• No results found

Identification of a Novel Transcriptional Repressor Encoded by Human Cytomegalovirus

N/A
N/A
Protected

Academic year: 2019

Share "Identification of a Novel Transcriptional Repressor Encoded by Human Cytomegalovirus"

Copied!
8
0
0

Loading.... (view fulltext now)

Full text

(1)

Copyright © 2001, American Society for Microbiology. All Rights Reserved.

Identification of a Novel Transcriptional Repressor Encoded

by Human Cytomegalovirus

LORIE A. LAPIERRE1†ANDBONITA J. BIEGALKE1,2*

Department of Biomedical Sciences, College of Osteopathic Medicine,1and Molecular and

Cellular Biology Program,2Ohio University, Athens, Ohio 45701

Received 30 January 2001/Accepted 30 March 2001

The expression of human cytomegalovirus (HCMV) genes during viral replication is precisely regulated, with the interactions of both transcriptional activators and repressors determining the level of gene expression. One gene of HCMV, the US3 gene, is transcriptionally repressed early in infection. Repression of US3 expression re-quires viral infection and protein synthesis and is mediated through a DNA sequence, the transcriptional repressive element. In this report, we identify the protein that represses US3 transcription as the product of the HCMV UL34 open reading frame. The protein encoded by UL34 (pUL34) binds to the US3 transcriptional repressive element in yeast and in vitro. pUL34 localizes to the nucleus and alone is sufficient for repression of US3 ex-pression. The data presented here, along with earlier data (B. J. Biegalke, J. Virol. 72:5457–5463, 1998), suggests that pUL34 binding of the transcriptional repressive element prevents transcription initiation complex formation.

Human cytomegalovirus (HCMV) is an important opportu-nistic pathogen and causes disease in transplant recipients, people with AIDS, and neonates (8). Primary infection results in viral replication and is followed by the establishment of a latent infection. Viral replication is a result of the ordered expression of the HCMV genome; both transcriptional activa-tors and repressors are involved in the precise regulation of viral gene expression during the 5-day replication cycle of the virus (46).

Several HCMV proteins are involved in regulating the ex-pression of other viral genes. The two HCMV major immedi-ate-early (mIE) proteins, IE1 and IE2, have important roles as activators of viral gene expression, while IE2 also acts as a autorepressor, repressing the expression of IE1 and IE2 (13, 28, 38, 57; see reference 47 for a review). Other proteins encoded by the virus (UL82, UL37, UL84, and TRS1/IRS1 among others) are also involved in regulating viral gene ex-pression (14–16, 21, 39, 52). The US3 gene is one example of an HCMV gene whose expression is precisely regulated, with its expression influenced positively and negatively by the pro-teins listed above (6). Analyses of US3 transcription suggest that additional as-yet-unidentified cellular or viral proteins also contribute to regulated expression.

The US3 gene is transcribed at immediate-early times of infection, yielding three alternatively spliced transcripts that are predicted to encode related but distinct proteins (58, 62). Expression of the US3 gene causes major histocompatibility complex (MHC) class I heavy chains to be retained in the endoplasmic reticulum (1, 30). Retention of MHC class I heavy chains prevents the presentation of viral antigens on the sur-face of infected cells and is one of the many immune evasion mechanisms utilized by HCMV (27).

In the course of viral infection, US3 expression is initially activated with US3 transcripts accumulating to abundant levels during the first 3 h of infection (3). Following the burst of transcriptional activity, the level of US3 transcripts begins to decline, and by 5 h postinfection there is very little detectable US3 expression. DNA elements that control the pattern of US3 expression include silencer, enhancer, promoter, and transcriptional repressive elements (5, 11, 35, 59, 62).

The decrease in the level of US3 expression is a result of transcriptional repression mediated through the transcrip-tional repressive element (tre [3, 35]). The treis located be-tween the transcription start site and the TATA box (sequenc-es from ⫺18 to ⫹1) and mediates repression of US3 transcription in transient-transfection assays and during viral infection (5, 35).tre-dependent transcriptional repression re-quires viral infection and associated protein synthesis (5). In-terestingly, the tre shares sequence similarity with another DNA element (the cis-repressive sequence, crs [4]) that is involved in IE2 autorepression (13, 38, 48). The similarity in sequence between thetreand thecrssuggested that IE2 might mediate transcription repression of the US3 gene (4). How-ever, in permissive human diploid fibroblasts, IE2 activates rather than represses US3 gene expression, resulting in a ca. 5-to 10-fold increase in expression. In contrast, in cells nonper-missive for viral replication, Lashmit et al. observed an⬃2-fold inhibition of US3 expression by IE2 (35). The significance of IE2 repression of US3 expression in nonpermissive cells is unclear. The following studies were performed to identify pro-tein(s) that interact with the US3treand repress US3 tran-scription. Our data, presented below, identify the HCMV UL34 gene product as a novel sequence-specific DNA-binding protein that acts to repress expression from the US3 promoter.

MATERIALS AND METHODS

Virus, cells, and transfections.HCMV (strain Towne) was obtained from Adam Geballe (Fred Hutchinson Cancer Research Center, Seattle, Wash.) and was propagated in primary human diploid fibroblast (HDF) cultures established from skin tissue samples obtained from O’Bleness Memorial Hospital, Athens, Ohio. Cells were propagated in Dulbecco minimal essential medium

supple-* Corresponding author. Mailing address: Department of Biomedi-cal Sciences, 228 Irvine Hall, Ohio University, Athens, OH 45701. Phone: (740) 593-2377. Fax: (740) 597-2778. E-mail: biegalke@ohiou .edu.

† Present address: Department of Biological Sciences, Ohio Univer-sity, Athens, OH 45701.

6062

on November 9, 2019 by guest

http://jvi.asm.org/

(2)

mented with penicillin, streptomycin, glutamine, and 10% NuSerum (Collabo-rative Research Products, Bedford, Mass.). For transient-transfection assays, primary human diploid fibroblasts (HDFs) were transfected using DEAE-dex-tran as previously described (3). For protein localization studies, HDFs were transfected using Effectene (Qiagen); fluorescent proteins were visualized using a fluorescein isothiocyanate (FITC) filter.

