Species Specific Identification of a Wide Range of Clinically Relevant Fungal Pathogens by Use of Luminex xMAP Technology

11  Download (0)

Full text

(1)

0095-1137/09/$08.00⫹0 doi:10.1128/JCM.01558-08

Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Species-Specific Identification of a Wide Range of Clinically Relevant

Fungal Pathogens by Use of Luminex xMAP Technology

C. Landlinger,

1,2

S. Preuner,

1

B. Willinger,

3

B. Haberpursch,

4

Z. Racil,

5

J. Mayer,

5

and T. Lion

1,2

*

Division of Molecular Microbiology and Development of Genetic Diagnostics, Children’s Cancer Research Institute,1and LabDia Labordiagnostik GmbH,2Vienna, Austria; Division of Clinical Microbiology, Institute of Hygiene and

Medical Microbiology, Medical University of Vienna, Vienna, Austria3; Multimetrix GmbH, Heidelberg, Germany4; and Department of Internal Medicine Hemato-Oncology, University Hospital Brno and

Masaryk University Brno, Brno, Czech Republic5

Received 12 August 2008/Returned for modification 27 September 2008/Accepted 18 February 2009

In immunocompromised patients suffering from invasive fungal infection, rapid identification of the fungal species is a prerequisite for selection of the most appropriate antifungal treatment. We present an assay permitting reliable identification of a wide range of clinically relevant fungal pathogens based on the high-throughput Luminex microbead hybridization technology. The internal transcribed spacer (ITS2) region, which is highly variable among genomes of individual fungal species, was used to generate oligonucleotide hybridization probes for specific identification. The spectrum of pathogenic fungi covered by the assay includes

the most commonly occurring species of the genera Aspergillus and Candida and a number of important

emerging fungi, such as Cryptococcus, Fusarium, Trichosporon, Mucor, Rhizopus, Penicillium, Absidia, and

Acremonium. Up to three different probes are employed for the detection of each fungal species. The redun-dancy in the design of the assay should ensure unambiguous fungus identification even in the presence of mutations in individual target regions. The current set of hybridization oligonucleotides includes 75 species-and genus-specific probes which had been carefully tested for specificity by repeated analysis of multiple reference strains. To provide adequate sensitivity for clinical application, the assay includes amplification of the ITS2 region by a seminested PCR approach prior to hybridization of the amplicons to the probe panel using the Luminex technology. A variety of fungal pathogens were successfully identified in clinical specimens that included peripheral blood, samples from biopsies of pulmonary infiltrations, and bronchotracheal secretions derived from patients with documented invasive fungal infections. Our observations demonstrate that the Luminex-based technology presented permits rapid and reliable identification of fungal species and may therefore be instrumental in routine clinical diagnostics.

Although the vast majority of invasive fungal infections are

still caused byAspergillusorCandidaspecies, changes in

epi-demiology have become evident over the last years (11, 15, 33, 39). In view of the different drug resistance profiles of many clinically relevant fungal pathogens (34), the development of rapid methods for species-specific identification of clinically important fungi is desirable in order to permit selection of the most appropriate antifungal treatment. Traditional diagnostic approaches to the identification of fungal species are mainly based on phenotype analysis of fungal cultures. However, these approaches are time-consuming and show limited applicability for the detection of molds (29). Over the last years, a variety of molecular methods have been established for rapid and sensi-tive detection of fungal pathogens. Many of these assays are real-time quantitative PCR tests, mostly targeting the ribo-somal multicopy gene (rDNA gene) (1, 3, 12–14, 16, 21, 30, 31, 35, 40). With these techniques, the fungal sequences of interest can be amplified by universal primers targeting highly con-served regions within the rDNA gene, and identification of individual species can either be performed by specific

hybrid-ization probes directed against variable sequences within the amplicons or by specific melting curve profiles. Many of these assays, however, only permit the detection of a limited number of fungal species.

Other approaches to the identification of fungal pathogens have been introduced, including fragment length analysis of the internal transcribed spacer 2 (ITS2) region by capillary electrophoresis (5, 7, 37), hybridization assays recognizing unique portions of the ITS2 sequence (6, 9, 42), microarray-based detection (4, 36), or DNA sequencing of the ITS regions (2, 28).

In view of the increasing need for clinically applicable tech-nical approaches to rapid identification of fungal species, we have established a high-throughput assay facilitating reliable recognition of a broad range of pathogenic fungi that are relevant in the context of invasive infections. Our approach is based on the Luminex xMAP hybridization technology, which permits the analysis of up to 100 different target sequences in a single reaction vessel (10). Microbeads, uniquely defined by their specific spectral addresses, are covalently bound by fun-gus-specific hybridization probes. Biotinylated PCR-amplified target DNA is hybridized to microbead sets bearing oligonu-cleotide capture probes of interest. By adding a streptavidin-phycoerythrin reporter, all hybridized amplicons captured by their complementary nucleotide sequence on the mi-crobeads are recognized and the median fluorescence

inten-* Corresponding author. Mailing address: CCRI, Kinderspitalgasse 6, A-1090 Vienna, Austria. Phone: 43-0-1-40470 489. Fax: 43-0-1-40470 437. E-mail: Thomas.Lion@ccri.at.

† Supplemental material for this article may be found at http://jcm .asm.org/.

Published ahead of print on 25 February 2009.

1063

on May 16, 2020 by guest

http://jcm.asm.org/

(2)

TABLE 1. Species-specific and genus-specific hybridization probes

Probe Specificity(ies) Accession no., position

of target sequence Sequence (5⬘–3⬘)

Length (nucleotides)

Temp (°C)

% G⫹C content

Species specific

A.can1 A. candidus AY373843, 506–526 CAGCCGACCAACCCAACCATT 21 68.38 57.14

A.cla1 A. clavatus AY373847, 513–533 CCTGTCGACACCAACCCAATT 21 64.27 52.38

A.fla1 A. flavus AY373848, 398–418 GGTCGTCGTCCCCTCTCCGGG 21 73.38 76.19

A.fla2 A. flavus AY373848, 504–524 GCGCTTGCCGAACGCAAATCA 21 73.38 57.14

A.fla3 A. flavus AY373848, 524–544 AATCTTTTTCCAGGTTGACCT 21 56.81 38.10

A.fum1 A. fumigatus AF455542, 529–549 AGCCGACACCCAACTTTATTT 21 59.88 42.86

A.fum2 A. fumigatus AF455542, 498–518 TGTCACCTGCTCTGTAGGCCC 21 64.91 61.90

A.nid1 A. nidulans AY373888, 455–475 CACCCGCTCGATTAGGGCCGG 21 73.53 71.43

A.nid2 A. nidulans AY373888, 479–499 CCAGCCGGCGTCTCCAACCTT 21 71.76 66.67

A.nig1 A. niger AY373852, 486–507 ATGCTCTGTAGGATTGGCCGG 21 65.64 57.14

A.nig2 A. niger AY373852, 515–535 GACGTTTTCCAACCATTCTT 20 61.24 40.00

A.ter1 A. terreus AJ413985, 511–531 GCTTCGTCTTCCGCTCCGTAG 21 65.64 61.90

A.ter2 A. terreus AJ413985, 552–572 ACGCATTTATTTGCAACTTGT 21 57.41 33.33

Ab.cor1 Absidia corymbifera AY533554, 191–211 GTTGCTGTCATGGCCTTAAAT 21 59.10 42.86 Ab.cor2 Absidia corymbifera AY533554, 268–288 GAGCAGCTTGGTTAGTGAGTT 21 56.37 47.62 Ab.cor3 Absidia corymbifera AY533554, 336–356 ATGGGACACTACTTGGAGAAA 21 56.24 42.86 Ac.str1 Acremonium strictum AY214439, 352–372 TTTCAACCCTCAGGCCCACCC 21 69.57 61.90 Ac.str2 Acremonium strictum AY214439, 379–399 GGGAGCGGGCCTGGTTCTGGG 21 74.93 76.19 Ac.str3 Acremonium strictum AY214439, 422–442 CGTCCCTCAAATTCAGTGGCG 21 67.14 57.14

