Full Terms & Conditions of access and use can be found at
https://www.tandfonline.com/action/journalInformation?journalCode=tabg21
Acta Botanica Gallica
Botany Letters
ISSN: 1253-8078 (Print) 2166-3408 (Online) Journal homepage: https://www.tandfonline.com/loi/tabg20
Helper bacteria associated with
Casuarina
cunninghamiana-Frankia
symbiosis: selection of
isolates for their effects on plant growth in axenic
conditions
Hakima Echbab, Yves Prin, Marc Ducousso, Sophie Nourissier-Mountou,
Houria Lahlou & Moustapha Araho
To cite this article: Hakima Echbab, Yves Prin, Marc Ducousso, Sophie Nourissier-Mountou, Houria Lahlou & Moustapha Araho (2004) Helper bacteria associated with Casuarina
cunninghamiana-Frankia symbiosis: selection of isolates for their effects on plant growth in axenic conditions, Acta Botanica Gallica, 151:4, 429-440, DOI: 10.1080/12538078.2004.10515445 To link to this article: https://doi.org/10.1080/12538078.2004.10515445
Published online: 27 Apr 2013.
Submit your article to this journal
Article views: 403
View related articles
Helper bacteria associated with Casuarina cunninghamiana-Frankia
symbiosis: selection of isolates for their effects on plant growth in
axe-nic conditions
by Hakima EchbabcJ), Yves Prine), Marc Ducoussoe), Sophie Nourissier-Mountoue), Houria Lahlou( 1) and Moustapha Arahou( 1)
(/) Laboratoire de Botanique, Departement de Biologie. Faculte des Sciences, Universite Mohammed V-Agdal, Rabat, Maroc
(2) Laboratoire des Symbioses tropicales et mediterraneennes, UMR 113 CJRAD/Agro-MI JNRAIIRDIUM2, TA/0/J, F-34398, Montpel/ier Cedex 5
arrive le 27 juillet 2004, accepte /e 10 septembre 2004
Abstract.- The formation of Casuarina actinorhizae in axenic conditions remains a challenge hindering research program. To explore the putative role of helper bacteria favouring actinorhizae formation, 50 bacteria were tested in an original selection scheme for their effects on C. cunninghamiana growth in the presence of Frankia. Two strains FAB1 and FAB2 were identified as having a significant promoting effect on C. cunninghamiana growth in the presence of
Frankia. Actinorhizae formation was never observed in these strictly axenic conditions. The comparison of 165 rDNA sequences shows similarity of 99% for FAB1 with Bacillus sp. and of 99% for FAB2 with Ochrobactrum sp.
Key words : axenic culture - Casuarina - Frankia - helper bacteria - symbiosis. Resume.-La formation axenique d'actinorhizes chez Casuarina n'a pas encore ete obtenue oberant Ia conduite des programmes de recherche. Afin d'explorer le role potential de bacteries auxiliaires favorisant Ia formation d'actinorhizes, 50 bacteries ant ete testees pour leurs effets sur Ia croissance de C.
cunningha-miana en presence de Frankia dans le cadre d'un schema de selection original. Deux souches FAB1 et FAB2 ant ete identiliees comme ayant un eifel significa-tif sur Ia croissance de C. cunninghamiana en presence de Frankia. La forma-tion axenique d'actinorhize n'a pas ete observes. La comparaison des sequences de I'ADNr 165 montrent une similarite de 99% de FAB1 avec Bacillus sp. et de 99% de FAB2 avec Ochrobactrum sp.
Mots cles : bacteria auxiliaire - Casuarina - culture axenique - Frankia - sym-biose.
I. INTRODUCTION
Casuarinaceae is a tree family able to develop a nitrogen-fixing symbiosis with the actino-mycete Frankia (Diem & Dommergues, 1983). This particular symbiosis called "actino-rhizae" enables species of Casuarinaceae to grow in adverse ecological conditions such as land reclamation, reforestation and soil stabilization (Richards eta/., 2002).
The effectiveness of the Frankia-Casuarinaceae symbiosis depends strongly on the potential of Casuarinaceae trees to acquire nutrients from the soil, particularly phosphorus (Sanginga eta/., 1989; Yang, 1995) cobalt, molybdenum (Hewit & Bond, 1961, 1966) and also iron (Arahou et a/., 1996; Arahou & Diem, 1997). As a matter of fact, investigations have focused on mineral nutrition and symbiotic associations to improve plant growth.
Most root symbioses generally involve only two partners: the host plant and a soil microorganism, be it Rhizobium, Frankia or a mycorrhizal fungus. In a number of cases
more than one symbiotic microorganism can coexist within the same host root system. For example, one individual of Alnus glutinosa is able to develop, in the same time, symbioses
with Frankia, ectomycorrhizal fungi and arbuscular mycorrhizal fungi (Massicotte eta/.,
1986).