Nuclear extracts.Nuclear extracts were prepared by a modification of the method described by Dignam et al. (17), with all manipulations carried out on ice. Briefly, HDFs were plated in 150-mm dishes and either mock infected or infected with HCMV strain Towne at a multiplicity of infection of 5 PFU/cell. Nuclear extracts were prepared from infected cells at 3 h postinfection (h.p.i.). Cells were rinsed twice with phosphate-buffered saline (PBS) and harvested by scraping cells from each plate into a 1.5-ml microfuge tube. Cells were pelleted by centrifugation for 5 min at 3,000 rpm at 4°C (Eppendorf model 5415C microcentrifuge). Pellets were resuspended in 100␮l of PBS, combined with three to five pellets per tube, and centrifuged as described above. The combined cell pellet was quickly rinsed in hypotonic buffer (10 mM HEPES [pH 7.9 at 4°C], 1.5 mM MgCl2, 10 mM KCl, 0.2 mM phenylmethylsulfonyl fluoride [PMSF], 0.5 mM dithiothreitol [DTT], 1.5⫻ Complete EDTA-free protease inhibitors [Boehringer Mannheim]) at five times the packed cell volume (PCV). The pellet was immediately centrifuged as described above, resuspended in hypotonic buffer at three times the PCV, and incubated for 5 min. The cells were Dounce homogenized gently 10 times in a microtissue grinder (Fisher Scientific) to release nuclei. Nuclei were then pelleted by centrifugation at 4,000 rpm for 8 min. Nuclear proteins were extracted by resuspending the nuclei in extraction buffer (20 mM HEPES [pH 7.9 at 4°C], 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol, 0.2 mM PMSF, 0.5 mM DTT, 1.5⫻protease inhibitors [as described above]) at two times the packed nuclear volume followed by incubation on ice for 1 h. The extraction mixture was centrifuged for 30 min at 13,000 rpm at 4°C. The crude nuclear extract was aliquoted and stored at⫺80°C. Approx-imately 300␮l of nuclear extract (1 to 2 mg/ml) were obtained from 10 150-mm plates.

Electrophoretic mobility shift assays (EMSAs).DNA fragments containing US3 sequences from⫺22 to⫹1 or⫺25 to⫹10 and containing either thetreor a mutanttrewere prepared by annealing purified complementary oligonucleo-tides (oligos) (⫺22 to⫹1 wild-type sequences, oligo 115 [5⬘-TCAAAAACACC GTTCAGTCCACA-3⬘] and oligo 116 [5⬘-TGTGGACTGAACGGTGTTTTTG A-3⬘];⫺22 to⫹1 mutant sequences, oligo 117 [5⬘-TCAAAAACACTGCCCAG TCCACA-3⬘] and oligo 118 [5⬘-TGTGGACTGGGCAGTGTTTTTGA-3⬘];⫺25 to⫹10 wild-type sequences, oligo 123 [5⬘-GATTCAAAAACACCGTTCAGTC CACACGCTACTTC-3⬘] and oligo 124 [5⬘-GAAGTAGCGTGTGGACTGAA CGGTGTTTTTGAATC-3⬘];⫺25 to⫹10 mutant sequences, oligo 125 [5⬘-GA TTCAAAAACACTGCCCAGTCCACACGCTACTCC-3⬘] and oligo 126 [5⬘-G AAGTAGCGTGTGGACTGGGCAGTGTTTTTGAATC-3⬘]). DNA fragments consisting of US3 sequences from⫺58 to⫹32 and with atreor a mutant version were generated by digesting plasmids pBJ171 and pBJ214 (4), respectively, with SnaBI andPstI, followed by gel purification of the DNA fragments. DNA probes were radiolabeled using T4 polynucleotide kinase (New England Biolabs) and [␥-32P]ATP (3,000 Ci/mmol; New England Nuclear).

Binding reactions were carried out as described by Macias et al. (42). Briefly, 15-␮l binding reaction mixtures contained the radiolabeled probe, nuclear ex-tracts, or in vitro translation reaction products and 2␮g of salmon sheared salmon sperm DNA (Gibco-BRL) in binding buffer (25 mM Tris-HCl [pH 8.0], 0.5 mM EDTA, 6.25 mM MgCl2, 0.5 DTT, 9% [vol/vol] glycerol, and 0.01% Nonidet P-40). For the cold competition assays, an excess of nonradioactive DNA fragments was added to the binding reaction mixtures. The protein-DNA complexes were separated from unbound DNA by electrophoresis through 5% polyacrylamide gels (36:1, acrylamide/bisacrylamide ratio) in 0.5⫻TBE (45 mM Tris-borate [pH 8.3], 1.0 mM EDTA) for 2 h at 200 V at 4°C.

Yeast one-hybrid analysis.Total cellular RNA was prepared from HCMV-infected HDFs at 3 h.p.i.; poly(A)⫹RNA was isolated from the total RNA (5 Prime-3 Prime, Inc.) and used as the template for construction of a cDNA library, using the HybriZap 2.1 XR Library Construction kit (Stratagene). The cDNA library contained 2⫻106independent clones. Mass excision was used to convert the HybriZap library to a pAD-GAL4 library.Saccharomyces cerevisiae YM4271 reporter strains were made that contained an integrated␤ -galactosi-dase reporter gene with either three copies of thetreor three copies of the mutatedtreinserted 5⬘of the reporter gene. To generate the stable yeast cell lines, oligos consisting of three copies of the wild-typetre(oligo 167 [5⬘-AATT CCAAAAACACCGTTCAGTCCACACGTCAAAAACACCGTTCAGTCCA CACGTCAAAAACACCGTTCAGTCCACACGTCGACGAT-3⬘] and oligo 168 [5⬘-CTAGATCGTCGACGTGTGGACTGAACGGTGTTTTTGACG TGTGGACTGAACGGTGTTTTTGACGTGTGGACTGAACGGTGTTT

TTG-3⬘) or three copies of the mutanttre(oligo 165 [5⬘-AATTCAAAAACAC TGCCCAGTCCACACGTCAAAAACACTGCCCAGTCCACACGTCAAAA ACACTGCCCAGTCCACACGTCGACGAT-3⬘] and oligo 166 [5⬘-CTAGATC GTCGTCGACGTGTGGACTGGGCAGTGTTTTTGACGTGTGGACTGG GCAGTGTTTTTGACTGTTGGACTGGGCAGTGTTTTTG-3⬘]) were an-nealed and inserted into theEcoRI andSalI sites of the vector, pLacZi (Match-maker One Hybrid System; Clontech). The resulting plasmids, pLacZi-TREwt (pBJ339) and pLacZi-TREmut (pBJ338), were linearized and integrated into the genome ofS. cerevisiaeYM4271 by homologous recombination to obtain the yeast reporter strains YM-TREwt and YM-TREmut. The cDNA library was trans-formed into YM-TREwt; transformants were screened using ␤-galactosidase filter assays to identify positive colonies. Plasmids were isolated from potential positive clones by using the Y-DER Yeast DNA Extraction Reagent Kit (Pierce) and further analyzed for activation of␤-galactosidase activity in the YM-TRE-mut reporter strain. cDNA inserts from positive colonies were partially se-quenced to determine their identity.

