JOURNALOF CLINICALMICROBIOLOGY, Sept. 1990,p. 1982-1987 0095-1137/90/091982-06$02.00/0
Copyright© 1990,American Society forMicrobiology
Analysis of
a
Repetitive DNA Sequence from
Bordetella pertussis
and
Its
Application
to
the
Diagnosis of Pertussis Using the
Polymerase Chain Reaction
ERIC M. GLARE,' JAMES C. PATON,1* ROBERT R. PREMIER,2 ANDREW J. LAWRENCE,'
AND IAN T. NISBET2
Microbiology Department, Adelaide Children'sHospital, NorthAdelaide, South Australia 5006,' and Commonwealth Serum Laboratories, Parkville, Victoria 3052,2 Australia
Received 13February1990/Accepted 13 June 1990
A tandemly repeated 1,046-base-pair (bp) ClaI DNA fragment fromBordetellapertussis was cloned into Escherichia coli by using thevectorpUC19. Thisfragment, whenisolated, hybridized stronglytoDNAfrom
all 100 clinical isolates of B. pertussis tested. It was shown to have homology to single-copy sequences in Bordetellabronchiseptica but notBordetellaparapertussis and didnothybridizetolysateblots ofawide range
of otherbacteria,includingmembers of thecloselyrelatedgeneraPasteurella,Alcaligenes,andHaemophilus. The 1,046-bp fragmentwassequenced,andcomplementary synthetic oligonucleotides flankinga153-bp region withinthe repeatedelementwereusedasprimersforspecific amplificationofthisregion usingthepolymerase
chain reaction (PCR). This procedure was then applied to the rapid (5-h) detection of B. pertussis in
nasopharyngeal secretionscollected from 332 children withsuspected pertussis.Thetestyielded positiveresults inatotalof98 samples, comparedwith66 for cultureand33for direct immunofluorescence (IF).Allofthe
IF-positive samples were PCR positive, as were 63 of the samples from which B. pertussis was eventually cultured. Two hundredthirty-one specimenswhichwerenegative byIF and culture werealsonegative inthe PCR assay. However, 33 culture- and IF-negative specimens were positive by PCR assay. Several ofthese
specimens were collected from closecontacts ofculture-proven pertussis patients,were follow-up specimens
from suchpatients, or were frompatientswith serological evidence ofpertussisand thereforemay be
true-rather thanfalse-positives.
In recent years much interest has centered on the appli-cation ofnucleic acid probes to thediagnosis of infectious
diseases, particularlyin view of theavailabilityof nonradio-active labeling techniques. These diagnostic probes will be
particularly useful for organisms which are fastidious or
difficult to culture in vitro. Bordetella pertussis is such an
organism. It takes several days to isolate and identify B.
pertussis from cultures of nasopharyngeal secretions.
Fur-thermore, false-negative culture results are obtained in a
significant proportion of pertussis cases (12).
Recently,thepresenceofspecificreiteratedchromosomal
DNAsequences has beenreported foranumber of bacterial
species (4, 7, 8), includingB.pertussis (1, 14-17).Theseare ideal targets fordiagnostic probes because multiple targets tendtoenhance the sensitivity of probe-based assays. In B.
pertussis the repeat ispresent in 50to 100copies per cell, andconsensus sequences uptoapproximately 1.1 kilobase
pairs (kbp) long have been determined by comparing
se-quence dataobtained from different clones containing por-tions of therepeating element(14, 17).
In the present study, we have shown that the repeated elementisindeed 1,046basepairs (bp) long andthatmanyof
thecopies arearranged in tandem onthechromosome. We have analyzedthe specificity of the repeat and developed a
potentialdiagnostictestfor pertussis basedonamplification
ofa 153-bp region of the repeated element using the
poly-merase chainreaction (PCR).
*Corresponding author.
MATERIALSANDMETHODS
Bacterial strains and cloning vectors. B. pertussis NCTC 10908, NCTC 10911, and NCTC 10739,Bordetella
paraper-tussis NCTC 5952, and Bordetella bronchiseptica NCTC
8344 were obtained from the National Collection ofType
Cultures, London, United Kingdom, and were grown on
charcoal agar (Oxoid Ltd., Basingstoke, United Kingdom) containing10% defibrinated horse blood. Clinical isolatesof B. pertussis and B. parapertussis were collected at the
Adelaide Children's Hospital, Adelaide, South Australia,
Australia. Escherichia coli K-12 strain JM109 (19) has been
described previously and was grown in Luria-Bertani me-dium (13) with or without 1.5% Bacto-Agar (Difco
Labora-tories, Detroit, Mich.). When appropriate, ampicillin was added to media at 50 Fg/ml. Plasmids pUC18 and pUC19
have also beendescribed previously (19).