C.alb1 C. albicans AF217609, 373–394 TGCTTGAAAGACGGTAGTGGT 21 59.79 47.62

C.alb2 C. albicans AF217609, 393–413 TAAGGCGGGATCGCTTTGACA 21 67.04 52.38

C.alb3 C. albicans AF217609, 437–457 ATTGCTTGCGGCGGTAACGTC 21 68.44 57.14

C.dub1 C. dubliniensis AF218993, 130–150 AGGCGGAGATGCTTGACAATG 21 64.75 52.38

C.dub2 C. dubliniensis AF218993, 171–191 ATTGCTAAGGCGGTCTCTGGC 21 64.97 57.14

C.dub3 C. dubliniensis AF218993, 190–210 GCGTCGCCCATTTTATTCTTC 21 62.93 47.62

C.gla1 C. glabrata AF218994, 201–222 ATCAGTATGTGGGACACGAGC 21 60.01 52.38

C.gla2 C. glabrata AF218994, 232–253 CAACTCGGTGTTGATCTAGGG 21 59.60 52.38

C.gla3 C. glabrata AF218994, 281–301 TAGGTTTTACCAACTCGGTGT 21 56.33 42.86

C.gui1 C. guilliermondi AF218996, 94–114 CTCTTAGTCGGACTAGGCGTT 21 57.79 52.38

C.gui2 C. guilliermondi AF218996, 152–172 GCTGTCGACCTCTCAATGTAT 21 56.87 47.62

C.gui3 C. guilliermondi AF218996, 192–212 GAATGGTGTGGCGGGATATTT 21 63.01 47.62

C.kru1 C. krusei L47113, 329–349 ACGACGTGTAAAGAGCGTCGG 21 64.75 57.14

C.kru2 C. krusei L47113, 381–401 GGCCGAGCGAACTAGACTTTT 21 62.07 52.38

C.kru3 C. krusei L47113, 421–441 CCGAGAGCGAGTGTTGCGAGA 21 68.47 61.90

C.lip1 C. lipolytica AY282524, 96–116 GTACCGCACGGATGGAGGAGC 21 68.35 66.67

C.lip2 C. lipolytica AY282524, 128–148 GGGATCGCATTGCTTTCTTGA 21 64.59 47.62

C.lip3 C. lipolytica AY282524, 188–208 CCTCCTTCATCCGAGATTACC 21 59.91 52.38

C.lus1 C. lusitaniae AY493434, 209–229 CTCCGAAATATCAACCGCGCT 21 65.57 52.38

C.lus2 C. lusitaniae AY493434, 230–250 GTCAAACACGTTTACAGCACG 21 59.30 47.62

C.lus3 C. lusitaniae AY493434, 250–270 GACATTTCGCCCTCAAATCAA 21 62.22 42.86

C.par1 C. parapsilosis AF455530, 321–341 TGAGCGATACGCTGGGTTTGC 21 67.69 57.14

C.par2 C. parapsilosis AF455530, 351–371 AGGCGGAGTATAAACTAATGG 21 55.24 42.86

C.par3 C. parapsilosis AF455530, 395–415 ACAAACTCCAAAACTTCTTCC 21 55.11 38.10

C.tro1 C. tropicalis AF218992, 93–113 ACGCTAGGTTTGTTTGAAAGA 21 56.74 38.10

C.tro2 C. tropicalis AF218992, 136–156 AGCGACTTAGGTTTATCCAAA 21 55.81 38.10

C.tro3 C. tropicalis AF218992, 156–176 AACGCTTATTTTGCTAGTGGC 21 58.60 42.86

Cr.neo1 Cryptococcus neoformans AJ876598, 311–331 AATCTCAATCCCTCGGGTTTT 21 61.01 42.86 Cr.neo2 Cryptococcus neoformans AJ876598, 364–384 CGCGACCTGCAAAGGACGTCG 21 72.40 66.67 Cr.neo3 Cryptococcus neoformans AJ876598, 406–426 GGGAAGGTGATTACCTGTCAG 21 58.51 52.38 F.oxy1 Fusarium oxysporum AY188919, 356–376 GTGTTGGGACTCGCGTTAATT 21 61.27 47.62

F.oxy2 Fusarium oxysporum AY188919, 386–406 CAAATTGATTGGCGGTCACGT 21 65.18 47.62

F.sol1 Fusarium solani AJ608989, 331–351 GTCATTACAACCCTCAGGCCC 21 62.88 57.14

F.sol2 Fusarium solani AJ608989, 447–467 AGCTAACACCTCGCAACTGGA 21 62.25 52.38

F.sol3 Fusarium solani AJ608989, 478–498 GCCATGCCGTAAAACACCCAA 21 67.04 52.38

M.muc1 Mucor mucedo AF412289, 388–408 GATGGCCTTTGAGAGTTTACC 21 57.80 47.62

M.muc2 Mucor mucedo AF412289, 461–681 ACTGTATGTTCGTAGATGCCC 21 56.71 47.62

M.muc3 Mucor mucedo AF412289, 514–534 CGCTTAAAGTCTGCGTGCAAC 21 63.22 52.38

M.rac1 Mucor racemosus AF117924, 166–186 GATCTTGAAATCCCTGAAATT 21 54.89 33.33

M.rac2 Mucor racemosus AF117924, 196–216 CTGAACTTGTTTAAATGCCTG 21 55.24 38.10

Continued on following page

on May 16, 2020 by guest

http://jcm.asm.org/

(3)

sity (MFI) is subsequently measured by flow cytometry. Re-cently, this technology has been successfully used for the

detection of individual pathogenic fungi, such as

Trichos-poron spp. (9), Fusarium spp. (25), and several Candida

species (6, 26, 27). The assay presented herein permits the rapid identification of a broad spectrum of fungal patho-gens, including 10 fungal genera and 29 fungal species, cov-ering both commonly occurring and emerging fungi, and the

TABLE 1—Continued

Probe Specificity(ies) Accession no., position

of target sequence Sequence (5⬘–3⬘)

Length (nucleotides)

Temp (°C)

% G⫹C content

M.rac3 Mucor racemosus,Mucor plumbeus

AF117924, 253–273 GACTTTGATGGGGCCTCCCAA 21 67.58 57.14

P.chr1 Penicillium chrysogenum AM182189, 488–508 CAACCCGAATTTTTATCCAGG 21 60.52 42.86 P.cit1 Penicillium citrinum AM176691, 418–438 CACCCGCTCTAGTAGGCCCGG 21 69.14 71.43 P.cit2 Penicillium citrinum AM176691, 456–477 CCAACCTTTAATTATCTCAGGT 22 54.30 36.36 P.mar1 Penicillium marneffei AJ853738, 471–491 GGTTGGTCACCACCATATTTA 21 57.20 42.86 P.pur1 Penicillium purpurogenum AY373926, 439–459 CGTTGGCCACCCACGATATTT 21 66.04 52.38 P.sim1 Penicillium simplicissimum AJ608945, 445–465 CCTCAATCTTTCTCAGGTTGA 21 56.97 42.86

R.ory1 Rhizopus oryzae AB126323, 529–549 ATGTGGTAATGGGTCGCATCG 21 65.08 52.38

R.ory2 Rhizopus oryzae AB126323, 580–600 GTGTGATTTTCTGTCTGGCTT 21 56.90 42.86

R.ory3 Rhizopus oryzae AB126323, 601–621 GCTAGGCAGGAATATTACGCT 21 57.72 47.62

Genus specifica

Pan-A/P1 A. candidus,A. clavatus,

A. flavus,A. fumigatus,

A. nidulans,A. niger,A. terreus,A. versicolor,A. glaucus,P. chrysogenum,

Penicillium citrinum,P. marneffei,Penicillium purpurogenum,P. simplicissimum

AF455542, 382–403 GCGTCATTGCTGCCCTCAAGC 21 69.59 61.90

Pan-A/P2 A. candidus,A. clavatus,

A. flavus,A. fumigatus,

A. nidulans,A. niger,A. terreus,A. versicolor,A. glaucus,Penicillium chrysogenum,

Penicillium citrinum,

Penicillium marneffei,

Penicillium purpurogenum,

Penicillium simplicissimum

AF455542, 478–498 TCCTCGAGCGTATGGGGCTT 20 66.35 60.00

Pan-Can C. albicans,C.

dubliniensis,C. glabrata,

C. guilliermondi,C. krusei,C. lipolytica,C. lusitaniae,C. parapsilosis,C. tropicalis,C. famata,C. inconspicua,C. kefyr,C. membranifaciens,C. norvegensis,C. pelliculosa,C. pararugosa,C. sake,C. utilis,C. valida,C. zeylanoides

AF217609, 232–252 GGGCATGCCTGTTTGAGCGTC 21 69.39 61.90

Pan-Fus Fusarium oxysporum,

Fusarium proliferatum,

Fusarium verticilloides

AY188919, 349–378 GCGTAGTAGTAAAACCCTCG 20 54.39 50.00

Pan-Tri1 Trichosporon asahii,

Trichosporon beigelii,

Trichosporon inkin,

Trichosporon cutaneum

AJ853754, 372–392 GCTCGCCTTAAAAGAGTTAGC 21 57.64 47.62

Pan-Tri2 Trichosporon asahii,

Trichosporon beigelii,

Trichosporon inkin,

Trichosporon cutaneum

AJ853754, 282–302 TTCCGGAGAGCATGCCTGTTT 21 66.35 52.38

aBased on sequence alignments, the spectrum of fungal species recognized by the genus-specific probe is significantly greater than the number of species tested

experimentally and presented in the table.

on May 16, 2020 by guest

http://jcm.asm.org/

(4)

current panel can be readily extended to cover any other species of interest.

