacterium ‘b’, T3 was degradation of 1% toluene using bacterium ‘c’ and T4 was degradation of 1% toluene using bacterium ‘d’. In (Figure 15 B), S indicates standard catechol, 1,2 and 3 were samples treated with bacterium ‘b’ in which only sample 2 showed degradation of toluene. Ferric chloride was used to develop the black spots. In (Figure 15 A), all four samples developed black spots which indicated degradation of toluene to catechol while in (Figure 15 B) only one bacterium was able to degrade toluene. The black spot developed were similar to the standard catechol spot used for reference.

Figure 15: A) TLC of 1% toluene treated with bacteria and B) TLC of 2% toluene treated with bacteria.

FOURIER TRANSFORM – INFRA RED SPECTROSCOPY

All the three samples with different concentrations of toluene were degraded to similar compounds (Figures 16 and 17 and Table 12). The peak values and the corresponded compounds were present in the sample. This showed the presence of alcohol, alkyne, alkene, A

A

[image:14.595.211.388.473.611.2]
(15)
[image:15.595.150.429.233.422.2]

nitro, ether, alkoxy and arene groups in the degraded sample. When compared to the toluene FT – IR, the peak range as well as the compounds differs in all the three cases. A C-H bending at 1035 peak range in toluene has been converted to C-O stretching peak indicating presence of alkoxy. C-C bond has been converted to C-O, C=C and N-O bonds in the treated sample in 1100 – 1635 peak range. The C-H stretching bonds aft 1635 peak range have been converted to O-H and C≡C compounds.

Figure 16: FT – IR of Control sample containing toluene.

[image:15.595.130.466.492.701.2]
(16)
[image:16.595.123.472.75.210.2]

Table 12: FT – IR interpretation of degraded sample.

S.NO. PEAK VALUE UNKNOWN COMPOUND

1. 3327.41757 O-H alcohol stretching 2. 2120.43328 C≡C alkyne stretching 3. 1635.99741 C=C alkene stretching 4. 1373.25253 N-O nitro stretching 5. 1264.45973 C-O ether stretching 6. 1100.24418 C-O alkoxy stretching 7. 749.23345 C-H arene bending

GAS CHROMATOGRAPHY – MASS SPECTROSCOPY

The sample which contained 2% toluene and showed turbidity was given for GC – MS to identify the degraded compound. The compound catechol at 9.888 retention time shows the highest peak of area 99.11% (Figure 18 and Table 13). This high amount of catechol in the degraded sample was due to incubation of the organism with toluene in shaker at 150rpm for 10-15 days to obtain the maximum degradation of toluene. This confirms the degradation of toluene to catechol which is a less toxic compound and a product of toluene degradation by bacteria. The other compounds present in the samples were vinylcyclohexyl ether, 1-decene, 1-hexanol, 4-methyl, decane, heptane, 2,5,5-trimethyl-, 2-undecene, 4,5-dimethyl, 3-dodecene, oxalic acid, isobutyl pentyl ester, 1,1-dioctyloxyoctane, dodecane, 1,1-difluoro, 1,2-benzenediol, brenzcatechin, benzamide, 2-hydroxy-, benzaldehyde, 2,6-dichloro groups. These were found in trace amounts in the degraded sample. The presence of these products could be due to the presence of MSM residues present in the sample after utilization of salts.

[image:16.595.119.477.513.719.2]
(17)
[image:17.595.28.572.86.323.2]

Table 13: Compound identification by GC – MS.

PEAK NO. RETENTION TIME IN MINUTES COMPOUNDS PEAK AREA %

1. 5.183 vinylcyclohexyl ether 0.04

2. 6.420 1-decene 0.22

3. 6.483 1-hexanol, 4-methyl 0.02

4. 6.556 Decane 0.11

5. 6.717 heptane, 2,5,5-trimethyl 0.02 6. 7.897 2-undecene, 4,5-dimethyl 0.03

7. 8.073 3-dodecene 0.12

8. 8.202 oxalic acid, isobutyl pentyl ester 0.05 9. 9.676 1,1-dioctyloxyoctane 00.4 10. 9.799 dodecane, 1,1-difluoro 0.02

11. 9.888 Catechol 99.11

12 10.767 1,2-benzenediol 0.00

13. 10.808 Brenzcatechin 0.01

14. 10.892 benzamide, 2-hydroxy 0.03 15. 11.463 benzaldehyde, 2,6-dichloro 0.18

16s rRNA SEQUENCING

[image:17.595.96.502.358.655.2]
(18)
[image:18.595.93.505.75.409.2]

Figure 20: Sequencing of Bacterium.

DNA SEQUENCE OF THE MOST EFFICIENT BACTERIUM

(19)
[image:19.595.97.480.300.351.2]

CCACCTACGCGCGCTTTACGCCCAGTAATTAAGATTAACGCTTGCACCCTCTGTA TTACCGCGGCGCTGGCACAGAGTAGCGGTGCTTATTCTATCGGTAACGTCAAAAC ATCAGTATACCTACTGACATTCTCCCAACTGAAAGTGATTTACAATCGAAGACTA CTCAACACGCGCATGCTGCATCAGCTTTCCCCAATGTCAATTCCCACCGCTGCAG CAGTAGGACTGACGGTCTCAGTCAGTGACTGATCCTCTGACGTCGATCGTGCCTT GTGACATACCCACAAATAGCTATCCGACTTAGGCTCATGCGATAGCGCAAGGCCT GAAGGTCCCTTGCTTTCAGGGGTAGGACGTATGCGGCATTAGCGTTCCTTTTGAA ACGCTGTCCCCCACTACCAGGCAGATTCATAGGCATTACTCACCCCTCTGCCGAC GAATCAAGGTAGCACAGCCCCCGGCATCCGCTCGACTGCATGTATAGTCTGGGCC CACGCG.

