• No results found

View Download

N/A
N/A
Protected

Academic year: 2020

Share "View Download"

Copied!
6
0
0

Loading.... (view fulltext now)

Full text

(1)

Name: Date:

Unit 4 Assessment:

DNA Replication and Protein Synthesis

1. Which is a correct example of the base-pairing rule within the Watson-Crick double-helix model of DNA? (SC.912.L.16.3) a. guanine-adenine

b. adenine-thymine c. thymine-guanine d. cytosine-thymine

2. Which of the following is an improper base pair? (SC.912.L.16.3) a. purine – pyrimidine

b. guanine – cytosine c. thymine – adenine d. adenine – cytosine

3. Thirty percent of bases in a sample of DNA extracted from a cell is guanine. What percentage of cytosine is present in this DNA molecule? (SC.912.L.16.3)

a. 10% b. 20% c. 30% d. 40%

4. Forty percent of bases in a sample of DNA extracted from a cell is adenine. What percentage of guanine is present in this DNA molecule? (SC.912.L.16.3)

a. 10% b. 20% c. 30% d. 40%

5. Why is DNA replication necessary? (SC.912.L.16.3) a. it is not – not all cells have to copy their DNA

b. DNA replication must occur in all cells prior to cell division to ensure the conservation of genetic material in new cells c. DNA replication must occur in all cells following to cell division to ensure the conservation of genetic material in new cells d. DNA replication ensures that the information in DNA is not conserved and not passed on to daughter cells.

6. The figure below shows which of the following? (SC.912.L.16.3) a. DNA replication

b. transcription c. translation d. protein synthesis

7. When a cell replicates its DNA, what is the first thing that happens? (SC.912.L.16.3) a. The original DNA strand opens because of Helicase at several places along its length. b. One end of the DNA strand opens because of Helicase and the two sides pull apart. c. The DNA strand flattens out so a new double strand can form on top.

d. Small segments are removed from the original DNA so they can be copied. 8. The primary function of DNA polymerase is to… (SC.912.L.16.3)

a. add nucleotides to the growing daughter strand b. seals gaps along the DNA backbone

c. unwind the parent DNA helix

(2)

9. Which of the following statements describes processes that occur during DNA replication? (SC.912.L.16.3)

a. A DNA sequence is read by RNA polymerase, which produces another RNA strand complementary to the first strand b. Two single stranded segments of DNA are joined by DNA polymerase.

c. Messenger RNA are decoded by a ribososme to produce and amino acid chain. In the cell’s cytoplasm, tRNA reads the mRNA code to form a polypeptide

d. A double stranded DNA is unwound into single strands. DNA polymerase matches the right nucleotides to the single strand so that each template strand forms a complementary strand. The final product is two identical pieces of DNA

10. One side of a DNA strand is being replicated to make a new, complete strand of DNA. The original strand contains the following base sequence: A-T-T-C-G-C. What sequence of bases will be in the strand built from this sequence? (SC.912.L.16.3)

a. A-T-T-C-G-C b. T-A-A-G-C-G c. C-G-G-A-T-A d. U-A-A-C-G-C

11. The leading strand adds nucleotides continuously. Which of the following is true of the lagging strand? (SC.912.L.16.3) a. The lagging strand adds nucleotides in the opposite direction as the leading strand forming Okazaki fragments b. The lagging strand adds nucleotides in the same direction as the leading strand forming Okazaki fragments c. There is no difference between the leading and lagging strands

d. The lagging strand adds nucleotides faster than the leading strand

12. Every cell contains DNA. The main purpose of DNA is to store the cell’s genetic information. How does DNA control the cell? (SC.912.L.16.5) a. DNA activates nerve signals

b. DNA speeds up chemical reactions c, DNA protects the cells from invaders

d. DNA determines which proteins are made within the cell

13. What is the difference in structure between RNA and DNA? (SC.912.L.16.5) a. RNA is double stranded while DNA is single stranded.

b. RNA is single stranded while DNA is double stranded. c. RNA has a 6-carbon sugar while DNA has a 5-carbon sugar. d. RNA has a 5-carbon sugar while DNA has a 6-carbon sugar. 14. How do the functions of DNA and RNA differ? (SC.912.L.16.5)

a. DNA directs protein transport, while RNA aids in energy production. b. DNA aids in energy production, while RNA directs protein transport.

c. DNA stores genetic information, while RNA relays genetic information for protein synthesis. d. DNA relays genetic information for protein synthesis, while RNA stores genetic information.