MATERIALS AND METHODS

Fungal strains.Reference fungal strains of all species of interest were ob-tained from different institutions, including the American Type Culture Collec-tion (ATCC, Rockville, MD), the German CollecCollec-tion of Microorganisms (DSM, Braunschweig, Germany), and the Institute of Hygiene and Medical Microbiol-ogy of the Medical University of Vienna (IHMM, Austria). Strains are listed in the table in the supplemental material.

Clinical materials.Specimens from patients with fungal infections, including samples from biopsies of pulmonary infiltrations, bronchoalveolar lavage, bron-chotracheal secretions, and peripheral blood, were obtained after informed con-sent. The clinical samples and blood cultures were provided by the St. Anna Children’s Hospital, Vienna, Austria; the Institute of Hygiene and Medical Microbiology, Medical University of Vienna, Austria; and the Department of Internal Medicine-Hematooncology, University Hospital Brno, Czech Republic. Peripheral blood specimens from healthy volunteer donors were used to test for cross-reactivity with human DNA.

DNA extraction. All steps were performed in a laminar flow hood using one-way sterile utensils. Reagents used for extraction were filtered through 0.2-␮m sterile filters (Corning; Corning, Incorporated, Germany). (i) For fungal strains, a loopful from individual colonies of each fungus culture was homoge-nized in 500␮l of lyticase lysis buffer (LLB; 50 mM Tris [pH 7.6], 1 mM EDTA [pH 8.0], 0.2% 2-mercaptoethanol, and 1 U/100␮l recombinant lyticase [Sigma, Steinheim, Germany]) and incubated at 37°C for 1 h. After incubation, acid-washed glass beads 710 to 1,180␮m in diameter (Sigma) were added and the solution was vortexed thoroughly for 2 min. Amounts of 400␮l of the superna-tant were used for DNA extraction on a MagNA Pure compact instrument using a MagNA Pure compact nucleic acid isolation kit I (Roche Diagnostics, Pen-zberg, Germany), as described by the manufacturer. DNA concentrations were determined by using a PicoGreen double-stranded DNA quantification kit (Mo-lecular Probes, Inc., Eugene, OR) on an F-2500 fluorescence spectrophotometer (Hitachi, Japan). (ii) For peripheral blood specimens, after hypotonic lysis of the erythrocytes using red blood cell lysis buffer (10 mM Tris [pH 7.6], 5 mM MgCl2, 10 mM NaCl [all from Sigma]), as described previously (19), the leukocytes were pelleted and resuspended in 470␮l LLB. The subsequent steps were identical to the extraction protocol described above. (iii) For blood culture specimens, 200-␮l aliquots derived from blood cultures previously shown to be fungus positive were transferred to Falcon tubes and red blood cell lysis buffer was added. The subsequent procedure was as described above. (iv) For plasma containing white blood cells, peripheral blood specimens anticoagulated with EDTA were kept at 4°C for at least 4 h to sediment the red blood cells. The entire supernatant, i.e., plasma containing white blood cells, was used for DNA extraction. The samples were centrifuged at 15,000⫻gfor 10 min. Most of the plasma was removed, leaving a residual volume of 100␮l, and 430␮l of LLB was added. The DNA extraction was performed as described above. (v) For specimens from respiratory tract and lung biopsies, solid material was cut into small pieces and homogenized in 430␮l of LLB. The ensuing steps were as described above.

Seminested PCR amplification.Consensus primers for the ITS2 target region were used to minimize the number of reactions required for subsequent fungus identification. For the first round of amplification, the described universal ITS4 reverse primer (41) (5⬘-TCC TCC GCT TAT TGA TAT GCT-3⬘) and a newly designed forward primer (5⬘-TTT CAA CAA YGG ATC TCT TGG-3⬘), desig-nated ITS1A, were used to amplify a sequence covering the complete ITS1, 5.8S, and ITS2 regions, as well as portions of the 18S and 28S regions of the rDNA gene. Amplicons containing the entire ITS2 region were generated by a second round of amplification using the 5⬘-end biotinylated reverse primer ITS4 (se-quence given above) and two 5⬘-end biotin-labeled forward primers, ITS86-I (5⬘-TGA ATC ATC GAR TCT TTG AAC G-3⬘) and ITS86-II (5⬘-TGA ATC ATC GAG TTC TTG AAC G-3⬘), which hybridize to the 5.8S region of the rDNA gene. The second forward primer, ITS86-II, was necessary for adequate amplification ofCandida kruseiandAbsidia corymbifera. The PCRs were set up in a total volume of 25␮l containing GeneAmp 1⫻PCR buffer II (Applied Biosystems [AB], Branchburg, NJ), 2.5 mM MgCl2(AB), 5 mM deoxynucleotide triphosphate, dATP, dCTP, dGTP, and a 1:8 ratio of dUTP to dTTP (Invitrogen, Lofer, Austria), 400 nM of each primer, 0.25 U heat-labile uracyl-DNA glyco-sylase (UDG; Roche) (for the first round of amplification only) (20), 2.5 U AmpliTaq DNA polymerase (AB), and molecular biology-grade water (Eppen-dorf, Hamburg, Germany). Amounts of 5␮l of template DNA were used for the first round of amplification, and 3␮l of the first-round PCR product served as template for the second round of amplification. The PCR was performed ac-cording to the following protocol: 10 min at 37°C (UDG activation); 95°C for 10 min (polymerase activation); 35 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s; and a final extension at 72°C for 10 min, followed by cooling at 4°C. The amplification conditions for the second round of amplification were identical, omission of the initial UDG activation step being the only difference.

Probe design.The selection of hybridization probes was based on comprehen-sive ITS2 sequence alignments of all fungal strains listed in Table 1, employing a multiple sequence alignment program. We have screened and aligned the appropriate sequences of multiple clinical isolates registered in the GenBank database and performed meticulous sequence comparison of the available en-tries (up to 65 different enen-tries per species). Due to the significant error rate within the GenBank entries (8, 24), selection of species-specific hybridization probes was based on the ITS2 consensus sequence of a broad spectrum of different isolates of individual fungal species of interest (i.e., intraspecies con-sensus). The second important criterion for the selection of species-specific probes was the greatest possible divergence to other fungal species of the same genus (i.e., interspecies diversity).

Additionally, probes with broader specificity covering selected fungal genera (genus-specific detection probes; Table 1) were designed to facilitate more-economical prescreening of clinical specimens. All probes were designed to display an optimal length of 21 nucleotides (range, 20 to 22) and a similar G⫹C content to facilitate multiplex hybridization under uniform conditions. The con-sensus hybridization temperature ofⱖ54°C was determined by using the soft-ware program Primer3. The absence of prospective cross-reactivity of the hy-bridization probes was determined by careful analysis of sequences across a large panel of organisms using the BLAST software. All probes were tagged with the 5⬘-end amino modifier C12, a reactive primary amino group that facilitated the TABLE 2. Identification of zygomycetes,Trichosporon,Fusarium, and other emerging fungal species by species-specific and genus-specific

hybridization probes

Target species (strain) MFI value for indicated species-specific hybridization probe

a

Pan-Tri1 Pan-Tri2 Pan-Fus F.sol1 F.sol2 F.sol3 F.oxy1 F.oxy2 Cr.neo1 Cr.neo2 Cr.neo3 R.ory1

Cryptococcus neoformans (DSM70219)

286 168 866

Fusarium oxysporum(DSM2018) 1,639 807 1,041

Fusarium proliferatum(DSM840) 603

Fusarium solani(DSM62413) 215 229 206

Fusarium verticilloides(DSM62264) 1,689 796 Trichosporon asahii(IHMM) 1,470 1,001

Trichosporon beigelii(IHMM) 1,100 724

Trichosporon cutaneum(DSM70675) 1,099 936

Trichosporon inkin(IHMM) 1,232 679

Rhizopus oryzae(DSM853) 1,231

Mucor mucedo(DSM809) Mucor racemosus(DSM62760) Absidia corymbifera(IHMM) Acremonium strictum(DSM3567)

a

Values indicated in boldface represent specific MFI measurements. Cross-reactivities (i.e., nonspecific values) are indicated in lightface.

on May 16, 2020 by guest

http://jcm.asm.org/

(5)

coupling to the carboxyl group on the xMAP beads (Luminex), and a poly(T) linker (7 T) between the reacting amine and the hybridizing sequence.