Figure 21: Phylogenetic tree of the sequenced bacteria.

The phylogenetic tree prediction and the BLAST sequences confirm the bacteria as

Pseudomonas putida (Figures 19 - 21). This bacterium has been able to tolerate and degrade 2% toluene and convert it to catechol. Such efficient bacterium can be further studied and used for in situ bioremediation processes.

TOLUENE BIODEGRADATION PATHWAY

[image:19.595.183.449.517.742.2]
(20)

The pathway in Figure 22 gives an overall view in which toluene is converted to Methylcatechol or Catechol or p – Hydroxybenzoic acid with the help of bacteria. In most of the cases, toluene is degraded to some form of catechol which is less toxic than toluene. According to Olajire et al., (2014) the first pathway which includes formation of benzyl alcohol, benzoic acid and then catechol is carried out by Pseudomonas putida. The catechol thus formed is further degraded and utilised by the bacteria for its growth and metabolism. Therefore for future studies, such bacteria can be employed in large scale production for degrading harmful pollutants to less harmful or less toxic compounds.

CONCLUSION

The soil and water samples obtained from various harsh environments were used for the isolation of bacteria. The enrichment of samples in nutrient broth before exposing the bacteria to toluene enhanced the growth in MSM supplemented with toluene. The methods used for the isolation of toluene degrading bacteria were simple but accurate methods to obtain the efficient bacterium. The degradation of toluene to catechol was visualized conveniently using thin layer chromatography where black spots indicated presence of catechol. Biochemical tests such as Indole, MR, VP, Citrate utilization, TSI, Oxidase and Catalase tests were performed to identify the four toluene degrading bacteria. Two Pseudomonas spp. and two

Citrobacter spp. were identified using the biochemical tests that were able to degrade 1% toluene. FT – IR spectroscopy was carried to identify the functional groups present in the degraded sample. GC – MS served as an important tool in confirming the presence of catechol in the degraded sample. 16s rRNA sequencing was performed to identify the most potential bacterium Pseudomonas putida which was able to degrade 2% of toluene.

Pseudomonas putida was observed to be the most efficient bacterium among the four isolated bacteria.

BIBLIOGRAPHY

1. George D.C. and Florence E.C. (1994) Aromatic hydrocarbons, Patty’s industrial hygiene

and toxicology, Vol. II, Part B, 4th edn., John Wiley and Sons, Inc., New York, 1301-1350.

(21)

3. Angela Woods, Maribeth Watwood and Egbert Schwartz (2011) Identification of a Toluene-Degrading Bacterium from a Soil Sample through H218O DNA Stable Isotope

Probing. Applied and Environmental Microbiology, 77(17): 5995–5999.

4. Tury, B., Pemberton, D. and Bailey, R.E (2003) Fate and potential environmental effects of methylenediphenyl diisocyanate and toluene diisocyanate released into the atmosphere. Journal of the Air & Waste Management Association, 53(1): pp.61-66. 5. Casey Hubert, Yin Shen and Gerrit Voordouw (1999) Composition of Toluene-Degrading

Microbial Communities from Soil at Different Concentrations of Toluene. Applied and Environmental Microbiology, p. 3064–3070.

6. Foo, S.C., Jeyaratnam, J. and Koh, D (1990) Chronic neuro behavioural effects of toluene. British Journal of Industrial Medicine, 47(7): 480-484.

7. Jacob H. Jacob, Fawzi I. Irshaid (2015) Toluene Biodegradation by Novel Bacteria Isolated from Polluted Soil Surrounding Car Body Repair and Spray Painting Workshops.

Journal of Environmental Protection, 6: 1417-1429.

8. Gericke, C., Hanke, B., Beckmann, G., Baltes, M.M., Kühl, K.P., Neubert, D. and Toluene Field Study Group (2001) Multicenter field trial on possible health effects of toluene: III. Evaluation of effects after long-term exposure. Toxicology, 168(2): 185-209. 9. Rabus R and Widdel F (1995) Anaerobic degradation of ethyl benzene and other aromatic

hydrocarbons by new denitrifying bacteria. Archives of Microbiology, 163(2): 96-103. 10.M. Gopinath and R. Dhanasekar (2012) Microbial degradation of toluene. African

Figure

Table 1: Physical and Chemical properties of Toluene.
Figure 3: Sample enriched in Nutrient Broth.
Figure 4: Growth in MSM supplemented with 1% Toluene.
Figure 7: Subculture of four colonies obtained in MSM plate.
+7

References

Related documents

4 Einfluss der Positionierung des Probanden im Tomographen sowie der Orientierung des Magnetfeldgradienten auf die Stimulationsschwelle sowie den Stimulationsort

This study analyzes the experiences of homosexual prospective teachers, examining how homosexual prospective teachers form their identities as members of a sexual minority and

pneumoniae cells binding to 1 mm 2 of cultured cells was performed for antibodies generated from vaccinated mice ( n ⫽ 4 in each group). pneumoniae was incubated with serum

ALI: acute lung injury; CO: cardiac output; CVP: central venous pressure; cfu: colony-forming unit; EA: endotoxin activity; PMX-HP: hemoperfusion through the column

ein signifikant höheres Auftreten von Fernmetastasen (ohne Knochenmetastasen) (p=0,001) sowie ein geringeres Gesamtüberleben bei Patientinnen mit positivem Knochenmarkstatus

positron emission tomography (FDG-PET), advanced tumour size or central tumour location in patients with suspected non-small cell lung cancer (NSCLC), Dutch and European

hanolic extract of FA: ethyl acetate d for p ª 0.01. tioxidant activity ered 100%. On the %, slightly lower xane eliminates ioxidant activity.