Plasmids.UL34 was amplified from genomic HCMV Towne DNA usingPfu polymerase (Stratagene) and primers 218 (5⬘-CGTCTAGAGAATTCATCATG AACTTCATCATCACC-3⬘) and 219 (5⬘-CTCGTCGACTTAAATACACAAC GGGGTTATGG-3⬘). The amplimer was inserted into the Zero-Blunt cloning vector (Invitrogen) to generate pBJ374. The eukaryotic UL34 expression con-struct, pBJ386, was constructed by inserting theXbaI/SalI UL34-containing frag-ment from pBJ374 into pBJ201 (4). The plasmid pBJ384 was constructed by inserting the EcoRI/SalI UL34-containing fragment from pBJ374 into pBS⫹

(Stratagene). A plasmid (pBJ507) expressing UL34 as an in-frame fusion with eukaryotic green fluorescent protein (EGFP) was constructed by inserting the EcoRI/SalI fragment from pBJ374 into pEGFP-C2 (Clontech). The mIE protein expression plasmids have been described previously (7), as have pEQ3 (the promoter-lesslacZplasmid), pBJ201 (3), pBJ171 (the US3 promoter-trereporter gene plasmid), and pBJ214 (4).

In vitro transcription and translation reactions.In vitro transcription and translation reactions were performed using pBJ384 and the TnT7 kit as directed (Promega). Proteins were visualized by autoradiography following electrophore-sis on 10% sodium dodecyl sulfate (SDS)-polyacrylamide gels.

RESULTS

Formation of tre-dependent DNA-protein complexes. The

requirements for US3 transcriptional repression include a spe-cific DNA element (tre) and protein synthesis following viral infection. These requirements suggested that nuclear proteins present in infected cells interact with thetreto repress US3 transcription. The interaction of nuclear proteins with thetre

was examined using EMSAs. Nuclear extracts were prepared from mock-infected HDFs or from HCMV-infected HDFs at 3 h.p.i. US3 transcriptional repression occurs between 3 and 4 h.p.i., suggesting that a repressor protein is present in cells during this time period (3). Radiolabeled double-stranded DNA fragments containing either the repressive element (tre) or a mutated version of thetre(Fig. 1C) were used as probes to assay for binding of the DNA fragments by proteins in the nuclear extracts. Radiolabeled DNA fragments were incubated with the nuclear extracts; the resulting DNA-protein com-plexes were analyzed on native polyacrylamide gels.

DNA fragments containing the tre and consisting of US3 sequences from⫺25 to⫹10, from⫺22 to⫹1, or from⫺58 to

⫹32 were all able to form a unique DNA-protein complex in the presence of nuclear extracts prepared from infected cells (Fig. 1A, lanes 3, 5, and 7 respectively). Radiolabeled DNA probes (⫺25 to⫹10 or⫺22 to⫹1) that contained a mutanttre

(Fig. 1C) (5) were unable to form similar DNA-protein com-plexes (Fig. 1A, lanes 4 and 6). The largest DNA fragment (consisting of sequences from⫺58 to⫹32) formed a tre -de-pendent DNA-protein complex and an additional DNA-pro-tein complex that was independent of the presence of a func-tionaltre(Fig. 1A, lanes 7 and 8). This additional DNA-protein

on November 9, 2019 by guest

http://jvi.asm.org/

(3)

complex is presumed to result from the interaction of the DNA probe with other DNA-binding proteins such as CREB, c-rel, or TBP, binding sites for which are predicted in this region by TFSEARCH (26). Extracts prepared from mock-infected cells were unable to form a DNA-protein complex with DNA frag-ments containing either thetreor the mutant version of thetre

(Fig. 1A, lanes 1 and 2, sequences from ⫺25 to ⫹10). The DNA-protein complexes formed with the two smaller DNA probes (⫺22 to ⫹1 and ⫺25 to ⫹10) had similar rates of migration despite the difference in size between the DNA probes. The similarity in migration rates of the complexes suggests that protein binding to thetre is causing the DNA fragments to bend, or alternatively, that the electrophoretic charge of the bound protein(s) is the major determinant of the mobility of the complex, a result similar to the results seen in mobility shifts of GCN4-DNA complexes (20).

The specificity of the DNA-protein interactions was ana-lyzed in competition assays by adding an excess of DNA frag-ments that contained the tre, consisted of a mutant tre, or contained the mIEcrs. A 100-fold molar excess of unlabeled competitor DNA fragments was added to the nuclear extracts from infected cells prior to incubation with the radiolabeled DNA probe composed of the US3tre(⫺22 to⫹1). As depicted in Fig. 1A, in the absence of competitor the tre-containing

probe was able to form a specific DNA-protein complex (Fig. 1B, lane 9). Excess unlabeled DNA fragments containing the

trewere able to compete with the radiolabeled probe for pro-tein binding (Fig. 1B, compare lanes 9 and 10). However, DNA fragments containing the mIEcrsor the mutant version of the

trewere unable to compete for protein binding (Fig. 1B, lanes 11 and 12). Competition by the unlabeledtre-containing DNA fragment for protein binding coupled with the inability of the mutanttre or the mIEcrs fragments to compete for protein binding demonstrated the specific nature of the DNA-protein interaction. Although thetre-containing DNA fragments com-peted with the radiolabeledtreprobe for protein binding (Fig. 1B, lane 10), the competition was not 100% at the ratio of DNA to protein used. The lack of complete competition sug-gests that the protein(s) present in the DNA-protein complex has a relatively weak binding affinity for the DNA fragmentin

vitro, a feature associated with rapid modulation of protein

binding (32). The inability of the mIEcrsto compete with the

trefor protein binding suggests that the two DNA elements interact with different proteins and correlates with the inability of IE2 to repress US3 expression (5).

[image:3.612.127.479.70.350.2]

These experiments demonstrated that a specific DNA-pro-tein complex forms on the tre. Mutations that functionally inactivated the tre (5) prevented formation of tre-specific FIG. 1. Electrophoretic mobility shift assays. (A) Double-stranded radiolabeled DNA fragments containing either atre(w) or a mutant version of thetre(m) were used to assay for specific DNA-binding proteins in nuclear extracts prepared from mock-infected (mock) or HCMV-infected (infected) HDFs. Lanes 1 to 4, US3 sequences from⫺25 to⫹10; lanes 5 to 6, sequences from⫺22 to⫹1; lanes 7 and 8, sequences from⫺58 to ⫹32. (B) Specificity of DNA-protein interactions. Competition experiments were performed, using nuclear extracts from infected HDFs and adding either no competitor (lane 9) or a 100-fold molar excess of unlabeled DNA fragments containing the US3tre(wt tre, lane 10), the mIE crs(crs, lane 11), or the mutant version of thetre(m tre, lane 12) to the DNA-protein binding reactions prior to addition of the radiolabeled tre-containing fragment. Arrows, specific DNA-protein interactions; ⴱ, unbound probe; dash, tre-independent DNA-protein interaction. (C) Sequence of the US3 regulatory region; thetreis underlined, the TATA box is indicated by a rectangle, nucleotide substitutions that create a nonfunctionaltre(5) are indicated by asterisks. The locations of the⫺22 to⫹1,⫺25 to⫹10, and⫺58 to⫹32 probes are indicated; the bent arrow indicates the transcription start site.

on November 9, 2019 by guest

http://jvi.asm.org/

(4)

DNA-protein complexes (Fig. 1A). The protein(s) needed for DNA-protein complex formation were only present in nuclear extracts prepared from infected cells, suggesting that the DNA-binding protein(s) was either a viral protein or, alterna-tively, a cellular protein whose synthesis or activity was altered as a result of viral infection.