Coupling of capture probes to xMAP Luminex beads.Amounts of 100␮l or 1.25 million of the respective Luminex beads, uniquely defined by different red to infrared fluorescent color tones, were used for coupling. The coupling effi-ciency was enhanced by bovine serum albumin coating. The 100-␮l bead solu-tions were supplemented with 0.002% Tween 20, briefly vortexed, and centri-fuged for 3 min at 11,000⫻g. The beads were washed once with 500␮l activation buffer (100 mM NaH2PO4 䡠 2 H2O [pH 6.1]) and resuspended in 192␮l activation buffer by brief vortexing and sonication. Amounts of 24␮l of fresh N-hydroxysulfosuccinimide sodium salt (NHS; Sigma) solution (50 mg/ml in activation buffer) and 24␮l of fresh N-(3-dimethylaminodipropyl)-N⬘-ethylcar-bodiimide (EDC; Sigma) solution (50 mg/ml in activation buffer) were added, and the vials were incubated in the dark for 20 min in the ultrasonic bath. The beads were washed once with 500␮l 50 mM MES buffer (2-[morpholino]eth-anesulfonic acid [Roth], 0.002% Tween 20 [pH 5.0]) and resuspended in 250␮l 50 mM MES buffer without Tween. Amounts of 250␮l of bovine serum albumin solution (0.5 mg/ml in MES buffer) were added, and the vials were incubated in the dark for 2 h under permanent agitation. Then the samples were supple-mented with 0.002% Tween 20, washed twice with 500␮l 0.1 M MES (pH 5.0)–0.002% Tween 20, and resuspended in 30␮l 0.1 M MES. The beads were coupled in the dark with 10␮l of 100 pmol/␮l capture probes in the presence of 10␮l of EDC (100␮g/␮l in H2O) for 1 h under agitation. After 30 min, 10-␮l amounts of a freshly prepared EDC solution were added again. The beads were washed with 1 ml of 0.02% Tween 20 and subsequently with 1 ml of 0.1% sodium dodecyl sulfate. Finally, the beads were resuspended in 100␮l TE (10 mM Tris-HCl, 1 mM EDTA [pH 8.0]) buffer and stored in the dark at 4°C.

Hybridization assay and Luminex measurement.A number of parameters were carefully optimized to establish adequate conditions for hybridization and measurement by multiplex Luminex assays. The appropriate oligonucleotide-coupled xMAP beads were selected, resuspended by vortexing and sonication, and diluted 1:10 in TE buffer. The hybridization reaction mixture contained 0.5 ␮l of each type of coupled beads (approximately 5,000 beads per reaction), 33␮l of 1⫻tetramethyl ammonium chloride (TMAC; 3 M), 0.1% sarcosyl, 50 mM Tris-HCl (pH 8.0), 4 mM EDTA (pH 8.0), 5␮l of biotinylated PCR amplicons and was filled up with TE buffer to a total volume of 50␮l. The reaction mixture was incubated for 5 min at 95°C in a PCR thermocycler, followed by 15 min of incubation at 55°C. The use of high concentrations of TMAC, an ammonium salt agent that increases the stringency conditions of hybridization, was crucial for the discrimination between fungal target sequences differing by only 1 nucleotide. This compound renders the efficiency of oligonucleotide probe hybridization dependent on the length of the probe rather than on the base composition. After hybridization, the beads were pelleted for 3 min at 1,800⫻gand washed once with 100␮l of 1⫻TMAC. Next, the beads were incubated with 100␮l conjuga-tion buffer (80 mM Na2HPO4, 18 mM KH2PO4, 30 mM NaCl), including 200 ng streptavidin–R-phycoerythrin (Sigma), for 5 min in the dark. The washing buffer, the number of wash cycles, the concentration of streptavidin–R-phycoerythrin, and the incubation time for staining were optimized for multiplex, single-well Luminex assays containing pools of differentially coupled beads.

The subsequent detection of the hybridized probes was performed on the Luminex 100 apparatus by analyzing 50 beads of each set. The MFI values were

generated with the Luminex software. The MFI values presented were sub-tracted from the background fluorescence determined by the parallel analysis of control samples containing all components except the PCR amplicons. When analyzing patient specimens, signals were regarded as positive if the fluorescence intensity was at least two times higher than the background noise.

Multiple positive and negative controls were included in each run to assess the amplification efficiency of the preceding seminested PCR amplification of the target sequences and to exclude the occurrence of contamination during analysis.

RESULTS

We have established a high-throughput multiplexed hybrid-ization assay permitting rapid identification of a large spectrum

of pathogenic fungi, including the most importantAspergillus

(n ⫽ 7) and Candida species (n ⫽ 9), as well as emerging

fungal genera, such asCryptococcus, Trichosporon, Fusarium,

Penicillium, Acremonium,Mucor, Rhizopus, and Absidia. The present detection panel includes 69 species-specific hybridiza-tion probes facilitating the identificahybridiza-tion of 29 different patho-genic fungi and 6 genus-specific probes (panprobes) for the

identification of the generaAspergillus,Penicillium,Candida,

Tri-chosporon, andFusarium(including two alternative pan-Aspergil-lus/Penicilliumand pan-Trichosporonprobes) (Table 1).

Selection and design of hybridization probes.The variable

ITS2 sequence within the multicopy rDNA gene cluster was chosen as the target region for the identification of a wide range of fungal pathogens. The ITS2 sequence is flanked by highly conserved nucleotide stretches and can therefore be easily amplified by a universal primer pair. A panel of genus-and species-specific probes hybridizing within the ITS2 region has been carefully designed to facilitate multiplex analysis of fungal pathogens using the Luminex assay. All probes were

conceived to display a length of 20 to 22 nucleotides, a G⫹C

content ranging from 40 to 80%, and a calculated hybridization

temperature ofⱖ54°C in order to permit hybridization under

uniform conditions (Table 1). Predicted formation of hairpin or other secondary structures or stretches of more than four G-C bases within the hybridizing sequence were exclusion cri-teria for the design and selection of oligonucleotide probes. For reliable identification of fungal species with highly con-served ITS2 sequences differing by a single base pair, optimal specificity of detection was achieved by placing the discrimi-nating nucleotide in the center of the probe. Whenever

possi-TABLE 2—Continued

MFI value for indicated species-specific hybridization probe

R.ory2 R.ory3 M.muc1 M.muc2 M.muc3 M.rac1 M.rac2 M.rac3 Ab.cor1 A

b.cor2 Ab.cor3 Ac.str1 Ac.str2 Ac.str3

1,146 1,549

1,009 1,949 2,277

1,290 1,079 1,917

322 374 364

459 415 421

on May 16, 2020 by guest

http://jcm.asm.org/

(6)

ble, two or three probes targeting different portions of the ITS2 region within each fungal species of interest have been de-signed, in order to permit unambiguous identification even in the presence of mutations within individual target sequences. For most fungal species, three different probes were available for specific detection. In some instances, however, the gener-ation of multiple probes displaying adequate specificity was not

possible owing to the presence of very high G⫹C content

within the discriminating sequences or of stretches of high homology to other species. Due to these limitations, only one

species-specific probe could be designed forA. candidus, A.

clavatus, Penicillium chrysogenum, Penicillium marneffei, and Penicillium simplicissimum.