15. The central dogma of molecular biology states that _____ is transcribed into ______ which is translated into _____ (SC.912.L.16.5) a. genes, polypeptides, proteins

b. protein, RNA, DNA c. DNA, mRNA, tRNA d. DNA, RNA, protein

16. Which of these best describes the correct sequence in the expression of a trait (a trait is a physical characteristic)? (SC.912.L.16.5) A. trait → gene → enzyme

B. gene → protein → trait C. protein → gene → trait D. gene → trait → DNA

17. Transcription results in the formation of… (SC.912.L.16.5) a. proteins

b. rRNA c. mRNA d. tRNA

18. RNA polymerase is the enzyme responsible for which process? (SC.912.L.16.5) a. DNA replication

(3)

19. Introns are DNA sequences that… (SC.912.L.16.5) a. code for functional proteins

b. are removed during post-transcriptional modifications c. do not exist in eukaryotes

d. are attached during post-transcriptional modifications

20. Which of the following does NOT occur during RNA processing (post-transcriptional modifications)? (SC.912.L.16.5) a. Introns are removed from the hnRNA molecule

b. A string of adenine nucleotides is added to the 3’ end of the hnRNA molecule c. A cap is added to the 5’ end of the hnRNA molecule

d. Methyl groups are added to certain nucleotides of the hnRNA molecules

21. Which RNA sequence is produced using the DNA sequence AGC-TAC-ACT? (SC.912.L.16.5) a. UCG-AUG-UGA

b. UCG-UAC-ACU c. TCG-ATG-TGA d. AGC-UAC-ACU

22. According to the diagram, in which step is messenger RNA being constructed? (SC.912.L.16.5) a. I

b. II c. III d. IV

23. Translation results in the formation of…(SC.912.L.16.5) a. proteins

b. rRNA c. mRNA d. tRNA

24. Which step involves transfer RNA? (SC.912.L.16.5) a. I

b. II c. III d. IV

25. In messenger RNA, each codon specifies for a particular… (SC.912.L.16.5) a. nucleotide

b. purine c. amino acid d. pyrimidine

26. Which of the following accurately describes the difference between transcription and translation? (SC.912.L.16.5)

a. In transcription, the genetic code of a DNA molecule is first encoded. Translation is the process of converting the DNA code into code that RNA can use.

b. In transcription, an amino acid chain is encoded in a DNA molecule. Translation is the process of turning the amino acids into nucleic acids in an RNA molecule

c. In transcription, the genetic code of a DNA molecule is transferred to a messenger RNA molecule. Translation is the process of creating an amino acid chain using the encoded messenger RNA.

d. In transcription, a double helix DNA molecule is split into two separate single strands. Translation is the process of joining each single DNA strand with a single strand of matching RNA.

27. How many mRNA nucleotides are needed to code for one amino acid? (SC.912.L.16.5) a. 1

(4)

28. Translate the following mRNA (SC.912.L.16.5) 3’ GAUGGUUUUAAAGUA 5’

a. met-lys-phe-leu-stop b. met-lys-phe-trp-stop c. asp-gly-phe-lys-val d. asp-gly-phe-lys-stop

29.Using the mRNA sequence above, what would happen if there were a frameshift mutation such that first two nucleotides at the 5’ end were deleted? (SC.912.L.16.5)

a. There would be no change in the protein produced b. Met would be switched to Iso

c. the protein would never begin because there is no start codon d. The protein would not have a stop codon so it would continue to grow