It has also been shown that non-symbiotic bacteria may have a promoting effect on seve-ral symbiotic associations. Azospiril/um, Bacillus, Pseudomonas and Streptomyces are
known to be auxiliary bacteria of Rhizobium promoting nodulation in many legume
spe-cies (Iruthayathas eta/., 1983; Grimes & Mount, 1984; Li & Alexander, 1990). Itzigsohn
eta/. (1993) demonstrated that the combination of Azospiri/lum and Rhizobium resulted in
increased weight and shoot length of host plant compared to the effect of Rhizobium alone.
In the case of ectomycorrhizas, it has been demonstrated that a range of bacteria isolated from Laccaria laccata ectomycorrhizas and sporocarps increased mycorrhizal
develop-ment of Douglas fir inoculated with L. laccata (Duponnois & Garbaye, 1991 ).
In actinorhizae, little is known about the possible involvement of rhizospheric bacteria in the process of actinorhizae formation. Knowlton et a/. ( 1980) described a promoting
effect of Pseudomonas cepacia on Alnus rubra actinorhizae formation but Perinet and
Lalonde ( 1983) showed that the axenic obtaining of Alnus glutinosa-Frankia actinorhizae
was also possible. In the Casuarina-Frankia symbiosis, the axenic development of
actino-rhizae remains a challenge and the putative role of helper bacteria in the process of acti-norhizae establishment has never been explored.
The objective of the present research is to select soil bacteria isolated from the rhizos-phere of C. cunninghamiana to test it on the growth and physiology of C.
cunninghamia-na inoculated with Frankia. For that purpose a fast and origicunninghamia-nal method of bacterial isolates
selection respectful of putative interactions between bacteria has been set up.
II. MATERIALS AND METHODS
A. Isolation of bacteria from C. cunninghamiana root systems
Three soils from under C. cunninghamiana containing roots and actinorhizae were col-lected from its native range at Cape Hillsborough Road (nine km from Mackay), Herveys Range and Haughton River in North Queensland, Australia. These soils were used to grow C. cunninghamiana seedlings at the laboratory glasshouse (LSTM, Montpellier). After one year of growth, twenty carefully cleaned root tips of five mm each and ten also carefully cleaned actinorhizae were harvested on one plant from each soil. Root tips and
actinorhi-zae were then separately crushed in 500 111 sterile distilled water using Piston Pellets® (Bioblock, Illkirch, France). For each of the six crushing, 300 111 of a diluted suspension (I0-1, I0-2 and I0-3) were plated into Petri dishes containing Tryptic Soy Agar (TSA) (Difco-Fischer, Elancourt, France), Luria Broth (LB) (Difco-Fischer, Elancourt, France) or Yeast Mannitol Agar (YMA) (Vincent, 1970). After two days of incubation (25 °C}, bacte-rial colonies were isolated on to Nutrient Agar (NA) (Difco-Fischer, Elancourt, France) in order to get a first reliable phenotypic characterisation. Isolates were stored in 30% w/w glycerol at -80
oc
(LSTM, Montpellier).B. Method applied to select helper bacteria
Testing one by one each bacterial isolate for its effect on C. cunninghamiana-Frankia would have been a very heavy procedure especially given the large number of isolates obtained. Moreover, putative positive interactions between bacterial isolates cannot be observed in a one by one procedure. Consequently a method based on the effects of mix-tures of bacterial isolates on C. cunninghamiana inoculated by Frankia has been develo-ped. In a first step, a mixture of all bacterial isolates was tested for its ability to increase C. cunninghamiana growth in the presence and in the absence of Frankia. In the case of a positive response, two new mixtures (A and B) composed of half of the bacterial isolates initially used and randomly chosen are tested for their effects on C.
cunninghamiana-Frankia growth in a second step. Bacterial isolates used in mixture that have a positive effect on C. cunninghamiana-Frankia growth were then separated again into two new mix-tures (C and D) composed of half of the bacterial isolates used in mixture A or B. Mixmix-tures C and D were tested for their effects on C. cunninghamiana-Frankia growth. The proce-dure is driven step by step until the test of pure bacterial isolates (Fig. I). For each mixtu-re or lastly for single bacterial strain, the average growth mixtu-response to inoculation of ten individuals of C. cunninghamiana was estimated after two months of growth in the pre-sence and in the abpre-sence of Frankia by the measurement of four growth parameters: root dry weight (ROW), shoot dry weight (SOW), root length (RL) and shoot length (SL). Mixtures or strains having a non-significant effect on growth parameters were excluded of the process. Mixtures that had a significant effect on growth parameters were maintained in the process until single strain was obtained.