Identification of atre-binding protein.To identify proteins

binding to the tre, the yeast one-hybrid system was utilized (18). For these experiments, a cDNA expression library was constructed from poly(A)⫹RNA isolated from infected

hu-man diploid fibroblasts at 3 h.p.i., such that cDNAs were ex-pressed as GAL4 activation domain (GAL4 AD) fusion pro-teins in recipient yeast cells. The GAL4 AD-cDNA library was transformed into aS. cerevisiaeyeast strain (YM-TRE-wt) that contained three copies of thetreinserted 5⬘ of the promoter for thelacZgene. Approximately 7⫻106yeast transformants were screened for elevated levels of␤-galactosidase using filter lift assays. From the library screen, two yeast colonies were identified that expressed elevated levels of␤-galactosidase ac-tivity within 1 h of incubation with the substrate, X-Gal (5-bromo-4-chloro-3-indolyl-␤-D-galactopyranoside). The GAL4

AD-cDNA plasmids were isolated from the positive yeast col-onies and introduced into a yeast strain that contained three copies of the mutant tre (YM-TREmut). The GAL4 AD-cDNA plasmids failed to induce lacZexpression in the YM-TREmut yeast strain, demonstrating that the proteins encoded by the cDNAs were able to specifically bind to thetre.

The cDNAs present in the GAL4 AD-cDNA plasmids were partially sequenced. The first plasmid isolate contained HCMV sequences from nucleotides 44797 to 46039; the second plas-mid isolate contained HCMV sequences from 44815 to 46044 (nucleotide numbers correspond to the sequence of HCMV AD169 [12]). This region of the HCMV genome is contained within the predicted UL34 open reading frame. In both plas-mid isolates, the predicted UL34 open reading frame was in-serted into the expression plasmid in frame with the activation domain of GAL4. The ATG at positions 44791 to 44793 is predicted to serve as the translation initiation codon for the UL34 mRNA (61); isolation of UL34 cDNAs with 5⬘ ends close to the proposed translation initiation codon supports this prediction. Northern blot analysis confirmed that UL34 tran-scripts are present early in infection (data not shown). Thus, the HCMV UL34 gene is transcribed early in infection and encodes a protein capable of binding to the US3 trein yeast. These data suggested that the protein encoded by UL34 (pUL34) is potentially capable of acting as a transcriptional repressor.

DNA-binding activity of UL34.The protein encoded by the

HCMV UL34 gene, pUL34, functioned as a sequence-specific DNA-binding protein in the yeast one-hybrid system. To con-firm and extend the results seen with the yeast one-hybrid system, EMSAs were performed using a radiolabeledtre -con-taining DNA fragment (sequences from⫺22 to⫹1, Fig. 1C) and in vitro-synthesized UL34 protein. The UL34 protein was synthesized by transcribing and translating the UL34 open reading frame in vitro in the presence of [35S]methionine. The translation products were analyzed by SDS-polyacrylamide gel electrophoresis, demonstrating the synthesis of an ⬃49-kDa UL34 protein (Fig. 2A, lane 1). A control plasmid that con-tained the luciferase open reading frame was also transcribed

and translated (Fig. 2A, lane 2). The in vitro-synthesized pro-teins were assayed for the ability to bind totreby using EMSAs as described in Fig. 1. The addition of in vitro-synthesized pUL34 to a radiolabeled DNA fragment containing the tre

(sequences from⫺22 to⫹1) resulted in the formation of a DNA-protein complex (Fig. 2B, lanes 6 and 7). Increasing the amount of translation product increased the amount of DNA-protein complexes formed (Fig. 2B, compare lanes 6 and 7) and resulted in the formation of an additional minor DNA-protein complex. This minor complex may be a result of in-complete pUL34 translation products or pUL34 degradation products interacting with the DNA probe. In vitro-synthesized luciferase protein was unable to form a DNA-protein complex, demonstrating that the complex formed in the presence of pUL34 was specific (Fig. 2B, compare lanes 5 and 6).

A competition experiment was performed as described above, analyzing the ability of unlabeledtrefragments to com-pete for pUL34 binding. Addition of a 200-fold molar excess of unlabeledtre-containing DNA prevented the formation of a detectable DNA-protein complex, demonstrating that the DNA-protein interactions are specific for thetre(Fig. 2B, lane 3). Extracts prepared from infected cells formed a DNA-pro-tein complex similar to that seen with pUL34 alone (Fig. 2B, lane 1), while extracts from mock-infected cells were unable to form a complex with thetre-containing DNA fragment (Fig. 2B, lane 8). Supplementation of extracts prepared from mock-FIG. 2. (A) SDS-polyacrylamide gel electrophoresis of the in vitro-synthesized pUL34 and luciferase proteins. Lane 1, 5␮l of the in vitro translation reaction utilizing the UL34-encoding plasmid; lane 2, 5␮l of the translation reaction utilizing the luciferase-encoding (luc) plas-mid; lane 3, control reaction containing no template plasmid. The positions of the molecular weight markers are indicated. (B) EMSA analysis of in vitro-synthesized pUL34. The radiolabeled double-stranded DNA probe used in lanes 1 to 8 consisted of atre-containing fragment (⫺22 to⫹1, see Fig. 1C), while the probe in lanes 9 to 10 contained a mutant version of thetre. The proteins incubated with the DNA probes are as follows: lane 1, infected cell extracts (Inf.); lane 2, extracts from mock-infected cells supplemented with 1␮l of the in vitro-translated pUL34 (M⫹UL34); lane 3, 1␮l of the in vitro-trans-lated pUL34 preincubated with a 200⫻molar excess of unlabeled tre-containing US3 sequences from⫹1 to⫺22 (competitor, c); lane 4, no protein; lane 5, 1␮l of the in vitro-translated luciferase protein (luc); lane 6, 1␮l of the in vitro-translated pUL34; lane 7, 5␮l of the in vitro-translated pUL34; lane 8, extracts from mock-infected cells (Mock); lane 9, no protein; and lane 10, 1␮l of the in vitro-translated pUL34. Arrow, specific DNA-protein interaction.

on November 9, 2019 by guest

http://jvi.asm.org/

(5)

infected cells with the in vitro-translated pUL34 resulted in the formation of a DNA-protein complex similar to that seen in the presence of infected cell extracts (Fig. 2B, lane 2). In vitro-synthesized pUL34 was unable to bind to a mutant ver-sion of thetre(Fig. 2B, lane 10). These experiments confirmed the results obtained with the yeast-one hybrid system, and establish pUL34 as a site-specific DNA-binding protein.