Chromosomal DNA extraction from Bordetella species. Chromosomal DNA was extracted from Bordetella species
by a modification of the method ofBrown and Parker (2). Bacteriagrown onfourcharcoalagarplateswere harvested andwashed in 150mMNaCI-10mMTrishydrochloride(pH
7.5) and resuspended in a volume of 20 ml of the same mixture. The suspensionwasfrozenat -20°C. One volume of 1% sodium dodecyl sulfate-100 mM NaCl-100 mM Tris
hydrochloride (pH 8.8)-100 ,ug of pronase (Boehringer
Mannheim, North Ryde, New South Wales, Australia) per mlwasself-digestedat37°C for1h before being usedtothaw the cell suspension by gentle inversion. The lysate was
digested overnightat37°C. Nucleic acids were precipitated with2.5 volumesofchilled ethanol, suspended in TE buffer
(10 mM Tris hydrochloride, 0.1 mM EDTA [pH 8.0]), and
digested again with pronase overnight. The solution was
1982
Vol.28,No. 9
on April 12, 2020 by guest
http://jcm.asm.org/
extracted with phenol-chloroform (1:1) and then with chlo-roform and was precipitated again. B. pertussis DNA was further purified on a
CsCi
gradient. TEbuffer-CsCI
(735 mg/ml) was added to 8-ml centrifuge tubes and underlaid with 2.4ml of DNA solution to which 4.2 g ofCsCI
and 400,ul
of ethidium bromide (10 mg/ml) had been added. After centrifugation at 180,000 x g for 42h,
DNA bands were removed under UV illumination andcleaned as described by Maniatis et al. (13).Methods for DNA isolation and analysis.Plasmid DNA was isolated by the alkaline lysis method described by Maniatis et al. (13). E. coli cells were treated with CaCl2 and trans-formed with plasmid DNA as described by Brown etal. (3). Digestion of genomic DNA and plasmids with restriction endonucleases was conducted under the conditions recom-mended by the supplier (Boehringer Mannheim). Restricted DNA was electrophoresed in agarose gels with a Tris-borate-EDTA buffer system as described by Maniatis et al. (13). Restriction fragments were purified from agarose gels with Geneclean (Bio 101,Inc., La Jolla, Calif.). Electrophoresed DNA was transferred to nitrocellulose by the method of Southern (18) and then hybridized and autoradiographed as described by Maniatis et al. (13). Hybridization was carried out overnight at 420C in 6x SSC (lx SSC is 0.15 M
NaCI
plus 0.015 M sodium
citrate)-1
x Denhardtsolution-1%
sodium dodecyl sulfate-100 ,ug of herring sperm DNA per ml-100
,ug
of heparin per ml-50% formamide. Filters were washed twice in 2x SSC for5min at65°C and twicein0.2x SSC-0.1% sodium dodecyl sulfate for5 min at 65°C. Probe DNA waslabeled with[ct-32P]dCTP
(3,000Ci/mmol;
Amer-sham, North Ryde, New South Wales, Australia) by the method of Feinberg andVogelstein
(5).Lysate blots. A light suspension ofbacterial
cells
from agar plates was made in 200,ul
of TE buffer.Cells
werethenlysed
by the addition of sodium dodecyl sulfateto a final concen-tration of 1%. After the suspension wasvortexed briefly, 0.8 M NaOH was added to a final volume of 1.2ml. Samples of each lysate werediluted 1:100 with 0.8MNaOHandapplied to nitrocellulose by loading 50
,ul
into thewells of aBio-Dot apparatus (Bio-Rad Laboratories, Richmond, Calif.). The samples were washed with 100,ul
of20x SSC perwell
before the membrane was removed and baked for 2 h in vacuo at 800C.DNA sequencing. Nested deletions ofcloned DNA were constructed by using an Erase-a-base kit obtained from Promega Corp., Madison,Wis. Bidirectional DNA sequenc-ing was then carried out by the
double-stranded
template technique described by Kraft etal.