C. Preparation of bacterial and Frankia inoculum
Bacterial isolates were incubated two days at 28
oc
in 30 ml tubes containing Nutrient Broth liquid medium (Difco-Fischer, Elancourt, France). In each culture, the estimated number of bacterial cells (DO 600 nm) is 7. 106. Hundred 111 of each bacterial culture were mixed together. The mix was centrifuged (I 0,000 g for I 0 min at 4oq
two times and re-suspended in physiological water (NaCI 9 g/1). Lastly, the pellet was re-re-suspended in the initial volume of HA medium and used for inoculation.Frankia strain ORS021001 (synonym Cjl) originally isolated from
Casuarinajunghu-niana Miq. (Diem & Dommergues, 1983) and reported as infective and effective on the genus Casuarina in field conditions (Sougoufara et a/., 1987) was chosen. In order to obtain Frankia culture only composed of young vegetative hyphae, the strain has been sub-cultured three times for eight to ten days. Frankia culture is placed in sterile ten ml tubes and centrifuged ( 10,000 g for 10 min at 4 °C}. The pellet obtained is washed three times in sterile BAP medium (Murry eta/., 1984) before being disrupted into small hypha) frag-ments by passages through a 0.8 mm diameter needle and used for inoculation.
Fig. 1.- Scheme of the method adopted for the selection of Casuarina cunninghamiana-Frankia helper bacteria.
Fig. 1.- Schema de Ia methode adoptee pour Ia selection des bacteries associees
a
Ia sym-biose Casuarina cunninghamiana-Frankia .D. In vitro cultivation of C. cunninghamiana and inoculation with Frankia and bacte-ria
Seeds of C. cunninghamiana collected from the outskirts of Rabat (Morocco) have been soaked in sterile water for 24 h before being surface sterilised using H202 (30%) for 40 min. Seeds are then kept in sterile distilled water for 80 min before being rinsed three times with sterile distilled water. Surface sterilised seeds are then placed in Petri dishes on water agar (7 g/1) for germination. Ten to fourteen-days old germinations are transferred into 22x220 mm glass tubes closed by plastic hood containing a diluted (1/4) Hoagland &
Amon (HA) (1938) nutrient solution and a paper foil (CYG Seed Germination Pouch®, Minneapolis MN, USA) to support the seedling (Vergnaud eta/., 1985). After a four weeks cultivation period, a nitrogen-free HA nutrient solution was used to replace the initially used HA with nitrogen. The HA nitrogen-free nutrient solution was weekly renewed until inoculation.
Ten-weeks old C. cunninghamiana seedlings were inoculated with 100 Jll of bacterial inoculum and 500 Jll of Frankia Cj 1 inoculum.
E. Molecular characterisation of pure helper bacteria strains
A loopful of bacterial cells was suspended in twenty Jll of sterile water in an Eppendorf tube for preparing DNA for the polymerase chain reaction (PCR). The cell suspension was boiled in water for five min for lysing the cells. The cell debris was removed by centrifu-gation at 13,000 rpm for one min at room temperature. Two Jll of the supernatant was used as a template for PCR. Twenty-five Jll of reaction mixture containing 200 JlM of each deoxynucleoside triphosphate, 0.8 JlM of each primer, 1.5 mM of MgCI2, 1.25 U ofTaq DNA polymerase (Promega, Charbonnieres, France) and the buffer supplied with the enzy-me was used for PCR amplification by a Perkin-Elenzy-mer model2400 thermocycler.
The oligonucleotides (Eurogentec) used for priming PCR were derived from the 16S and the 23S rDNA genes flanking the internal transcribed spacer. They had the following sequences:
5' CCTGGGGAGTACGGTCGCAAG 3', 213, sense; Escherichia coli numbering 882 to 902, and 5' CCGGGTTTCCCCATTCGG 3', FGPL 2054, antisense, beginning ofthe 23S gene.
The PCR was done as follow: initial denaturing at 94
oc
for three min followed by 35 cycles consisting of denaturing at 94oc
for 30 s, one min at an annealing temperature of 55 °C, followed by a three min primer extension at 72oc.
After a final elongation step at 72oc
for 3 min, the PCR products were run on a I% agarose gel (Sigma) in TAE buffer with a DNA size standard (Eurogentec Smartladder). The amplified 1630-bp fragment obtained was purified with a QIAquick Gel Extraction Kit (Qiagen, France). A 630-pb por-tion of 16S rDNA was sequenced on both strands using the following internal sequencing primers: 5' CCTGGGGAGTACGGTCGCAAG 3', 213, sense; Escherichia coli numbering 882 to 902, and 5' AAGGAGGGGATCCAGCCGCA 3', FGPS 1509, 33, antisense, at the end of 16S rDNA (Normand eta/., 1996).Sequencing reactions were analysed on an Applied Biosystems model 310 DNA auto-mated sequencer with BigDye Terminator chemistry. The l6S rDNA sequences were sub-mitted to the GenBank nucleotide sequence database (www.ncbi.nlm.nih.gov) by using the algorithm BLASTN for identifying the most similar 16S rDNA sequences.
III. RESULTS
A. Isolation of bacteria
A total of 50 bacteria were isolated from C. cunninghamiana rhizosphere. Twenty-seven isolates were obtained from roots and 23 from actinorhizae. The origin of soils, Cape Hillsborough Road, Herveys Range and Haughton River did not seem affect to the number of bacterial isolates obtained: respectively eighteen, eighteen and fourteen.