Localization of pUL34.As a DNA-binding protein, pUL34

was predicted to localize to the nucleus of cells. Amino acid analysis identified three potential nuclear localization signals within the UL34 open reading frame (analysis by PSORT [47]). Classical nuclear localization signals were detected at amino acid positions 300 and 306 (see reference 29 for a review), and a potential bipartite nuclear localization signal was predicted beginning at amino acid 60 (51). To determine if pUL34 lo-calizes to the nucleus, a plasmid expressing an EFGP-UL34 fusion protein was transfected into HDFs. The parental plas-mid (pEGFP-C2) was also transfected into HDFs as a control. Nuclei were stained with DAPI (4⬘,6⬘ -diamidino-2-phenylin-dole); cells were observed for green (EGFP or EGFP-UL34) and blue (nuclei) fluorescence. As illustrated in Fig. 3A and B, expression of EGFP alone resulted in an intracellular pattern of widely distributed bright green fluorescence with the nuclei fluorescing blue. The expression of the EGFP-UL34 protein resulted in the localization of the green fluorescence to the nuclei of transfected cells (Fig. 3D and F) with the green fluorescence colocalizing with DAPI-stained nuclei (Fig. 3C and E). These data demonstrated that pUL34 localizes to the nucleus, consistent with its ability to bind DNA and its pre-dicted function as a transcriptional repressor.

UL34 repression of US3 transcription. The interaction of

pUL34 with the tre in the yeast one-hybrid system and in

EMSAs suggested that pUL34 was involved in transcriptional repression of the US3 gene. To examine the effect of pUL34 on US3 gene expression, a transient-expression system was uti-lized. Reporter gene plasmids expressing thelacZgene under the control of the US3 promoter and tre(pBJ171 [3]) or the US3 promoter and a mutant version of the tre(pBJ214 [4]) were transfected into HDFs either alone or in combination with plasmids expressing IE1, IE2, IE1 and IE2, and pUL34. The transcriptional activators IE1 and IE2 were used in these assays to increase US3-regulated␤-galactosidase expression to easily detectable levels. The levels of␤-galactosidase activity were assayed by adding media containing the␤-galactosidase substrate, methylumbelliferyl-␤-D-galactoside (MUG), to the

transfected cells and then measuring the fluorescence of the MUG cleavage product. Expression of UL34 alone repressed transcription from the US3 promoter in atre-dependent fash-ion (Fig. 4A). Expressfash-ion of pUL34 repressed IE1, IE2, or IE1-IE2 activation of the US3 promoter in the presence of the wild-typetre(Fig. 4A). In contrast, mutational inactivation of the tre prevented pUL34 repression of US3 expression. pUL34-mediated transcriptional repression of the tre

re-porter gene plasmid was similar to that seen following viral infection (Fig. 4B) (4). Bothtreandtremutant reporter gene

constructs were expressed to similar levels following cotrans-fection with the IE1 and IE2 expression plasmids, demonstrat-ing that the repressive effect was specific for pUL34 (data is not shown) (4). Cotransfection of an expression plasmid contain-ing an inverted UL34 open readcontain-ing frame resulted in similar levels of reporter gene activity for the treand tre mutant

reporter gene constructs (data not shown), demonstrating a requirement for the UL34 open reading frame for transcrip-tional repression. Furthermore, transcriptranscrip-tional repression by UL34 was independent of IE2, confirming earlier observations about the lack of IE2 involvement in US3 repression (4).

Although the overall effects of pUL34 repression were sim-ilar for all combinations of transcriptional factors tested (Fig. 4), the level of gene expression was influenced by the presence of the transcriptional activators, IE1 and IE2. This suggests that there is a balance between activation and repression that ultimately determines the level of gene expression.

DISCUSSION

[image:5.612.55.293.69.296.2]

These studies have identified a novel transcriptional repres-sor and correspondingly have defined a function for the pre-dicted UL34 open reading frame of the HCMV genome. The protein encoded by the UL34 open reading frame, pUL34, bound specifically to thetreof the US3 gene. Three nucleo-tide substitutions within thetrethat result in a loss of tran-scriptional repression (5) prevented pUL34 DNA binding. Fur-thermore, pUL34 alone was sufficient for repression of US3 expression. pUL34 DNA-binding correlates directly with re-pression of US3 exre-pression. The mechanism by which pUL34 represses US3 transcription is unknown, however, in vivo foot-printing of the US3 promoter suggests that transcriptional repression results from a block in formation of the preinitia-tion complex (5). Thus, pUL34 binding to thetremay prevent formation of the preinitiation complex, possibly through inter-actions with general transcription factors such as TFIID or TFIIB.

FIG. 3. Micrographs of HDFs transfected with pEGFP-C2 (A and B) or pBJ507 (which expresses an EGFP-UL34 fusion protein) (C, D, E, and F). Cells were stained with DAPI and visualized with UV and FITC filters (⫻400 magnification). Panels A, C, and E, DAPI staining; panels B, D, and F, GFP fluorescence. Arrows indicate the positions of the transfected cells.

on November 9, 2019 by guest

http://jvi.asm.org/

(6)

Other than the studies reported here, very little is known about the UL34 gene. The UL34 gene is conserved among the cytomegaloviruses and a homolog has been identified in mouse, rat, and guinea pig cytomegaloviruses (49, 60; Y. Liu and B. J. Biegalke, unpublished data). Other than the cyto-megalovirus homologs, pUL34 shares no clear similarity with proteins encoded by sequences in GenBank (BLAST analysis). The predicted UL34 protein contains a basic NH2-terminal end and an acidic COOH-terminal end, which is suggestive of functional structural domains similar to those of other tran-scription factors such as GAL4.

The repression of gene expression by protein binding to a DNA element located between the TATA box and the tran-scription start site is a relatively common scheme for regulating herpesvirus gene expression. In addition to repression medi-ated by pUL34, ICP4 of herpes simplex virus and the IE2 protein of HCMV act as autoregulatory transcriptional repres-sors, binding to sequences located between the TATA box and the transcription start site and downregulating their own ex-pression (9, 13, 34, 37, 38, 38, 43, 45, 48, 50). Although the mechanisms by which ICP4 and IE2 repress their own expres-sion are not completely understood, IE2 blocks the recruit-ment of RNA polymerase II to the preinitiation complex, and ICP4 interferes with the formation of transcription initiation complexes (23, 36, 63). In addition to their repressive effects, ICP4 and IE2 play essential roles in activating the expression of viral genes. Both ICP4 and IE2 interact with a number of cellular proteins that are involved in transcriptional regulation; these interactions may also contribute to their repressive ef-fects (9, 10, 19, 22, 24, 31, 33, 40, 41, 53–56).