In addition to probes facilitating the identification of indi-vidual fungal species, capture probes for genus-specific classi-fication were generated by targeting regions of the ITS2 se-quence that are conserved among species of individual fungal genera. The current panel includes two

pan-Aspergillus/Penicil-liumprobes (Pan-A/P1 and Pan-A/P2), two pan-Trichosporon

probes (Pan-Tri1 and Pan-Tri2), one pan-Fusarium probe

(Pan-Fus), and one pan-Candida(Pan-Can) probe (Table 1),

facilitating economical prescreening of clinical specimens at the level of fungal genera. The two genus-specific probes

Pan-A/P1 and Pan-A/P2 detect the entire range ofAspergillusand

Penicillium species presented in Table 1. The Pan-Tri1 and Pan-Tri2 probes facilitate the detection of at least four

clini-cally relevantTrichosporonspecies (Tables 1 and 2). The

ge-nus-specificFusariumprobe (Pan-Fus) permits the detection

of theFusariumspecies indicated (Tables 1 and 2). For reliable

detection of Fusarium solani, however, more than 1 pg of

template DNA is required (Table 2). Three species-specific probes (F.sol1, F.sol2, and F.sol3) were therefore designed to

facilitate the detection and identification ofFusarium solaniat

lower concentrations also, down to 10 fg (Table 2). Based on

sequence alignments, the spectrum ofCandidaspecies

recog-nized by the genus-specific probe is significantly greater than

the number of species tested (Table 1), but certainCandida

species, includingC.lipolytica,C.kefyr,C.inconspicua, andC.

valida, are not reliably detected by this probe in clinical spec-imens containing very small amounts of fungal DNA.

How-ever, C. lipolytica, which is certainly the most common and

clinically relevant pathogen of the Candida species not

de-tected by the Pan-Can probe, can be reliably dede-tected and identified by three species-specific probes included in the panel (Table 1).

Assessment of specificity and reproducibility.The eligibility

of probes for use in clinical testing was based on comprehen-sive sequence alignments of numerous clinical isolates of the species of interest registered in the GenBank database. For some fungal strains, we found isolates displaying minor in-traspecies variations within the targeted ITS2 regions. How-ever, all isolates showed 100% homology with at least one species-specific hybridization probe presented in Table 1. In addition to extensive sequence analyses, 82 different fungal strains/isolates of the fungal species covered by the assay were tested experimentally (see the table in the supplemental ma-terial). These strains were derived from reference collections, such as ATCC and DSM, or from the central diagnostic facility of the Medical University of Vienna, IHMM (see Materials and Methods). All fungal isolates used had been controlled by

culture and sequence analysis. The specific hybridization probes showed adequate MFI values, permitting clear and reliable species identification in all cases (data not shown).

To evaluate the specificity and reproducibility of the entire panel of 69 species-specific and 6 genus-specific detection probes, each individual fungal target detection test was as-sessed by a minimum of three independent analyses of a well-defined reference strain. In each analysis, 1 pg of genomic DNA derived from a defined fungal strain was amplified by seminested PCR and hybridized to specific probes coupled to uniquely defined, color-coded microbeads. The subsequent measurements of fluorescence signals were performed in trip-licates. The mean MFI values indicating the binding efficacy of individual species-specific and genus-specific hybridization probes were calculated and are presented in Tables 2, 3, and 4. The signal intensities exhibited by individual probes upon PCR

product analysis of 1 pg genomic template ranged from⬎100

to⬎4,000 MFI above the background levels. The variability of

signal intensities was dependent on the G⫹C content, the

self-complementarity, and the poly(A/T/C/G) content of the hybridization probes (Tables 2, 3, and 4). Assessment of the intra-assay variability revealed standard deviations of MFI values below 3%, and the interassay variability was below 10% in most instances. A small number of probes, however, re-vealed greater fluctuation of MFI values (data not shown). The Luminex technology is therefore only adequate for semiquan-titative analysis of the fungal targets.

An important requirement for the specificity of all genus-specific and species-genus-specific hybridization probes was the absence of relevant cross-reactivity with incompletely homolo-gous fungal target sequences. In rare instances, however, cross-reactivities not interfering with unequivocal fungal species or genus identification were observed (Tables 2, 3, and 4). Four probes showed cross-reactivities revealing MFI values similar

to the specific signals: A.fum2 withPenicillium chrysogenum,

A.fla3 withA. terreus, A.nid1 withA. versicolor, and F.oxy2 with

Fusarium verticilloides(Table 3). Minor cross-reactivities were

observed with five probes: A.fum2 withA. flavus, C.lus3 withC.

parapsilosis, C.par1 withC. albicans, A.fla3 withA. glaucus, and

Pan-Tri2 with C. albicans (Tables 2, 3, and 4). Despite the

cross-reactivity of some probes with certain fungal species, unambiguous species identification was not compromised. This was attributable to the fact that the cross-reactivities did not

occur in both directions (e.g.,A. terreusshowed some

cross-reactivity with one of the probes forA.flavus(A.fla3), butA.

flavusdid not cross-react with the probes forA.terreus(Table 3). Moreover, additional probes lacking any cross-reactivity are available for most fungal species (Tables 2, 3, and 4).

Detection limit.A panfungal seminested PCR protocol was

established for efficient amplification of the ITS2 region of all fungal species tested to ensure high sensitivity of the Luminex hybridization assay. To assess the detection limit of individual hybridization assays, fungal DNA from the strains of interest (Tables 2, 3, and 4) was serially diluted across a range of 10 fg to 10 pg, amplified by seminested PCR, and subjected to Lu-minex analysis. For most hybridization probes, good fluores-cence signals were obtained with template concentrations down to 10 fg, which corresponds to a fraction of a single fungal genome. However, a subset of probes, including A.can1, A.ter1, A.fla2, Ac.str1, Ac.stri2, Ac.str3, Ab.cor1, Ab.cor2,

on May 16, 2020 by guest

http://jcm.asm.org/

(7)

Ab.cor3, C.gla1, Cr.neo1, Cr.neo2, F.oxy1, P.mar1, Pan-Tri1, Pan-Tri-2, and R.ory1, revealed better reproducibility at 100 fg template DNA. To assess the detection limits of the Luminex assay for clinical specimens, 1-ml aliquots of peripheral blood from healthy volunteer donors were spiked with 10-fold serial

dilutions covering a range of 1 to 105conidia fromA. fumigatus

and A. flavus and cells of C. albicans as representatives of molds and yeasts, respectively. Upon DNA extraction and am-plification of the entire ITS2 region, species-specific Luminex detection assays were performed as described in Materials and Methods. Fluorescence signals were obtained down to concen-trations of a single organism per ml peripheral blood, but 10 organisms per ml provided better reproducibility of detection (data not shown). Peripheral blood from healthy volunteer donors that was not spiked with any fungal organism remained negative (data not shown).

Identification of fungal species in blood cultures and

clini-cal specimens.The initial series of tests included the

identifi-cation of fungal species in Candida-positive blood cultures

obtained from 10 patients. Upon extraction of DNA from the respective blood cultures and seminested PCR amplification of the ITS2 target region, Luminex hybridization assays were performed. All specimens analyzed showed high fluorescence

signals with the genus-specificCandidaprobe (Pan-Can), and

the species-specific probes readily permitted the identification

of theCandidaspecies present, includingC.albicans(n⫽6),

C.dubliniensis(n⫽1),C.glabrata(n⫽1),C.tropicalis(n⫽1), and C. parapsilosis(n ⫽ 1) (Table 5). Comparison with the results obtained by conventional blood culture revealed iden-tical results in 9 of 10 instances. In one specimen, culture

indicated the presence ofC.albicans, while the Luminex assay

unambiguously identified the species asC.dubliniensis(Table

5). In a subsequent series of tests, additional clinical specimens

derived from 10 cancer patients with proven (n⫽3), probable

(n ⫽ 2), and suspected (n ⫽ 5) invasive fungal infection,

according to the EORTC (European Organization for Re-search and Treatment of Cancer) criteria, were investigated. The specimens, including two lung biopsy samples, two plasma specimens, two blood specimens, two bronchotracheal secre-tion samples, one bronchoalveolar lavage sample, and one paraffin-embedded lung tissue sample, were analyzed with the Luminex hybridization assay. All specimens revealed specific hybridization signals facilitating the identification of various

fungal pathogens, includingC.lipolytica, A.fumigatus,A.

fla-vus, Penicillium chrysogenum, Rhizopus oryzae, and Trichos-poronspp. (Table 6). A low-level of cross-reactivity of individ-ual probes was observed, but it did not interfere with clear identification of the species present (Table 6). The results obtained with the Luminex detection assays were identical to those obtained by other methods, including microbiological culture and DNA sequencing (Table 6).