B. Selection of bacterial isolates for their effect on C. cunninghamiana-Frankia grow-th
Data of plant growth from each steps of the selection process are presented in Figures 2 and 3. In the first step the four growth parameters examined (SH, SDW, RL and RDW) pre-sent an important enhancement only when C. cunninghamiana were inoculated with both
Frankia and the mixture of the 50 bacterial isolates. These results bring evidence of the pre-sence of one or several helper bacteria possessing a meaningfully positive effect on C.
cun-ninghamiana growth in the presence of Frankia. Indeed, SH was increased significantly (P < 0.0 I) by a factor 3.3, SDW by a factor I ,9 (P < 0.0 I), RL by a factor 5.8 (P < 0.0 I) and RDW by a factor 2.1 (P < 0.0 I) compared to the mean of all other treatments not signi-ficantly different (P < 0.05). In the following steps of the selection scheme similar effects were obtained on C. cunninghamiana growth in the presence of Frankia until the obtaining of a mixture composed of only two bacterial isolates. The last step, pure single isolates tes-ting, permitted to characterize the effect of isolate J able to increase significantly (P < 0.0 I) SH by a factor 2.6, SDW by a factor 1.8, RL by a factor 6.3 and RDW by a factor 2.0; iso-late K was able to increase significantly (P < 0.0 I) SH by a factor 2.3, SDW by a factor 1.8, RL by a factor 4. 7 and RDW by a factor 1.4 compared to the mean of all other treat-ments were not significantly different (P < 0.05).
As these helper bacteria only acted on C. cunninghamiana in the presence of Frankia, we propose to call it "Frankia auxiliary bacteria" (FAB). Isolate J will now be called FABI and isolate K, FAB2. Notwithstanding, it is remarkable that whatever the inoculum com-bination tested, C. cunninghamiana systematically failed to form actinorhizae in our strict-ly axenic conditions.
C. Phenotypic and molecular characterisation of Frankia auxiliary bacterial strains FABl and FAB2
Strains FAB I (STM2341) and FAB2 (STM2342) have been isolated from the twenty root apices of the C. cunninghamiana cultivated on the soil collected at Herveys Range. When cultivated on NA, the strain STM2341 formed smooth yellow-hyaline round-convex colonies of one to four mm in diameter; the comparison of 16S rDNA sequences (BLASTN) with databank sequences shows similarity 99% (562/565) for STM2341 with
Bacillus sp. KL-052 (AY030327). In the same cultivation conditions, the strain FAB2 forms rough white-opaque round-convex colonies of 2 mm in diameter; BLASTN results indicate 99% (573/576) for STM2342 with Ochrobactrum sp. LUP21 (AY457038). STM2341 and STM2342 16S rDNA sequences have been deposited in GenBank nucleoti-de sequence database respectively unnucleoti-der accession number AY690663 and AY690662.
Fig. 2.- Effect of inoculation with mixtures or single pure strains of Casuarina cunningha-miana rhizospheric bacterial isolates and Frankia Cj1 on C. cunninghamiana shoot grow-th. A: Shoot height in em; 8: Shoot dry weight in g.
Legend: Step 1 to step 6 are as described in Fig. 1. Cj+ T50: C. cunninghamiana inocu-lated with Frankia Cj1 and the mixture of 50 bacterial isolates; Cj: C. cunninghamiana ino-culated with Frankia Cj1; T50: C. cunninghamiana inoculated with the mixture of 50 bacterial isolates; C.Un: Uninoculated controle. Cj+A to Cj+l: C. cunninghamiana inocu-lated with mixtures A to I (Fig. 1) and Frankia Cj1; A to 1: C. cunninghamiana inoculated with mixtures A to I (Fig. 1 ); Cj+J and Cj+K: C. cunninghamiana inoculated with single pure strain (Fig. 1) and Frankia Cj1; J and K: C. cunninghamiana inoculated with single pure strain. The white part at the top of the bars within histogram represents standard errors.
Fig. 2.- Effets de !'inoculation avec des melanges ou des souches pures de bacteries rhi-zospheriques de Casuarina cunninghamiana et de Frankia Cj1 sur Ia croissance des tiges de C. cunninghamiana. A : Hauteur des tiges en em ; 8 : Poids sec des tiges en g. Legende : Les etapes 1
a
6 sont decrites Fig. 1. Cj+ T50 : C. cunninghamiana inocule parFrankia Cj1 et le melange de 50 isolats bacteriens; Cj : C. cunninghamiana inocule par
Frankia Cj1 ; T50 : C. cunninghamiana inocule par le melange de 50 isolats bacteriens ; C.Un: Temoin non inocule. Cj+A to Cj+l : C. cunninghamiana inocule par le melange A
a
I (Fig. 1) et Frankia Cj1 ; Aa
I : C. cunninghamiana inocule par le melange Aa
I (Fig. 1) ; Cj+J et Cj+K : C. cunninghamiana inocule par une souche pure (Fig. 1) et FrankiaCj1 ; Jet K: C. cunninghamiana inocule par une souche pure. Les erreurs standard sont figurees dans les histogrammes par Ia partie blanche au sommet des barres.