(9).Preparation and PCR amplification of extracts ofNPA. A total of 332 nasopharyngeal aspirates (NPA) were obtained from children aged 10 days to 16 years (median age, approx-imately 18 months) with suspected pertussis (patients had a persistent cough with or without vomiting or paroxysms). Specimens collected over a12-month period were tested,but most of thesewereobtained duringthelast3monthsof1989, which was a period of high incidence ofpertussis in Ade-laide.
The NPA collection tubing was flushed out by aspiration of 1 ml of sterile saline, and the entire sample was then vortexed. Samples were immediately removed for culture and direct immunofluorescence (IF) analysis as described below. Samples (50 ,ul) ofthe remainder of the NPA were digested by the addition of 1 M Tris hydrochloride, pH 7.6, to 12 mM and proteinase K to 0.2 mg/ml and incubation at
65°C for 1 h. The proteinase K was then inactivated by boiling the extracts for 20 min.
PCR amplification was conducted in
50-,ul
reactionmix-tures
containing
20pul
of NPA extract, 200,uM
deoxynucle-osidetriphosphates,
approximately 1,uM
eachprimer, and1 U of Taqpolymerase and a buffer(Ten X Activity Grade), both of which were from IBI, New Haven, Conn. Thesequences
of the two oligonucleotide primers are 5'-GATTCAATAGGTTGTATGCATGGTT-3' and 5'-AATTGCTG GACCATTTCGAGTCGACG-3'. Samples were subjected to 30 PCR cycles, each consisting of1-min denaturation,
an-nealing,
andelongation
steps attemperatures of 94, 57,and72°C,
respectively. The 153-bp amplified product was de-tected byelectrophoresing
20-,ul
aliquots through 2% agar-ose gels in the presence ofethidium bromide for approxi-mately 30 min at 10 V/cm, followed by photography under UV illumination. Positive (B. pertussis DNA) andnegative
(proteinase K-treated saline) control extracts were included in each PCRrun.
Detection of B. pertussis by culture and IF. NPA were
cultured(100to200pil ofsample perplate) immediately after collection on charcoal agar, as well as on charcoal agar supplemented with 40
,ug
ofcephalexin perml andcharcoal agar supplemented with 2.5ktg
offlucloxacillin per ml, and were incubated for up to 7 days at 37°C. Plates were examined daily, and suspect colonies were subcultured and identified by slide agglutination with B. pertussis and B. parapertussis antisera obtained from WellcomeDiagnostics, Dartford,UnitedKingdom. For direct IF,100-,ul samples of eachaspirate were fixed on slides and stained withfluores-cein-conjugated
rabbit anti-B. pertussis antibody(Difco).
RESULTS
Cloningrepetitivesequences in E. coli. B. pertussis NCTC 10908 DNA wasdigestedtocompletion with Sau3AI, ligated into the BamHI site of pUC19, andused totransformE. coli JM109. DNA from recombinant clones was extracted, and the inserts were excised by double digestion with EcoRI and HindIII. After electrophoresis through 2% agarose gels and transfer to nitrocellulose, the filters were probed with ge-nomic B. pertussis DNA. The inserts of four of the recom-binant plasmids produced stronger hybridizationsignals than didthose ofthe other clones, implying that theirsequences were relatively more abundant in the heterogeneous probe DNA.Thesefour inserts wereallthe same size (188 bp) and hybridized strongly to each other.
One of theplasmids, designated pJCP601, was chosen for further study. To confirm that the cloned DNA was reiter-ated, the purified insert wasused toprobe Southern blotsof restricted B. pertussis genomic DNA (Fig. 1). It hybridized to multiple (at least 40) bands in the various digests and particularly highlighted a 1-kbp fragment in the ClaI digest, suggesting the existence of tandem repeats. This fragment was clearly visible as a distinct band in ethidium bromide-stained gels of ClaI-digested DNA and could be easily excised from the gel. The purified ClaI fragment was then ligatedinto the AccIsite ofpUC19, and, after transformation into E. coli, positiveclones were detectedbyprobing colony blots with the 32P-labeled insert of pJCP601; one of these was designated pJCP602. The hybridization pattern of the cloned ClaI fragment (from pJCP602) to various digests of chromosomal DNAis virtually identical tothe hybridization pattern obtained by using the 188-bp Sau3AI fragment in pJCP601 as a probe (Fig. 1),
indicating
that the smaller fragment is containedwithin most of thecopiesofthe1-kbp
ClaI fragmentin the genome. TheClaI fragmentcontained a single AccI site, and when Southern blots ofgenomic DNA
on April 12, 2020 by guest
http://jcm.asm.org/
1984 GLARE ET AL.
A_ kb 1 2 3
_
1
f
....w
::
r
.i._.