DISCUSSION

We present a test system, based on the Luminex hybridiza-tion technology, for genus- and species-specific diagnosis of clinically important fungal pathogens. The intended applica-tion of the assay is rapid identificaapplica-tion of invasive fungi in clinical specimens from immunosuppressed patients, in whom timely detection of the specific fungus type(s) present is critical

TABLE 3. Identification of Aspergillus and Penicillium species by species-specific and genus-specific hybridization probes Target species (strain) MFI value for indicated species-specific hybridization probe a Pan-A/P1 Pan-A/P2 A.can1 A.cla1 A.fla1 A.fla2 A.fla3 A.fum1 A.fum2 A.nid1 A.nid2 A.nig1 A.nig2 A.ter1 A.ter2 P.chry1 P.cit1 P.cit2 P.mar1 P.pur1 P.sim 1 A. candidus (DSM814) 455 660 2,334 A. clavatus (IHMM) 355 855 2,091 A. flavus (IHMM) 337 637 300 566 947 351 A. fumigatus (IHMM) 826 912 2,359 884 A. nidulans (DSM820) 774 1,425 818 1,153 A. niger (IHMM) 516 984 541 1,217 A. terreus (DSM826) 727 496 911 391 1,620 Pencillium chrysogenum (DSM844) 923 770 803 2,127 Pencillium citrinum (DSM1179) 1,066 513 2,640 1,908 Pencillium marnef fei (ATCC 18224) 111 456 837 Pencillium purpurogenum (DSM62866) 1,188 2,298 3,031 Pencillium simplicissimum (DSM1078) 1,031 417 1,943 A. glaucus (IHMM) 581 1,575 358 A. versicolor (DSM1953) 914 1,330 1,188 a Values indicated in boldface represent specific MFI measurements. Cross-reactivities (i.e., nonspecific values) are indicated in lightface.

on May 16, 2020 by guest

http://jcm.asm.org/

(8)

for the optimal choice of treatment and its success. The method presented offers major advantages over traditional di-agnostic approaches primarily based on microbiological cul-ture. Fungus identification by blood culture is less sensitive and often fails to detect invasive infections caused by aspergilli or other molds (29). Moreover, considerable experience is neces-sary for correct phenotypic identification of the steadily ex-panding range of pathogenic and opportunistic fungi. The

dis-crepant result of one clinical specimen identified as C.

dubliniensis by the Luminex assay and C. albicans by blood culture (Table 5) could be attributable to the major phenotypic (22) but only limited genetic similarities between these two species which have likely led to incorrect typing by routine

fungus culture. Unequivocal identification ofC.albicansand

C.dubliniensis, however, may be relevant for the most

appro-priate antifungal treatment. Although the majority ofC.

dub-liniensisisolates are susceptible to currently used antifungal drugs, it has been shown that isolates of this species, unlike

those ofC.albicans, can rapidly develop stable resistance to

fluconazole upon exposure in vitro (23).

The amount of fungal pathogens in clinical specimens, par-ticularly in peripheral blood, is usually very low (18) but may nonetheless indicate a life-threatening situation in immuno-compromised patients. High sensitivity of detection is there-fore a prerequisite for clinical diagnosis of invasive fungal infections in this setting. To achieve adequate sensitivity of the Luminex hybridization technique presented, a two-step pream-plification of fungal DNA was performed, using a newly de-signed and optimized forward primer (ITS1A) for the first round of amplification. The employment of this preamplifica-tion protocol permitted reproducible species identificapreamplifica-tion with the Luminex hybridization assay down to 10 to 100 fg of fungal genomic DNA. This detection limit corresponds to 0.3 to 3 pathogens, based on an average fungal genome mass of approximately 35 fg.

The putative occurrence of intraspecies variations in the target regions of different fungal isolates could represent a possible impediment to the sensitivity and specificity of detec-tion. In order to overcome this potential problem, three dif-ferent hybridization probes were designed for the detection of

TABLE 4. Identification ofCandidaspecies by species-specific and genus-specific hybridization probes

Target species (strain)

MFI value for indicated species-specific hybridization probea

Pan-Can C.alb1 C.alb2 C.alb3 C.dub1 C.dub2 C.dub3 C.gla1 C.gla2 C.gla3 C.gui1 C.gui2 C.gui3

C. albicans(DSM1386) 325 1,031 881 786

C. dubliniensis(ATCC MYA646) 298 1,165 1,429 1,377

C. glabrata(ATCC 2001) 177 463 1,096 522

C. guilliermondi(IHMM) 320 689 787 1,292

C. krusei(IHMM) 342

C. lipolytica(DSM8218)

C. lusitaniae(DSM70102) 322

C. parapsilosis(IHMM) 495

C. tropicalis(DSM5991) 345

C. colliculosa(IHMM) 113

C. cylindracea(DSM2031) 358

C. famata(IHMM) 181

C. inconspicua(DSM70631)

C. kefyr(IHMM)

C. membranifaciens(DSM70109) 171

C. norvegensis(DSM70760) 498

C. pelliculosa(DSM70130) 248

C. pararugosa(IHMM) 215

C. sake(DSM70763) 170

C. utilis(DSM2361) 504

C. valida(IHMM)

C. zeylanoides(DSM70185) 412

a

Values indicated in boldface represent specific MFI measurements. Cross-reactivities (i.e., nonspecific values) are indicated in lightface.

TABLE 5. Analysis of blood culture-positive specimens

Specimen Result of

Luminex assay Specific hybridization probe, MFI value

Cross-reactive probe,

MFI value Result of culture

BC1 C. albicans C.alb1, 820 C.alb2, 651 C.alb3, 570 Pan-Can, 167 C.par1, 190 C. albicans

BC2 C. albicans C.alb1, 482 C.alb2, 373 C.alb3, 360 Pan-Can, 96 C.par1, 106 C. albicans

BC3 C. albicans C.alb1, 252 C.alb2, 185 C.alb3, 218 Pan-Can, 48 C.par1, 70 C. albicans

BC4 C. albicans C.alb1, 1,166 C.alb2, 919 C.alb3, 920 Pan-Can, 298 C.par1, 292 C. albicans

BC5 C. albicans C.alb1, 1,166 C.alb2, 919 C.alb3, 920 Pan-Can, 294 C.par1, 287 C. albicans

BC6 C. albicans C.alb1, 1,390 C.alb2, 1,383 C.alb3, 1,181 Pan-Can, 453 C.par1, 497 C. albicans

BC7 C. dubliniensis C.dub1, 1,096 C.dub2, 1,253 C.dub3, 1153 Pan-Can, 229 C. albicans

BC8 C. glabrata C.gla1, 598 C.gla2, 1,320 C.gla3, 702 Pan-Can, 451 C. glabrata

BC9 C. tropicalis C.tro1, 705 C.tro2, 1,273 C.tro3, 803 Pan-Can, 271 C.lus3, 97 C. tropicalis

BC10 C. parapsilosis C.par1, 988 C.par2, 1,217 C.par3, 1,683 Pan-Can, 433 C. parapsilosis

on May 16, 2020 by guest

http://jcm.asm.org/

(9)

each species, whenever possible, to permit unambiguous iden-tification of the fungal pathogen even in the presence of mu-tations in one of the target regions. Comprehensive ITS2 se-quence alignments, including sese-quences of up to 65 clinical isolates, of the individual fungal species of interest listed in the GenBank database revealed 100% homology with at least one hybridization probe presented in Table 1.

Some fungal genera display very limited variability within their ITS2 sequences, thereby preventing the design of multi-ple genus- or species-specific probes targeting different re-gions. This problem became apparent in the differentiation

between the generaAspergillusandPenicillium, where the very

high level of homology within the ITS2 region precluded the design of genus-specific probes permitting reliable

discrimina-tion. However, the pan-Aspergillus/Penicilliumprobes were

em-ployed to facilitate economical prescreening of clinical speci-mens at the level of fungal genera. In specispeci-mens testing positive in the prescreening, subsequent identification at the level of individual species was based on the application of species-specific hybridization probes (Table 3). Although there

are reports of the occurrence of invasive penicilliosis,

particu-larly from Southeast Asia, which is mostly caused by

Penicil-lium marneffei (32, 38), the presence of Penicillium spp. in clinical specimens from European and North American pa-tients is generally regarded as environmental contamination. The inclusion of probes for specific identification of the

most-common environmentalPenicilliumspecies may therefore help

prevent false diagnosis of aspergillosis in the clinical setting. Our current detection panel includes 69 species-specific and 6 genus-specific hybridization probes targeting the variable ITS2 region (Table 1). To render the detection system highly flexible, the probes were designed in a manner permitting any combination in individual multiplex tests. This permits the establishment of subpanels for the identification of individual fungal species and genera of interest, depending on the specific requirements of any particular application. For application in the identification of invasive fungal pathogens in the routine clinical setting, we have assembled the hybridization probes into two detection assays: a mold identification assay

compris-ing allAspergillus-,Penicillium-,Fusarium-, and

Acremonium-TABLE 4—Continued

MFI value for indicated species-specific hybridization probe

C.kru1 C.kru2 C.kru3 C.lip1 C.lip2 C.lip3 C.lus1 C.lus2 C.lus3 C.par1 C.par2 C.par3 C.tro1 C.tro2 C.tro3