Fig. 3.- Effect of inoculation with mixtures or single pure strains of Casuarina cunningha-miana rhizospheric bacterial isolates and Frankia Cj1 on C. cunninghamiana root grow-th. A: Root length in em; 8: Root dry weight in g.
Legend: idem Fig. 2.
Fig. 3.- Effets de !'inoculation avec des melanges ou des souches pures de bacteries rhi-zospheriques de Casuarina cunninghamiana et de Frankia Cj1 sur Ia croissance des racines de C. cunninghamiana. A : Longueur des racines en em ; 8 : Poids sec des racines en g.
Legende : idem Fig. 2.
IV DISCUSSION
A. Selection scheme
Selection scheme applied to obtained bacterial isolates able to improve plant growth or symbiotic association is generally poorly detailed (e.g. Fages & Mulard, 1988; Garno &
Ahn, 1991 ). The method developed by Duponnois and Garbaye ( 1991) to isolate helper bacteria from the Douglas fir-Laccaria laccata symbiosis and slightly modified by Poole
ectomy-corrhizas is based on a first phenotypical and physiological selection of the bacteria. Representative of each phenotypical and physiological groups are tested on the symbiosis reducing thus the number of tests to undertake. In a last step, bacteria belonging to groups having a significant effect were all tested. The putative presence of helper bacteria in the other groups was totally neglected. Our method was based on the test of all obtained iso-lates within mixtures until the obtaining of single strains. Bacterial isoiso-lates able to genera-te a significant growth effect on a plant when applied in a complex mixture of bacgenera-terial isolates that could be supposed effective and competitive toward the root native microflo-ra. We develop this new method to explore a wider biodiversity of bacteria without any other a priori assumption than the choice of cultivation media.
B. Hypotheses on the action ways of STM2341 and STM2342 strains on C.
cunnin-ghamiana growth
In order to explain the stimulation of C. cunninghamiana growth, three hypotheses
could be suggested.
The first hypothesis involves an increase in phyto-hormones responsible for root length enhancement. The ability of plant growth promoting rhizobacteria (PGPR) to produce phy-siologically active growth substances, for example indol-3-acetic acid (IAA), has been related to their growth promoting effect (Barbieri et a/., 1986; Loper & Schroth, 1986).
Srinvasan eta/. (1996) demonstrated that IAA produced by Bacillus isolates promoted root
growth and nodulation when co-inoculated with Rhizobium etli on Phaseolus vulgaris.
Duponnois ( 1992) showed that mycorrhization helper bacteria MHB associated with the Douglas fir-Laccaria laccata symbiosis produced IAA- most of them even in
tryptophan-free medium - and that exogenous IAA stimulated short root initiation on Douglas fir seedlings. Accordingly, Chan way et a/. ( 1991) suggested that the growth promotion of pine
by Bacillus polymyxa resulted from the production of hormones, including IAA, which
promotes the formation of lateral roots. So Gary eta/. (2002) showed that most of the
bac-teria, isolated from Pinus sylvestris-Sui/lus luteus mycorrhizas promoted growth of S. luteus. Olubukola et a/. (2003) and Glick et a/. (1998) demonstrate that PGPR effect
should result in the activity of 1-amino-cyclopropane-1-carboxylic (ACC) deaminase. However, the role of ACC deaminase in the root colonizing bacteria remains unknown (Wang eta/., 2000). The increase in RL by a factor 6.3 and 4. 7 respectively with STM2341
and STM2342 may result in the production of IAA.
The second hypothesis concerns modification in the chemical composition of the medium. Nylund ( 1988) and Wallander and Nylund ( 1991) showed that the nutrient balan-ce of the plant (mostly nitrogen and phosphorus) is a key factor in mycorrhizal develop-ment; by mobilizing mineral ions or by competing for nutrient uptake rhizospheric bacteria play an important role in plant growth. Olivier and Mamoun ( 1988) then Mamoun and Olivier ( 1989a, 1989b, 1990) showed changes in pH induce by the formation of complex of ions by siderophore produced by Pseudomonasjluorescens associated with hazel-Tuber melanosporum ectomycorrhizas. Mycorrhiza helper bacteria are also able to complement
siderophore production modifying thus the whole root-fungus equilibrium (Garbaye, 1994 ). The metabolic activity of the FAB may modify the physico-chimical properties of the medium resulting in a higher availability of nutrients for the plants. For example,
Ochrobactrum anthropi rapidly metabolises ammonium and methylammonium in
N-methylglutamate and gamma-N-methylglutamine modifying nitrogen availability for plant (Ewen et a/., 2000). Nitrogen fixation should also be considered as a possible reason of
have been demonstrated to stimulate the growth of the fungus by releasing ammonium (Rambelli, 1973 ). Li et a/. (1992) found that the tuberculate ectomycorrhizas formed by
Rhizopogon vinico/or with Douglas fir contained nitrogen-fixing, spore-forming Bacillus
sp., and that water extracts from the fungal tissues of the tuberculate mycorrhizal clusters enhanced nitrogenase activity of the bacteria, suggesting close nutritional relationships between the two microorganisms.