Although the DNA-binding and transcriptional repressive activities of pUL34 were identified through analysis of the US3 gene, there are several additional potential pUL34 binding

sites located throughout the HCMV genome. The frequency of potential binding sites suggests that pUL34 may have other roles in the virus life cycle, along with its role in repressing US3 transcription. Potential pUL34 binding sites are located both 5⬘ and 3⬘ of predicted promoter regions, suggesting that pUL34 may function to activate as well as repress transcrip-tion, depending on the position of the protein binding site. Intriguingly, potential pUL34 binding sites are also located in regions adjacent to the origin for lytic replication of the HCMV genome (2, 25, 44). This raises the possibility that pUL34 functions indirectly in DNA replication, perhaps by altering transcription in the region of the lytic origin of repli-cation.

Identification of pUL34 as a transcriptional regulatory pro-tein extends the growing list of transcription factors encoded by the herpesviruses. These studies provide the first identifi-cation of an HCMV-encoded sequence-specific DNA-binding protein that mediates transcriptional repression of another HCMV gene (the US3 gene) through a defined protein-bind-ing site. The mechanism of pUL34-mediated transcriptional repression has yet to be resolved. The potential involvement of pUL34 in the virus life cycle, particularly during latency, is an exciting possibility that remains to be investigated.

ACKNOWLEDGMENTS

We thank John Price for technical assistance, Mark Berryman for assistance with microscopy, Adam Geballe for pEQ plasmids, and Frank Horodyski for critical reading of the manuscript.

This work was supported in part by Council of Tobacco Research grant 4740 to B.J.B. and a College of Osteopathic Medicine postdoc-toral fellowship to L.A.L.

REFERENCES

1.Ahn, K., A. Angulo, P. Ghazal, P. A. Peterson, Y. Yang, and K. Fruh.1996. Human cytomegalovirus inhibits antigen presentation by a sequential

mul-FIG. 4. Analysis of the effect of pUL34 on US3 transcription. Reporter gene plasmids that express thelacZgene under the control of the US3 enhancer and promoter and contain either thetre(pBJ171, open columns) or a mutant version of thetre(pBJ214, crosshatched columns) were transfected into HDFs alone or with plasmids that express IE1 (pEQ273), IE2 (pEQ326), or IE1 and IE2 proteins (pEQ276) or pUL34 (pBJ386) as indicated. Reporter gene activity was assayed⬃36 h after transfection, by measuring the fluorescence of the cleavage product of the ␤-galactosidase substrate, MUG. The amount of plasmid DNA was kept constant in the transfections by adding the appropriate amount of a control plasmid, pBJ201, which contains the mIE promoter but expresses no protein (4). Background levels of␤-galactosidase obtained with a promoterlesslacZ-containing plasmid, pEQ3, were subtracted from the values obtained with pBJ171 and pBJ214. (A) pUL34 repression of US3 expression. The data presented are the averages of duplicate transfections plus one standard deviation. (B) Comparison of the repressive effect of infection with the repressive effect of pUL34 on IE1 and IE2 activation of the US3 promoter andtre.

on November 9, 2019 by guest

http://jvi.asm.org/

[image:6.612.142.473.71.262.2]
(7)

tistep process. Proc. Natl. Acad. Sci. USA93:10990–10995.

2.Anders, D. G., M. A. Kacica, G. S. Pari, and S. M. Punturieri.1992. Bound-aries and structure of human cytomegalovirusoriLyt, a complex origin for lytic-phase DNA replication. J. Virol.66:3373–3384.

3.Biegalke, B. J.1995. Regulation of human cytomegalovirus US3 gene tran-scription by acis-repressive sequence. J. Virol.69:5362–5367.

4.Biegalke, B. J.1997. IE2 protein is insufficient for transcriptional repression of the human cytomegalovirus US3 promoter. J. Virol.71:8056–8060. 5.Biegalke, B. J.1998. Characterization of the transcriptional repressive

ele-ment of the human cytomegalovirus immediate-early US3 gene. J. Virol.

72:5457–5463.

6.Biegalke, B. J.1999. Human cytomegalovirus US3 gene expression is regu-lated by a complex network of positive and negative regulators. Virology

261:155–164.

7.Biegalke, B. J., and A. P. Geballe.1991. Sequence requirements for activa-tion of the HIV-1 LTR by human cytomegalovirus. Virology183:381–385. 8.Britt, W. J., and C. A. Alford.1996. Cytomegalovirus, p. 2493–2524. In B. N.

Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lip-pincott-Raven Publishers, Philadelphia, Pa.

9.Carrozza, M. J., and N. A. Deluca.1996. Interaction of the viral activator protein ICP4 with TFIID through TAF250. Mol. Cell. Biol.16:3085–3093. 10. Caswell, R., L. Bryant, and J. Sinclair.1996. Human cytomegalovirus

im-mediate-early 2 (IE2) protein can transactivate the humanhsp70promoter by alleviation of Dr1-mediated repression. J. Virol.70:4028–4037. 11. Chan, Y. J., W. P. Tseng, and G. S. Hayward.1996. Two distinct upstream

regulatory domains containing multicopy cellular transcription factor bind-ing sites provide basal repression and inducible enhancer characteristics to the immediate-early IES (US3) promoter from human cytomegalovirus. J. Virol.70:5312–5328.

12. Chee, M. S., A. T. Bankier, S. Beck, R. Bohni, C. M. Brown, R. Cerny, T. Horsnell, C. A. Hutchison III, T. Kouzarides, J. A. Martignetti, E. Preddie, S. C. Satchwell, P. Tomlinson, K. M. Weston, and B. G. Barrell.1990. Analysis of the protein-coding content of the sequence of human cytomeg-alovirus strain AD169. Curr. Top. Microbiol. Immunol.154:125–170. 13. Cherrington, J. M., E. L. Khoury, and E. S. Mocarski.1991. Human

cyto-megalovirus IE2 negatively regulates␣gene expression via a short target sequence near the transcription start site. J. Virol.65:887–896.

14. Colberg-Poley, A. M.1996. Functional roles of immediate early proteins encoded by the human cytomegalovirus UL36–38, UL115–119, TRS1/IRS1 and US3 loci. Intervirology39:350–360.