278

512 1,035 945

886 1,234 4,337

467 566 2,211

250 1,230 1,586 2,641

977 1,731 1,118

TABLE 6. Analysis of clinical specimens with documented fungal infections

Type of

specimena Result of

Luminex assay Specific hybridization probe, MFI value

Cross-reactive probe, MFI

value

Result of sequencing

Result of culture

Lung C. lipolytica C.lip1, 533 C.lip2, 868 C.lip3, 3,202 Pan-Can, 494 C. lipolytica

A. fumigatus A.fum1, 304 A.fum2, 79 Pan-A/P1, 164 Pan-A/P2, 135 A. fumigatus A. fumigatus Plasma A. flavus A.fla1, 302 A.fla2, 365 A.fla3, 951 Pan-A/P1, 116 Pan-A/P2, 428 A.fum2, 156 A. flavus

P. chrysogenum P.chr1, 128 P.chr2, 36 Pan-A/P1, 114 Pan-A/P2, 129 Penicilliumsp. Blood A. flavus A.fla1, 80 A.fla2, 216 A.fla3, 789 Pan-A/P1, 123 Pan-A/P2, 225 A.fum2, 113 A. flavus

A. fumigatus A.fum1, 1971 A.fum2, 574 Pan-A/P1, 630 Pan-A/P2, 600 A. fumigatus

BS R. oryzae R.ory1, 506 R.ory2, 734 R.ory3, 823 R. oryzae A. fumigatus A.fum1, 838 A.fum2, 157 Pan-A/P1, 281 Pan-A/P2, 208 A. fumigatus BAL R. oryzae R.ory1, 245 R.ory2, 276 R.ory3, 350 R. oryzae

PE tissue Trichosporonsp. Pan-Tri1, 564 Pan-Tri2, 471 T. cutaneum

aBS, bronchotracheal secretion; BAL, bronchoalveolar lavage; PE, paraffin-embedded.

on May 16, 2020 by guest

http://jcm.asm.org/

(10)

specific probes, and a yeast/Zygomycetes identification assay

comprising allCandida-,Trichosporon-,Cryptococcus-,Mucor-,

Rhizopus-, andAbsidia-specific probes. The Luminex hybrid-ization assay presented was designed for specific identification of fungal genera and species and not for quantification of fungus load. Although at least semiquantitative analysis would be feasible upon the introduction of appropriate controls, we generally use a real-time panfungal PCR screening assay for detection of fungal infection and fungal load assessment prior to specific fungus typing by the Luminex assay. The panfungal real-time PCR test developed in our laboratory (L. Baskova and T. Lion, patent application 06817468.9, Europe) comprises two reactions, one covering a broad spectrum of molds and the other a broad spectrum of yeasts and Zygomycetes. For the analysis of clinical samples presented here, specimens that tested positive for mold DNA by real-time PCR were subjected to the Luminex mold assay to identify the pathogen(s) present, whereas yeast- or Zygomycetes-positive real-time PCR sam-ples were further analyzed with the yeast/Zygomycetes Lumi-nex assay.

An essential feature of the Luminex method described herein is the detection of potential coinfections with multiple fungal species in patients revealing positive findings in broad-spectrum real-time PCR screening tests. Concomitant infec-tions with two or more different fungi are not uncommon in immunocompromised individuals, and their identification may be an important prerequisite for determining the most appro-priate antifungal therapy.

The Luminex assay described facilitates high-throughput species-specific identification of a wide range of pathogenic fungi within a few hours. The detection spectrum of the Lu-minex assay comprises more than 30 fungal species but can be readily extended to meet general or local requirements of species identification. Upon confirmation of its utility in large-scale clinical studies, this method may contribute to improved management of invasive fungal infections.

ACKNOWLEDGMENTS

This study was supported by grants from the Austrian Science Fund (FWF) (P16929-B13), the Austrian Center for Innovation and Tech-nology (ZIT) (Calls Co-Operate Enlarged-Vienna 2005 and Life Sci-ences-Vienna 2006), and Fonds der Stadt Wien fu¨r innovative interd-isziplina¨re Krebsforschung.

REFERENCES

1.Baskova, L., C. Landlinger, S. Preuner, and T. Lion.2007. The Pan-AC assay: a single-reaction real-time PCR test for quantitative detection of a broad range of Aspergillus and Candida species. J. Med. Microbiol.56:1167– 1173.

2.Boyanton, B. L., Jr., R. A. Luna, L. R. Fasciano, K. G. Menne, and J. Versalovic.2008. DNA pyrosequencing-based identification of pathogenic Candida species by using the internal transcribed spacer 2 region. Arch. Pathol. Lab. Med.132:667–674.

3.Bu, R., R. K. Sathiapalan, M. M. Ibrahim, I. Al-Mohsen, E. Almodavar, M. I. Gutierrez, and K. Bhatia.2005. Monochrome LightCycler PCR assay for detection and quantification of five common species of Candida and As-pergillus. J. Med. Microbiol.54:243–248.

4.Campa, D., A. Tavanti, F. Gemignani, C. S. Mogavero, I. Bellini, F. Bottari, R. Barale, S. Landi, and S. Senesi.2008. DNA microarray based on arrayed-primer extension technique for identification of pathogenic fungi responsible for invasive and superficial mycoses. J. Clin. Microbiol.46:909–915. 5.Chen, Y. C., J. D. Eisner, M. M. Kattar, S. L. Rassoulian-Barrett, K. LaFe,

S. L. Yarfitz, A. P. Limaye, and B. T. Cookson. 2000. Identification of medically important yeasts using PCR-based detection of DNA sequence polymorphisms in the internal transcribed spacer 2 region of the rRNA genes. J. Clin. Microbiol.38:2302–2310.

6.Das, S., T. M. Brown, K. L. Kellar, B. P. Holloway, and C. J. Morrison.2006. DNA probes for the rapid identification of medically important Candida species using a multianalyte profiling system. FEMS Immunol. Med. Micro-biol.46:244–250.

7.De Baere, T., G. Claeys, D. Swinne, G. Verschraegen, A. Muylaert, C. Mas-sonet, and M. Vaneechoutte. 2002. Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region (ITS2). BMC Microbiol.2:21.

8.de Hoog, G. S., and R. Horre.2002. Molecular taxonomy of the Alternaria and Ulocladium species from humans and their identification in the routine laboratory. Mycoses45:259–276.

9.Diaz, M. R., and J. W. Fell.2004. High-throughput detection of pathogenic yeasts of the genus trichosporon. J. Clin. Microbiol.42:3696–3706. 10.Dunbar, S. A.2006. Applications of Luminex xMAP technology for rapid,

high-throughput multiplexed nucleic acid detection. Clin. Chim. Acta363:

71–82.

11.Enoch, D. A., H. A. Ludlam, and N. M. Brown.2006. Invasive fungal infec-tions: a review of epidemiology and management options. J. Med. Microbiol.

55:809–818.

12.Imhof, A., C. Schaer, G. Schoedon, D. J. Schaer, R. B. Walter, A. Schaffner, and M. Schneemann.2003. Rapid detection of pathogenic fungi from clinical specimens using LightCycler real-time fluorescence PCR. Eur. J. Clin. Mi-crobiol. Infect. Dis.22:558–560.

13.Jordanides, N. E., E. K. Allan, L. A. McLintock, M. Copland, M. Devaney, K. Stewart, A. N. Parker, P. R. Johnson, T. L. Holyoake, and B. L. Jones.

2005. A prospective study of real-time panfungal PCR for the early diagnosis of invasive fungal infection in haemato-oncology patients. Bone Marrow Transplant.35:389–395.

14.Kasai, M., A. Francesconi, R. Petraitiene, V. Petraitis, A. M. Kelaher, H. S. Kim, J. Meletiadis, T. Sein, J. Bacher, and T. J. Walsh.2006. Use of quantitative real-time PCR to study the kinetics of extracellular DNA re-leased from Candida albicans, with implications for diagnosis of invasive candidiasis. J. Clin. Microbiol.44:143–150.