In the third hypothesis, FAB may help the growth of the nitrogen-fixing Frankia. A highly significant correlation between the ability of the bacterial isolates to reduce or pro-mote mycelial growth of Laccaria /accata and their effect on mycorrhiza formation has been observed (Duponnois, 1992). Garbaye and Bowen ( 1989) showed that bacteria isola-ted from Pinus radiata-Rhizopogon /uteo/us ectomycorrhiza can limit or enhance mycor-rhizas and growth of mycelium in the soil. Mycorrhiza helper bacteria associated with
Hebe/oma crustu/iniforme. Paxi//us invo/utus and Laccaria /accata excreted some organic acids (predominantly malate and citrate), which represent a carbon source as efficient as glucose for fungal growth (Duponnois, 1992; Duponnois & Garbaye, 1990; Garbaye & Duponnois, 1990). In fact, of Frankia biomass seems to be increased in the presence of FAB. The effects of FAB on Frankia growth have to be explored.
C. Potential role of STM2341 and STM2342 strains in in vitro actinorhizae formation
The first Casuarina-infective Frankia strain was isolated in 1983 by Diem and Dommergues. This publication reported that actinorhizae formation has never been repor-ted with Casuarina under strictly axenic conditions. Since then, actinorhizae formation has been obtained in cultivation system like Gibson tubes or Petri dishes with aerial parts of the plant outside the tube or the dish (Sougoufara et a/., 1987). We cannot consider that these systems permit to warrant strictly axenic conditions over several months. The diffe-rent mixtures of bacteria tested failed to promote actinorhizae formation in C. cunningha-miana inoculated by Frankia yet the infectivity of Frankia Cj I has been confirmed under non-axenic conditions. If FAB seems not to be involved in actinorhizae formation, a clo-sely related strain ofSTM2342 isolated from root nodule of the nitrogen-fixing tree Acacia mangium is reported for its ability to form nitrogen-fixing nodules on A. mangium, A. a/bi-da and Paraserianthes fa/cataria (Ngom eta/., 2004). The involvement of STM2342 in actinorhizae formation and in legume nitrogen-fixing nodules has to be explored. Strains of Bacillus sp. CECT450, closely related to STM2341 have been shown to improve root nodules formation of Phaseo/us vulgaris inoculated with Rhizobium tropici CIAT899 (Camacho eta/., 200 I). Similar effects are not observed on C. cunninghamiana-Frankia
actinorhizae formation in our axenic conditions. A promoting effect of FAB I in other conditions enabling actinorhizae formation has to be explored.
Acknowledgements -The authors are indebted to Paul Reddell and Sue Joyce (CSIRO, Australia) for their help with soil, root and actinorhizae collection in North Queensland.
REFERENCES
Arahou M. & H.G. Diem, 1997.- Iron deficiency induces cluster (proteoid) root formation in Casuarina glauca. PlantandSoi1,196, 71-79.
Arahou M., H. Zaid & H.G. Diem, 1996.- Effects of iron and phosphorus on the growth and nodulation of
Casuarina glauca led with KN03 or dependent on symbiotically fixed-nitrogen. In: Recent Casuarina
Research and Development. K. Pinyopusarerk, J.W. Turnbull & S.J. Midgley (eds), CSIRO, Canberra, 44-50.
Barbieri P., T. Zanelli, E. Galli & G. Zanetti, 1986.- Wheat inoculation with Azospirillum brasilense Sp6 and some mutants altered nitrogen fixation and indole-3-acetic acid production. FEMS Microbiology Letters,
36, 87-90.
Camacho M., C. Santamaria, F. Temprano, D.N. Rodriguez-Navarro & A. Daza, 2001.- Co-inoculation with Bacillus sp. CECT450 improves nodulation in
Phaseolus vulgaris L. Can. J. Microbiology, 47, 1058-1062.
Chanway C.P., R.A. Radley & F.B. Holl, 1991.-lnoculation of conifer seed with plant growth promo-ting Bacillus strains causes increased seedling emer-gence and biomass. Soil Bioi. and Bioch., 23, 575-580.
Diem H.G. & Y.R. Dommergues, 1983.- The isolation of
Frankia from nodules of Casuarina. Can. J. Botany,
61, 2822-2825.
Duponnois R., 1992.- Les bacteries auxi/liaires de Ia mycorhization du Douglas (Pseudotsuga menziesii
(Mirb.) Franco) par Laccaria laccata souche S238.
PhD thesis, University Henri Poincare, Nancy, France,
p.
Duponnois R. & J. Garbaye, 1990.- Some mechanisms involved in growth stimulation of ectomycorrhizal fungi by bacteria. Can. J. Botany, 68, 2148-2152. Duponnois R. & J. Garbaye, 1991.- Mycorrhization
hel-per bacteria associated with Douglas lir-Laccaria lac-cata symbiosis: effects in aseptic and in glasshouse conditions. Ann. Sci. Forestieres, 48, 239-251. Duponnois R. & J. Garbaye, 1991.- Effect of dual
inocu-lation of Douglas fir with the ectomycorrhizal fungus
Laccaria laccata and mycorrhization helper bacteria (MHB) in two bare-root forest nurseries. Plant and Soil, 138, 169-176.