30. Given the following DNA sequence, how many amino acids would be in the peptide chain? (SC.912.L.16.5) 5’ TGCTATCCTACGTGTTTATCGATGATATCCCATG 3’

a. 5 b. 7 c. 9 d. 11

31. A strand of mRNA has made it to a ribosome in the cytoplasm and the ribosome has attached to the correct end of it. What is the next thing that will happen? (SC.912.L.16.5)

a. The ribosome will fold the mRNA strand so it becomes a completed protein strand. b. The complementary bases will pair up with the mRNA to make a new DNA strand. c. Amino acids will begin to attach to the correct codons on the mRNA strand.

d. The correct anticodon on a tRNA molecule will match up with the first mRNA codon.

32. An expressed gene is one that…(SC.912.L.16.5) a. functions as a promoter

b. is transcribed and translated into a protein c. codes for only one amino acid

d. is made of mRNA

33. How can there be many different types of proteins when there are only 23 different amino acids? (SC.912.L.16.5) a. there are multiple codons for each amino acid

b. each amino acid can have multiple chemical formulas c. many proteins are not made of amino acids

d. the number and sequence of amino acids can be changed to produce different proteins

34. If the genetic code is a code for proteins, how can organisms have parts made of other types of biological molecules, such as the carbohydrates that make up the cell walls of plants? (SC.912.L.16.5)

a. Other molecules such as mRNA hold the code for creating non-protein molecules within an organism. b. Carbohydrates are created during photosynthesis and do not require genetic information or proteins. c. Enzymes are made of protein and can be used as tools to build other types of molecules.

d. Organisms must take in all of the non-protein molecules they require from their environment.

35. The process of transcription is known to have a less effective “proof-reading” mechanism than the process of DNA replication. What effect does this have on the base sequences produced by transcription? (SC.912.L.16.4)

a. Errors in the base sequences will result in a more damaged strand of DNA than mRNA b. The base sequence of mRNA can be exactly the same as the DNA

c. It is likely there will be more errors on the mRNA than on the DNA as a result of the less effective proof-reading mechanism of transcription

(5)

36. Which of the following best describes the concept of a DNA mutation? (SC.912.L.16.4)

a. DNA mutations are alterations in DNA replication that always result in phenotypic change.

b. A DNA mutation is a change in the way that genes reproduce themselves, which may or may not affect phenotypic characteristics. Mutations are usually due to environmental factors or heredity

c. DNA mutation is a change in the gene sequence, which sometimes results in phenotypic change. Mutations can be due to environmental factors, heredity, or a mistake in DNA replication.

d. DNA mutation is an alteration in the nucleus of a cell that makes certain genes unable to be copied, and they result in phenotypic change. Mutations are usually due to viruses and environmental factors

37. Which of the following does NOT describe a reason genetic mutations may exist in a gene? (SC.912.L.16.4) a. When a cell dies, DNA in the nucleus can mutate

b. Exposure to chemicals and/or radiation can cause mutations in DNA c. Mutations in the DNA of sex cells can be passed down from parent to child

d. Enzymes can make mistakes matching nucleotides during DNA replication and transcription

38. Suppose there is a mutation in your DNA sequence. Does a mutation always result in phenotypic change? (SC.912.L.16.4) a. Yes, every mutation causes a phenotypic change

b. No, some mutations do not cause phenotypic changes because the codon does not change

c. No, some mutations do not cause phenotypic change because there are multiple codons for each amino acid d. Yes, but I do not know why

39. One way in which a point mutation and a deletion mutation are different is that… (SC.912.L.16.4) a. a point mutation is always harmful, and a deletion mutation is never harmful.

b. a point mutation is a physical change, and a deletion mutation is a chemical change.

c. a point mutation always results in a frameshift mutation, while a deletion mutation never results in a frameshift mutation. d. a point mutation only results in a change in a single nucleotide base and thus only one codon, while a deletion causes a frameshift

mutation which result in changes in multiple codons.