15.Kauffman, C. A.2006. Fungal infections. Proc. Am. Thorac. Soc.3:35–40. 16.Klingspor, L., and S. Jalal.2006. Molecular detection and identification of

Candida and Aspergillus spp. from clinical samples using real-time PCR. Clin. Microbiol. Infect.12:745–753.

17. Reference deleted.

18.Loeffler, J., N. Henke, H. Hebart, D. Schmidt, L. Hagmeyer, U. Schumacher, and H. Einsele.2000. Quantification of fungal DNA by using fluorescence resonance energy transfer and the light cycler system. J. Clin. Microbiol.

38:586–590.

19.Lo¨ffler, J., H. Hebart, U. Schumacher, H. Reitze, and H. Einsele.1997. Comparison of different methods for extraction of DNA of fungal pathogens from cultures and blood. J. Clin. Microbiol.35:3311–3312.

20.Longo, M. C., M. S. Berninger, and J. L. Hartley.1990. Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reac-tions. Gene93:125–128.

21.Maaroufi, Y., J. M. De Bruyne, V. Duchateau, A. Georgala, and F. Crokaert.

2004. Early detection and identification of commonly encountered Candida species from simulated blood cultures by using a real-time PCR-based assay. J. Mol. Diagn.6:108–114.

22.Marot-Leblond, A., L. Grimaud, S. David, D. J. Sullivan, D. C. Coleman, J. Ponton, and R. Robert.2004. Evaluation of a rapid immunochromatographic assay for identification ofCandida albicansandCandida dubliniensis. J. Clin. Microbiol.42:4956–4960.

23.Moran, G. P., D. Sanglard, S. M. Donnelly, D. B. Shanley, D. J. Sullivan, and D. C. Coleman.1998. Identification and expression of multidrug transporters responsible for fluconazole resistance inCandida dubliniensis. Antimicrob. Agents Chemother.42:1819–1830.

24.Nilsson, R. H., M. Ryberg, E. Kristiansson, K. Abarenkov, K. H. Larsson, and U. Koljalg.2006. Taxonomic reliability of DNA sequences in public sequence databases: a fungal perspective. PLoS ONE1:e59.

25.O’Donnell, K., B. A. Sarver, M. Brandt, D. C. Chang, J. Noble-Wang, B. J. Park, D. A. Sutton, L. Benjamin, M. Lindsley, A. Padhye, D. M. Geiser, and T. J. Ward.2007. Phylogenetic diversity and microsphere array-based geno-typing of human pathogenicFusaria, including isolates from the multistate contact lens-associated U.S. keratitis outbreaks of 2005 and 2006. J. Clin. Microbiol.45:2235–2248.

26.Page, B. T., and C. P. Kurtzman.2005. Rapid identification ofCandida species and other clinically important yeast species by flow cytometry. J. Clin. Microbiol.43:4507–4514.

27.Page, B. T., C. E. Shields, W. G. Merz, and C. P. Kurtzman.2006. Rapid identification of ascomycetous yeasts from clinical specimens by a molecular method based on flow cytometry and comparison with identifications from phenotypic assays. J. Clin. Microbiol.44:3167–3171.

28.Putignani, L., M. G. Paglia, E. Bordi, E. Nebuloso, L. P. Pucillo, and P. Visca.2008. Identification of clinically relevant yeast species by DNA se-quence analysis of the D2 variable region of the 25-28S rRNA gene. Mycoses

51:209–227.

29.Rickerts, V., S. Mousset, E. Lambrecht, K. Tintelnot, R. Schwerdtfeger, E.

on May 16, 2020 by guest

http://jcm.asm.org/

(11)

Presterl, V. Jacobi, G. Just-Nubling, and R. Bialek.2007. Comparison of histopathological analysis, culture, and polymerase chain reaction assays to detect invasive mold infections from biopsy specimens. Clin. Infect. Dis.

44:1078–1083.

30.Schabereiter-Gurtner, C., B. Selitsch, M. L. Rotter, A. M. Hirschl, and B. Willinger.2007. Development of novel real-time PCR assays for detection and differentiation of eleven medically important Aspergillus and Candida species in clinical specimens. J. Clin. Microbiol.45:906–914.

31.Selvarangan, R., U. Bui, A. P. Limaye, and B. T. Cookson.2003. Rapid identification of commonly encountered Candida species directly from blood culture bottles. J. Clin. Microbiol.41:5660–5664.

32.Shen, Y. Z., T. K. Qi, J. X. Ma, X. Y. Jiang, J. R. Wang, Q. N. Xu, Q. Huang, X. N. Liu, H. Q. Sun, and H. Z. Lu.2007. Invasive fungal infections among inpatients with acquired immune deficiency syndrome at a Chinese university hospital. Mycoses50:475–480.

33.Singh, N.2001. Trends in the epidemiology of opportunistic fungal infec-tions: predisposing factors and the impact of antimicrobial use practices. Clin. Infect. Dis.33:1692–1696.

34.Slavin, M. A., J. Szer, A. P. Grigg, A. W. Roberts, J. F. Seymour, J. Sasa-deusz, K. Thursky, S. C. Chen, C. O. Morrissey, C. H. Heath, and T. Sorrell.

2004. Guidelines for the use of antifungal agents in the treatment of invasive Candida and mould infections. Intern. Med. J.34:192–200.

35.Spiess, B., D. Buchheidt, C. Baust, H. Skladny, W. Seifarth, U. Zeilfelder, C. Leib-Mosch, H. Morz, and R. Hehlmann.2003. Development of a Light-Cycler PCR assay for detection and quantification ofAspergillus fumigatus

DNA in clinical samples from neutropenic patients. J. Clin. Microbiol.41:

1811–1818.

36.Spiess, B., W. Seifarth, M. Hummel, O. Frank, A. Fabarius, C. Zheng, H. Morz, R. Hehlmann, and D. Buchheidt.2007. DNA microarray-based de-tection and identification of fungal pathogens in clinical samples from neu-tropenic patients. J. Clin. Microbiol.45:3743–3753.

37.Turenne, C. Y., S. E. Sanche, D. J. Hoban, J. A. Karlowsky, and A. M. Kabani.1999. Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system. J. Clin. Mi-crobiol.37:1846–1851.

38.Vanittanakom, N., C. R. Cooper, Jr., M. C. Fisher, and T. Sirisanthana.

2006.Penicillium marneffeiinfection and recent advances in the epidemiol-ogy and molecular biolepidemiol-ogy aspects. Clin. Microbiol. Rev.19:95–110. 39.Warnock, D. W.2007. Trends in the epidemiology of invasive fungal

infec-tions. Nippon Ishinkin Gakkai Zasshi48:1–12.

40.White, P. L., A. Shetty, and R. A. Barnes.2003. Detection of seven Candida species using the Light-Cycler system. J. Med. Microbiol.52:229–238. 41.White, T. J., T. Bruns, S. Lee, and J. Taylor.1990. Amplification and direct

sequencing of fungal ribosomal RNA genes for phylogenetics, p. 315–322.In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications, Academic Press, San Diego, CA. 42.Zeng, X., F. Kong, C. Halliday, S. Chen, A. Lau, G. Playford, and T. C.

Sorrell. 2007. Reverse line blot hybridization assay for identification of medically important fungi from culture and clinical specimens. J. Clin. Mi-crobiol.45:2872–2880.

on May 16, 2020 by guest

http://jcm.asm.org/

Figure

TABLE 1. Species-specific and genus-specific hybridization probes

TABLE 1.

Species-specific and genus-specific hybridization probes p.2
TABLE 1—Continued

TABLE 1—Continued

p.3
TABLE 2. Identification of zygomycetes, Trichosporon, Fusarium, and other emerging fungal species by species-specific and genus-specifichybridization probes

TABLE 2.

Identification of zygomycetes, Trichosporon, Fusarium, and other emerging fungal species by species-specific and genus-specifichybridization probes p.4
TABLE 3. Identification of Aspergillus and Penicillium species by species-specific and genus-specific hybridization probes

TABLE 3.

Identification of Aspergillus and Penicillium species by species-specific and genus-specific hybridization probes p.7
TABLE 5. Analysis of blood culture-positive specimens

TABLE 5.

Analysis of blood culture-positive specimens p.8
TABLE 4. Identification of Candida species by species-specific and genus-specific hybridization probes

TABLE 4.

Identification of Candida species by species-specific and genus-specific hybridization probes p.8
TABLE 4—Continued

TABLE 4—Continued

p.9
TABLE 6. Analysis of clinical specimens with documented fungal infections

TABLE 6.

Analysis of clinical specimens with documented fungal infections p.9

References