15. Colberg-Poley, A. M., L. Huang, V. E. Soltero, A. C. Iskenderian, R. F. Schumacher, and D. G. Anders.1998. The acidic domain of pUL37⫻1 and gpUL37 plays a key role in transactivation of HCMV DNA replication gene promoters. Virology246:400–408.

16. Colberg-Poley, A. M., L. D. Santomenna, P. P. Harlow, P. A. Benfield, and D. J. Tenney.1992. Human cytomegalovirus US3 and UL36–38 immediate-early proteins regulate gene expression. J. Virol.66:95–105.

17. Dignam, J. D., R. M. Lebovits, and R. G. Roeder.1983. Accurate transcrip-tion initiatranscrip-tion by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res.11:1475–1489.

18. Fields, S., and O. Song.1989. A novel genetic system to detect protein-protein interactions. Nature340:245–246.

19. Furnari, B. A., E. Poma, T. F. Kowalik, S. M. Huong, and E. S. Huang.1993. Human cytomegalovirus immediate-early gene 2 protein interacts with itself and with several novel cellular proteins. J. Virol.67:4981–4991.

20. Gartenberg, M. R., C. Ampe, T. Steitz, and D. M. Crothers.1990. Molecular characterization of the GCN4-DNA complex. Proc. Nat. Acad. Sci. USA

87:6034–6038.

21. Gebert, S., S. Schmolke, G. Sorg, S. Flo¨ss, B. Plachter, and T. Stamminger.

1997. The UL84 protein of human cytomegalovirus acts as a transdominant inhibitor of immediate-early-mediated transactivation that is able to prevent viral replication. J. Virol.71:7048–7060.

22. Grondin, B., and N. DeLuca.2000. Herpes simplex virus type 1 ICP4 pro-motes transcription preinitiation complex formation by enhancing the bind-ing of TFIID to DNA. J. Virol.74:11504–11510.

23. Gu, B., R. Kuddus, and N. A. Deluca.1995. Repression of activator-mediated transcription by herpes simplex virus ICP4 via a mechanism involving inter-actions with the basal transcription factors TATA-binding protein and TFIIB. Mol. Cell. Biol.15:3618–3626.

24. Hagemeier, C., S. Walker, R. Caswell, T. Kouzarides, and J. Sinclair.1992. The human cytomegalovirus 80-kilodalton but not the 72-kilodalton imme-diate-early protein transactivates heterologous promoters in a TATA box-dependent mechanism and interacts directly with TFIID. J. Virol.66:4452– 4456.

25. Hamzeh, R. M., P. S. Lietman, W. Gibson, and G. Hayward.1990. Identifi-cation of the lytic origin of DNA repliIdentifi-cation in human cytomegalovirus by a novel approach utilizing ganciclovir-induced chain termination. J. Virol.

64:6184–6195.

26. Heinemeyer, T., E. Wingender, I. Reuter, H. Hermjakob, A. E. Kel, O. V. Kel, E. V. Ignatieva, E. A. Ananko, O. A. Podkolodnaya, F. A. Kolpakov, N. L. Podkolodny, and N. A. Kolchanov.1998. Databases on transcriptional

reg-ulation: TRANSFAC, TRRD and COMPEL. Nucleic Acids Res.26:362– 367.

27. Hengel, H., W. Brune, and U. H. Koszinowski.1998. Immune evasion by cytomegalovirus—survival strategies of a highly adapted opportunist. Trends Microbiol.6:190–197.

28. Hermiston, T. W., C. L. Malone, and M. F. Stinski.1990. Human cytomeg-alovirus immediate-early two protein region involved in negative regulation of the major immediate-early promoter. J. Virol.64:3532–3536.

29. Hicks, G. R., and N. V. Raikhel.1995. Protein import into the nucleus: an integrated view. Annu. Rev. Cell Dev. Biol.11:155–188.

30. Jones, T. R., E. J. H. J. Wiertz, L. Sun, K. N. Fish, J. A. Nelson, and H. L. Ploegh.1996. Human cytomegalovirus US3 impairs transport and matura-tion of major histocompatibility complex class I heavy chains. Proc. Natl. Acad. Sci. USA93:11327–11333.

31. Jupp, R., S. Hoffman, R. M. Stenberg, J. A. Nelson, and P. Ghazal.1993. Human cytomegalovirus IE86 protein interacts with the promoter-bound TATA-binding protein via a specific region distrinct from the autorepression domain. J. Virol.67:7539–7546.

32. Kay, B. K., M. P. Williamson, and M. Sudol.2000. The importance of being proline: the intearctin of proline-rich motifs in signaling proteins with their cognate domains. FASEB J.14:231–241.

33. Lang, D., S. Gebert, H. Arlt, and T. Stamminger.1995. Functional interac-tion between the human cytomegalovirus 86-kilodalton IE2 protein and the cellular transcription factor CREB. J. Virol.69:6030–6037.

34. Lang, D., and T. Stamminger.1993. The 86-kilodalton IE-2 protein of human cytomegalovirus is a sequence-specific DNA-binding protein that interacts directly with the negative autoregulatory response element located near the cap site of the IE-1/2 enhancer-promoter. J. Virol.67:323–331. 35. Lashmit, P. E., M. F. Stinski, E. A. Murphy, and G. C. Bullock.1998. A

cis-repression sequence adjacent to the transcription start site of the human cytomegalovirus US3 gene is required to down regulate gene expression at early and late times after infection. J. Virol.72:9575–9584.

36. Lee, G., J. Wu, P. Luu, P. Ghazal, and O. Flores.1998. Inhibition of the association of RNA polymerase II with the preinitiation complex by a viral transcriptional repressor. Proc. Natl. Acad. Sci. USA93:2570–2575. 37. Leopardi, R., N. Michael, and B. Roizman.1995. Repression of the herpes

simplex virus 1␣4 gene by its gene product (ICP4) within the context of the viral genome is conditioned by the distance and stereoaxial alignment of the ICP4 DNA binding site relative to the TATA box. J. Virol.69:3042–3048. 38. Liu, B., T. W. Hermiston, and M. F. Stinski.1991. Acis-acting element in the

major immediate-early (IE) promoter of human cytomegalovirus is required for negative regulation by IE2. J. Virol.65:897–903.

39. Liu, B., and M. F. Stinski.1992. Human cytomegalovirus contains a tegu-ment protein that enhances transcription from promoters with upstream ATF and Ap-1cis-acting elements. J. Virol.66:4434–4444.

40. Lukac, D. M., N. Y. Harel, N. Tanese, and J. C. Alwine.1997. TAF-like functions of human cytomegalovirus immediate-early proteins. J. Virol.71:

7227–7239.

41. Lukac, D. M., J. R. Manuppello, and J. C. Alwine.1994. Transcriptional activation by the human cytomegalovirus immediate-early proteins: require-ments for simple promoter structures and interactions with multiple com-ponents of the transcription complex. J. Virol.68:5184–5193.

