Introduction to next-generation sequencing data

(1)

Introduction to next-generation sequencing data

Centre for Experimental Medicine Queens University Belfast

http://www.qub.ac.uk/research-centres/CEM/

David Simpson

(2)

Outline

• History of DNA sequencing

• NGS or ‘massively parallel’ sequencing

– How it works: Illumina ‘sequencing by synthesis’

– Library preparation

– Clonal amplification – future single molecule

• Characteristics of the data: Quality control

– Base calling and quality (FastQ format)

• Phasing and homopolymers

– Trimming

– Implications of PCR

• Duplicates and bias

– Contamination

(3)

Sequencing time-line

Andy Vierstraete

2014 : Illumina HiSeq X10 - $1,000 Genome?

(4)

Conventional DNA sequencing

• Dideoxy terminator

– Sanger method

• Fluorescent dyes

• Gel electrophoresis

• 1 lane = 1 sequence

• Capillary electrophoresis

http://www.bio.davidson.edu/Courses/Molbio/MolStudents/

spring2003/Obenrader/sanger_method_page.htm

"G" tube:

All four dNTP's, ddGTP and DNA polymerase

"A" tube:

All four dNTP's, ddATP and DNA polymerase

"T" tube:

All four dNTP's, ddTTP and DNA polymerase

"C" tube:

All four dNTP's, ddCTP and DNA polymerase

Electropherogram

Primer

(5)

Next Generation Sequencing (NGS)

• Process millions of sequencing reads in parallel

• Common concept is the analysis of millions of sequences associated with a solid surface (or in wells)

– Contrast with traditional gel electrophoresis

• Range of platforms available

– Illustrate with Illumina

– Ion Torrent (Life Technologies/Thermo Fisher)

(6)

NGS workflow

Library preparation

Template preparation:

Single molecule

‘clonal’ amplification

Sequencing

RNA DNA

Fragmentation/size selection Addition of adaptors

Bridge PCR on a slide

(cluster generation)

Emulsion PCR

Reversible terminator

(Illumina)

Semiconductor (Ion Torrent)

Single molecule

(Nanopore)

(7)

Overview of DNA-Seq and RNA-Seq

AAAAAAA

Extract RNA cDNA

library

Exon 1 Exon 2

Reference sequence

Align to reference sequence

Fragmented DNA Library

Massively parallel sequencing

>10 million reads

TACATTTGGGAAAAGTAAATTTGCTGAAAATAATCCCGGT AAGAAAGAAACACTTTTCATGTAATTAGCTTTTTTACATC AAACTTCAGAACCCAAAGTCATTGAGAATATTAGGGATCA CAGAACCACATGAGTCAGAATCATCAGAATATCCCACCAA AGGAGAAGGAAGGAGCAGAGGATTCAAAAGGAAATGGAAT GATGAATATGAAGAAATGTCAGAAATGAAAGAAGGGAAAG GAAATTGAATTCGATGAAATAAATGATACTTGCTTATCTG

...

Genomic DNA

(8)

Library preparation

http://res.illumina.com/documents/products/research_reviews/sequencing-methods-review.pdf

(9)

Illumina: Cluster generation

Clonal amplification achieved by generating clusters on the surface of a flow cell (slide)

See SBS technology video at www.illumina.com/

(10)

Massively parallel sequencing

Glowing dots on a glass slide mark cloned DNA being sequenced

(11)

Reading the sequence

• Wash over all 4 nucleotides each with a fluorescent dye

• Only one complementary nucleotide incorporated

(12)

Illumina: Sequencing by synthesis:

• Prepare libraries with different index sequences

• Pool and sequence together – ‘multiplexing’

(13)

Platforms

• Illumina has several instruments

– Desktop-sized MiSeq that can complete smaller runs in under a day – NextSeq 500

– High throughput HiSeq 2500

• Ion Torrent ‘semi-conductor’ sequencing (Life Technologies)

– Fast, cheap entry level, output increasing rapidly – Personal Genome Machine

– Proton

HiSeq 2500 PGM 314 chip Proton P1 chip Total output 600/120 Gb up to 100Mb 10Gb

Run time 11 days/27 hrs 2-4 hrs 2-4 hrs Output/day 55 Gb up to 200 Mb ~20 Gb Read length 2 x 100/150bp up to 400b up to 200bp

# of single

reads 3/0.6 Billion up to 0.6M up to 82 Million

(14)

Ion torrent ‘Semiconductor sequencing’

• No optics required!

Beads with template attached (prepared by emulsion PCR)

Incorporation of a nucleotide changes pH

Detected on a semiconductor sequencing chip

(15)

Signal processing to optimise base calling

• Signal Decay

• Phase correction

– phasing is the rate at which single molecules within a cluster loose sync with each other.

– Incomplete Extension

• Limit read length

Further discussion

Ion torrent: http://biolektures.wordpress.com/2011/08/10/fundamentals-of-base-calling-part-1/

Illumina: http://pathogenomics.bham.ac.uk/blog/2013/11/diagnosing-problems-with-phasing-and-pre-phasing-on-illumina-platforms/

(16)

Read length and quality

• Per base sequence quality

• Phred quality score: Q an integer mapping of p, the probability that the corresponding base call is incorrect

Damien Gregory: http://www.somewhereville.com/?p=1508

(17)

FASTQ format

Nucleotide sequence and associated quality score (represented by ASCI characters)

@PSI179204_0007:4:1:1025:10482#0/1

GAGCAAAATTGTAGAAGAATTCAGGATCTCGTATGCCGTC +PSI179204_0007:4:1:1025:10482#0/1

C-:AC:?5:C-AAA-5>-,A5A>5:A?-DD?5A::>;><B

Flowcell lane & tile

‘X'-and ‘Y’co- ordinates of the cluster

Index of

multiplex sample

Illumina:

P. J. A. Cock, C. J. Fields, N. Goto, M. L. Heuer and P. M. Rice, “The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants.” Nucleic Acids Research, 2010, Vol. 38, No. 6, 1767–1771 doi:10.1093/nar/gkp1137

(18)

Homopolymers (runs of the same nucleotide)

• Illumina: Flow all 4 nucleotides, incorporate single one

• Ion torrent: Sequential flows of individual unmodified nucleotides

Ionogram (Ion torrent)

_EBI

(19)

Trimming

• Quality

– Ends

• Adaptors

– Clip adaptors (fastx clipper)

Insert Adaptor B

Adaptor A Adaptor A Adaptor B

FASTX-toolkit by Assaf Gordon

(20)

Implications of PCR

• Duplicate reads

– Erroneous quantification or variant detection

• Uneven coverage

– Additional sequencing required to achieve minimal coverage

(21)

Single nucleotide resolution

• High specificity

• Show ZEB1 mutation

Mutation:

c.1920G>T p.Gln640His

ZEB1 exon 7

CAG = Gln

CAT = His

(22)

Contamination

• Sample mix ups (!) - indexing

• Carry-over from previous run

• FastQ screen

(23)

Single molecule sequencing: Nanopore

https://www.nanoporetech.com/news/movies#movie-24-nanopore-dna-sequencing

• Single-stranded DNA polymer is passed through a protein nanopore

• Individual DNA bases on the strand are identified in sequence as the DNA

molecule passes through

Oxford Nanopore

(24)

Summary

• NGS works by sequencing millions of reads in parallel

• Library preparation

– Add adaptors to DNA of interest

– Requires clonal amplification (template preparation)

• Sequence data presented in FastQ format

– Quality control critical

• Errors inherent in the technology, eg. Phasing and homopolymers, PCR

• Trimming

– Contamination

(25)