40. Not all mistakes in copying DNA (genotypic changes) result in changes to the proteins that are made from the gene (phenotypic changes). For instance, if a DNA sequence that should result in an mRNA codon that reads C-C-C is miscopied so that the codon produced reads C-C-G, no change will occur. Why is this? (SC.912.L.16.4)

a. As long as the new codon stands for the same amino acid as the original codon, there will be no difference in the resulting protein. b. Guanine can be substituted for cytosine in a DNA strand without changing the meaning of the resulting strand of DNA.

c. A large section of the DNA would have to be deleted or miscopied before there would be any functional change to the protein produced. d. Special enzymes check the sequence of amino acids in a completed protein and replace any amino acids that are in the wrong place. 41. Which answer explains why changes like pierced ears or scars in a mother's body are not passed on to her children? (SC.912.L.16.4)

a. Piercing her ears or scars only altered the DNA at the site, not in any of the other cells in her body, so she could not pass them on. b. Only changes to the DNA in her egg cells would be passed on to her children, not changes to the rest of her body.

c. Once the mother's scars or ears had healed, the DNA in those cells was repaired so there would be no changed DNA to pass on. d. The chance of the mutated DNA migrating all the way to her egg cells and getting passed to her children is very low.

42. Which of the following explains why the regulation of gene expression is more complicated in eukaryotes than in prokaryotes? (SC.912.L.16.9) a. Prokaryotic cells are more complicated than eukaryotic cells

b. Eukaryotic cells have fewer genes that need to be expressed

c. Eukaryotic cells are differentiated. As a result, only specific genes should be expressed for the different cells d. Prokaryotic cells are differentiated. As a result, only specific genes should be expressed for the different cells

43. Genes for medically important proteins can be cloned and inser ted into bacteria, as shown in the diagram below. Why can bacteria recognize a human gene and then produce a human protein? (SC.912.L.16.9)

a. DNA replication in bacteria and humans is the same. b. Bacterial cells contain the same organelles as human cells.

c. The basic components of DNA are the same in humans and bacteria. d. Bacterial cells and human cells contain the same kind of chromosomes.

44. The genetic code is nearly universal, meaning that almost all organisms use the same genetic code. Which statement does NOT help explain why the genetic code is universal? (SC.912.L.16.9)

(6)

Unit 4 Reflection Sheet Grade: __________

For the following section, circle the questions you got correct and X the questions you got incorrect

Benchmark: SC.912.L.16.3: Describe the basic process of DNA replication and how it relates to the transmission and conservation of the genetic information.

1 2 3 4 5 6 7 8 9 10 11 _________

Benchmark: SC.912.L.16.5: Explain the basic processes of transcription and translation, and how they result in the expression of genes.

12 13 14 15 16 17 18 19 20 21 22 23 24 25 26

27 28 29 30 31 32 33 34

_________

Benchmark: SC.912.L.16.4: Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result in phenotypic changes in offspring.

35 36 37 38 39 40 41 _________

Benchmark: SC.912.L.16.9: Explain how and why the genetic code is universal and is common to almost all organisms.

References

Related documents

Colonoscopy with pCLE findings indicated the colon in remission, and the UC lesion in the sigmoid colon and rectum showed mild crypt distortion, but no dysplastic cells.. The

Not content with serving as an information centre for research on materials held by the Hong Kong Maritime Museum, the CSSC Maritime Heritage Resource Centre has undertaken its

This guide is a really simple guide, designed to walk you through a quick strategy you can use to not only drive more traffic but get free exposure for your business on the Internet -

Overall, this book is an excellent starting place for scholars of the Arthurian realm, particularly feminist scholars and graduate students interested in enchantresses and

– Object based programming (classes, objects, encapsulation) – Object oriented programming (inheritance, polymorphism) – Generic programming (class and function templates)...

Also, if larger size sheets are stacked on top of smaller size sheets after a job with the Booklet Finishing function specified has been run, the next job may not be delivered

[0011] According to the present invention, it is possible to provide an epoxy resin composition capable of providing a carbon fiber-reinforced composite material that is excellent

meant that most, if not the whole, of the airport, including all the basic airside infrastructure (runways, taxiways and terminals) and related land side facilities were necessary