Ewen H., H. Kaltwasser & T. Jahns, 2000.- Ammonium and methylammonium uptake in a fertilizer-degrading strain of Ochrobactrum anthropi. Antonie Van Leeuwenhoek, 77, 263-270.
Fages J. & D. Mulard, 1988.- lsolement de bacteries rhi-zospheriques et eifel de leur inoculation en pots chez
Zea mays. Agronomie, 8, 309-314.
Garno T. & S.B. Ahn, 1991.- Growth-promoting
Azospirillum spp. isolated from the roots of several non-gramineous crops in Japan. Soil Science and Plant Nutrition, 37, 455-461.
Garbaye J., 1994.- Tansley Review No. 76; Helper bac-teria: a new dimension to the mycorrhizal symbiosis.
New Phytologist, 128, 197-210.
Garbaye J. & G.D. Bowen, 1989.- Stimulation of mycor-rhizal infection of Pinus radiata by some microorga-nisms associated with the mantle of ectomycorrhizas.
New Phytologist, 112, 383-388.
Garbaye J. & R. Duponnois, 1992.- Specificity and func-tion of mycorrhizalion helper bacteria (MHB) associa-ted with Pseudotsuga menziesii-Laccaria laccata
symbiosis. Symbiosis, 14, 335-344.
Gary D.B., J.P. Elizabeth; M.W. John & J.R. David, 2002.- Characterization of bacteria from Pinus sylves-tris-Suillus luteus mycorrhizas and their effects on root-fungus interactions and plant growth. FEMS Microbiology Ecology, 39, 219-227.
Glick B.A., D.M. Penrose & J. Li, 1998.- A model for the lowering of plant ethylene concentrations by plant growth-promoting bacteria. J. Theor. Bioi., 190,63-68. Grimes H.D. & M.S. Mount, 1984.- Influence of
Pseudomonas putida on nodulation of Phaseolus vul-garis. Soil Biology and Biochemestry, 16, 27-30. Hewit E.J. & G. Bond, 1961.- Molybdenum and the
fixa-lion of nitrogen in Casuarina and Alnus root nodules.
Plant and Soil, 24, 159-175.
Hewit E.J. & G. Bond, 1966.- The cobalt requirement of non-legume root nodule plants. J. Experim. Botany,
17, 480-491.
Hoagland D.R. & D.l. Amon, 1938.-The water culture medium method for growing plants without soil.
University of California, College of Agriculture, Agricultural Experiment Station, Circular 347, Berkeley, USA.
lruthayathas E.E., S. Gunasekaran & K. Vlassak, 1983.-Effect of combined inoculation of Azospirillum and
Rhizobium on nodulation and N2-fixation of winged bean and soybean. Sci. Hortic., 20, 231-240. ltzigsohn R., Y. Kapulknik, Y. Okon & A. Dovrat,
1993.-Physiological and morphological aspects of interac-lions between Rhizobium meliloti and alfalfa
(Medicago sativa) in association with Azospirillum brasilense. Can. J. Microbiology, 39, 610-615. Knowlton S., J.O. Dawson & J.G. Torrey,
1980.-Evidence that associated soil bacteria may influence root hair infection of actinorhizal plants by Frankia. Can. J. Botany, 26, 971-977.
Li D.M. & M. Alexander, 1990.- Faclors affecting co-ino-culation with antibiotic producing bacteria to enhance rhizobia! colonization and nodulation. Plant Soil, 129,
195-201.
Li C.Y., H.B. Massicote & L.V.H. Moore, 1992.- Nitrogen-fixing Bacillus sp. associated with Douglas-fir tubercu-late ectomycorhizae. Plant and Soil, 140, 35-40. Loper J.E. & M.N. Schroth, 1986.- Influence of bacterial
sources of indole-3-acetic acid on root elongation of sugar beet. Phytopathology, 76, 386-389.
Mamoun M. & J.M. Olivier, 1989a.- Dynamisme des populations fongiques et bacteriennes de Ia rhizo-sphere de noisetiers truffiers. II - Chelation du fer et repartition taxonomique chez les Pseudomonas fluo-rescents. Agronomie, 9, 345-351.
Mamoun M. & J.M. Olivier, 1989b.- Effect of soil
ectomycorrhizal species Tuber melanosporum and their competitors. Plant and Soil, 139, 265-273. Mamoun M. & J.M. Olivier, 1990.- Dynamisme des
popu-lations fongiques et bacteriennes de Ia rhizosphere de noisetiers truffiers. Ill - Ellet du regime hydrique sur Ia mycorrhization et Ia microflore associee. Agronomie,
10, 77-84.