42. Macias, M. P., L. Huang, P. E. Lashnit, and M. F. Stinski.1996. Cellular or viral protein binding to a cytomegalovirus promoter transcription initiation site: effects on transcription. J. Virol.70:3628–3635.

43. Macias, M. P., and M. F. Stinski.1993. Anin vitro system for human cytomegalovirus immediate early 2 protein (IE2)-mediated site-dependent repression of transcription and direct binding of IE2 to the major immediate early promoter. Proc. Natl. Acad. Sci. USA90:707–711.

44. Masse, M. J. O., S. Karlin, G. A. Schachtel, and E. S. Mocarski.1992. Human cytomegalovirus origin of DNA replication (oriLyt) resides within a highly complex repetitive region. Proc. Natl. Acad. Sci. USA89:5246–5250. 45. Michael, N., and B. Roizman.1993. Repression of the herpes simplex virus 1 alpha4 gene by its gene product occurs within the context of the viral genome and is associated with all three identified cognate sites. Proc. Natl. Acad. Sci. USA90:2286–2290.

46. Mocarski, E. S.1996. Cytomegaloviruses and their replication, p. 2447–2492. InB. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields Virology, 3rd ed. Lippincott-Raven Publishers, Philadephia, Pa.

47. Nakai, K., and M. Kanhisa.1992. A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics14:897–911.

48. Pizzorno, M. C., and G. S. Hayward.1990. The IE2 gene products of human cytomegalovirus specifically down-regulate expression from the major imme-diate-early promoter through a target sequence located near the cap site. J. Virol.64:6154–6165.

49. Rawlinson, W. D., H. E. Farrell, and B. G. Barrell.1996. Analysis of the complete DNA sequence of murine cytomegalovirus. J. Virol.70:8833–8849. 50. Rivera-Gonzalez, R., A. N. Imbalzano, B. Gu, and N. A. Deluca.1994. The role of ICP4 repressor activity in temporal expression of the IE-3 and latency-associated transcript promoters during HSV-1 infection. Virology

202:550–564.

51. Robbins, J., S. M. Dilworth, R. A. Laskey, and C. Dingwall.1991. Two

on November 9, 2019 by guest

http://jvi.asm.org/

(8)

interdependent basic domains in nucleoplasmin nuclear targeting sequence: identification of a class of bipartite nuclear targeting sequence. Cell64:615– 623.

52.Romanowski, M. J., E. Garrido-Guerrero, and T. Shenk.1997. pIRS1 and pTRS1 are present in human cytomegalovirus virions. J. Virol.71:5703–5705. 53. Schwartz, R., B. Helmich, and D. H. Spector.1996. CREB and CREB-binding proteins play an important role in the IE2 86-kilodalton protein-mediated transactivation of the human cytomegalovirus 2.2-kilobase RNA promoter. J. Virol.70:6955–6966.

54. Smith, C. A., P. Bates, R. Rivera-Gonzalez, B. Gu, and N. DeLuca.1993. ICP4, the major transcriptional regulatory protein of herpes simplex virus type 1, forms a tripartite complex with TATA-binding protein and TFIIB. J. Virol.67:4676–4687.

55. Sommer, M. H., A. L. Scully, and D. H. Spector.1994. Transactivation by the human cytomegalovirus IE2 86-kilodalton protein requires a domain that binds to both the TATA box-binding protein and the retinoblastoma protein. J. Virol.68:6223–6231.

56. Speir, E., R. Modali, E.-S. Huang, M. B. Leon, F. Shawl, T. Finkel, and S. E. Epstein.1994. Potential role of human cytomegalovirus and p53 interaction in coronary restenosis. Science265:391–394.

57. Stenberg, R. M.1996. The human cytomegalovirus major immediate-early gene. Intervirology39:343–349.

58. Tenney, D. J., L. D. Santomenna, K. B. Goudie, and A. M. Colberg-Poley.

1993. The human cytomegalovirus US3 immediate-early protein lacking the putative transmembrane domain regulates gene expression. Nucleic Acids Res.21:2931–2937.

59. Thrower, A. R., G. C. Bullock, J. E. Bissell, and M. F. Stinski.1996. Regu-lation of a human cytomegalovirus immediate-early gene (US3) by a silenc-er-enhancer combination. J. Virol.70:91–100.

60. Vink, C., E. Beuken, and C. A. Bruggeman.2000. Complete DNA sequence of the rat cytomegalovirus genome. J. Virol.74:7656–7665.

61. Welch, R. W., L. M. McGregor, and W. Gibson.1991. Cytomegalovirus homologs of cellular G protein-coupled receptor genes are transcribed. J. Vi-rol.65:3915–3918.

62. Weston, K.1988. An enhancer element in the short unique region of human cytomegalovirus regulates the production of a group of abundant immediate-early transcripts. Virology162:406–416.

63. Wu, J., R. Jupp, R. M. Stenberg, J. A. Nelson, and P. Ghazal.1993. Site-specific inhibition of RNA polymerase II preinitiation complex assembly by human cytomegalovirus IE86 protein. J. Virol.67:7547–7555.

on November 9, 2019 by guest

http://jvi.asm.org/

Figure

FIG. 1. Electrophoretic mobility shift assays. (A) Double-stranded radiolabeled DNA fragments containing either a treof the(infected) HDFs
FIG. 3. Micrographs of HDFs transfected with pEGFP-C2 (A andB) or pBJ507 (which expresses an EGFP-UL34 fusion protein) (C, D,
FIG. 4. Analysis of the effect of pUL34 on US3 transcription. Reporter gene plasmids that express the lacZenhancer and promoter and contain either theexpression

References

Related documents

In short, we ask whether broad and abstract foreign policy postures, coupled with vari- ables standard in models of political choice (economic evaluations and partisanship),

In addition, extracellular Vpr reactivated HIV-1 expression in five latently infected cell lines of T-cell, B-cell, and promonocytic origin which normally express very low levels of

Virions of primary human immunodeficiency virus type 1 isolates resistant to soluble CD4 (sCD4) neutralization differ in sCD4 binding and glycoprotein gpl20 retention from

To investigate the role of the basic amino acids flanking the NCplO zinc finger, neutral residues were substituted for the basic amino acids and the effects of these mutations in

The concept of the so-called droop control has been widely discussed in the literature as the preferred controller for Voltage Source Converter for High Voltage

Methods: A Pop-Up health check was sited in four and three shopping centres sampled from the top ten unhealthiest and top 15 healthiest shopping regions respectively, following a

Under this third mapping the system becomes a diamond chain with alternating tunneling amplitudes, whose non-trivial topological na- ture of the gaps where the edge states lie

The research covers a range of botnet detection scenarios that is wider from what explored so far, explores atomic and box learning algorithms, and investigates thoroughly