Massicotte H.B., R.L. Peterson, C.A. Ackerley & Y. Piche, 1986.- Structure and ontogeny of Alnus crispa-Aipova diplophloeus ectomycorrhizae. Can. J.
Botany, 64, 177-192.
Murry M.A., S.M. Fontaine & J.G. Torrey, 1984.- Growth kinetics and nitrogenase induction in Frankia sp. HFP Ar13 grown in batch culture. Plant and Soil, 78,61-78. Ngom A., Y. Nakagawa, H. Sawada, J. Tsukahara, S. Wakabayashi, T. Uchuimi, A. Nuntagij, S. Kotepong, A. Suzuki, S. Higashi & M. Abe, 2004.- A novel sym-biotic nitrogen-fixing member of the Ochrobactrum
clade isolated from nodules of Acacia mangium. J.
Gen. Applied Microbilogy, 50, 17-27.
Normand P., S. Orso, B. Cournoyer, P. Jeannin, C. Chapelon, J. Dawson, L. Evtushenko & A.K. Misra, 1996.- Molecular phylogeny of the genus Frankia and related genera and emendation of the family Frankiaeceae. Int. J. System. Bacteriology, 46, 1-9. Nylund J.E., 1988.- The regulation of ectomycorrhiza
for-mation-carbohydrate and hormone theories revisited.
Scand. J. Forest Research, 3, 465-470.
Olivier J.M. & M. Mamoun, 1988.- Dynamisme des popu-lations fongiques et bacteriennes de Ia rhizosphere de noisetiers truffiers. I - Relations avec le statut hydrique du sol. Agronomie, 8, 711-717.
Olubukola O.B., 0.0. Ellie, I.S. Abiodun, D.O. George &
D.B. Wallace, 2003.- Amplification of 1-amino-cyclo-propane-1-carboxylic (ACC) deaminase from plant growth promoting rhizobacteria in Striga-infested soil.
Afr. J. Biotechnology, 2, 157-160.
Perine! P. & M. Lalonde, 1983.-In vitro propagation and nodulation of the actinorhizal host plant Alnus glutino-sa (L.) Gaertn. Plant Science Letters, 29, 9-17. Poole E.J., G.D. Bending, J.M. Whipps & D.J. Read,
2001.- Bacteria associated with Pinus sylvestris-Lactarius rufus ectomycorrhizas and their effects on mycorrhiza formation in vitro. New Phytologist, 151, 743-751.
Rambelli A., 1973.- The rhizosphere of mycorrhizae. In: Ectomycorrhizae, their ecology and physiology. G.C. Marks & T.T. Kozlowski (eds), New York Academic Press, 299-349.
Richards J.W., G.D. Krumholz, M.S. Cheval & L.S. Tisa, 2002.- Heavy metal resistance patterns of Frankia
strains. Appl. Environmental Microbiology, 68, 923-927.
Sanginga N., S.K.A. Danso & G.D. Bowen, 1989.-Nodulation and growth response of Allocasuarina and
Casuarina species to phosphorus fertilization. Plant and Soil, 118, 125- 132.
Sougoufara B., H.G. Diem & Y.R. Dommergues, 1987.-Response of field-grown Casuarina equisetifolia to inoculation with Frankia strain ORS 021001 entrap-ped in alginate beads. Plant and Soil, 118, 133-137. Sougoufara B., E. Duhoux, M. Corbasson & Y.R.
Dommergues, 1987.- Improvement of nitrogen fixa-tion by Casuarina equisetifolia through clonal selec-tion. Arid soil research and rehabilitation, 1, 129-132. Srinivasan M., D.J. Petersen & F.B. Holl, 1996.-lnfluence of Indoleacetic-acid-producing Bacillus iso-lates on the nodulation of Phaseolus vulgaris by
Rhizobium etli under gnotobiotic conditions. Can. J. Microbiology, 42, 1 006-1 014.
Vergnaud L., A. Chaboud, Y. Prin & M. Rougier, 1985.-Preinfection events in the establishment of Ainus-Frankie symbiosis. Development of a spot-inoculation technique. Plant and Soil, 87, 67-78.
Vincent J.M., 1970.- A manual for the practical study of the root-nodule bacteria. lntemational Biological pro-gram, handbook 15, Oxford, Blackwell Scientific Publication, 164 p.
Wallander H. & J.E. Nylund, 1991.- Effects of excess nitrogen on carbohydrate concentration and mycorrhi-zal development in Pinus sylvestris L. seedlings. New Phytologist, 119, 405-411.
Wang C., E. Knill, B.R. Glick & G. Defago, 2000.- Effect of transferring 1-amino-cyclopropane-1-carboxylic acid (ACC) deaminase genes into Pseudomonas fluo-rescens strain CHAO and its gacA derivative CHA96 on their growth-promoting and disease-suppressive capabilities. Can. J. Microbiology, 46, 898-907. Yang Y., 1995.- The effect of phosphorus on nodule
for-mation and function in the Casuarina-Frankia symbio-sis. Plant Soil, 176, 161-169.