*`%
e.;,1
kb
B C
1 2 3 1 2 3
FIG. 1. Southern blotanalysisof B.pertussisDNA.B.pertussis NCTC10908 DNAwasdigestedwith BamHI(B),EcoRI(E), PstI (P), or ClaI (C), electrophoresed on a 0.8% agarose gel, and transferred to nitrocellulose. Filters were probed with the 32p_ labeled inserts of pJCP601 (lanes 1) or pJCP602 (lanes 2). The mobilities ofvariousDNA size markersareindicated.
digested with thisenzymeorClaIwereprobedwith theClaI fragment, a comigrating DNA band was strongly labeled
(resultnotshown). This furthersupports thesuggestionthat manyof the copies of the repeated sequencearearrangedin
tandem.
Specificity of the repeatedsequence.Toassessthe
suitabil-ity of the cloned ClaI fragment as adiagnostic DNA probe specific forB.pertussis, theClaIfragmentwashybridizedto
lysate blots of 96 different bacteria isolated from clinical
specimens. These bacteria included 45 different species representing 24genera. While theprobe hybridized strongly
to B. pertussis strains, it did not hybridize to any other
bacteria, including members of the most closely related
genera (Pasteurella, Alcaligenes, and Haemophilus).
Fur-thermore, no hybridization was observed with B.
paraper-tussis lysates, even when autoradiography at -80°C was
extended considerably. However, under these conditions
somehybridization could be detectedtothelysate blot ofB.
bronchiseptica.
The nature of the homology between the 1-kbp ClaI fragment and the genomic DNA of the other Bordetella species was determined by Southern transfer of various
restriction digests of DNA (Fig. 2). After prolonged
autora-diography, hybridizationtoone ortwobands in each restric-tiondigest of B. bronchiseptica DNAwas detected butwas notdetected withB. parapertussisDNA. Thestrengthof the hybridization suggeststhatsingle-copy sequences that have
at least partial homology to the repetitive ClaI fragment
found inB. pertussisexist inB. bronchiseptica.
To determine whether the ClaI fragment in pJCP602 is present inall strains ofB. pertussis, the insertwas
hybrid-ized to lysate blots of 100 clinical isolates ofB. pertussis.
Hybridization to all B. pertussis isolates was detected but
wasnotdetected withanyof the controlsamples(DNAfrom
otherbacteriaorhuman DNA) (result notshown).
DNAsequence analysis of repetitiveclones. The insertsof
pJCP601 and pJCP602 were subcloned into pUC18 by
iso-lating the EcoRI-HindIII fragmentandligatingthisfragment
FIG. 2. Southern blot analysis of DNAfrom otherBordetella species. DNA from B.pertussis (A),B. bronchiseptica (B), orB. parapertussis(C)wasdigestedwith BamHI(lanes 1),ClaI (lanes 2), orEcoRI (lanes 3). Southernblots ofelectrophoresed DNAwere
then probed with the insert ofpJCP602. Filter Awas autoradio-graphedfor 4h, while filters B and Cwereautoradiographedfor4 days.
into EcoRI-HindlII-cut pUC18, producing pJCP603 and pJCP604, which had the respective inserts in the reverse
orientation withrespecttotheuniversalsequencing primer. Bidirectional double-stranded DNA sequencing was then conducted with theseplasmidsand, whennecessary,nested deletion derivatives, as templates. The sequence of the
insertofpJCP602 is comparedwith twopreviouslypublished
sequencesfor theB. pertussisrepeated element(14, 17) in Fig. 3. Thesequenceofthe tandemrepeat has beenarranged (i.e., "wrapped around") so that it lines upwith that ofa
nontandemcopyof thesequencepublished byMcLaffertyet
al. (14), and this places the ClaI site at position 620. The
sequenceofthe insert ofpJCP601 wasidentical tothe first
168 bases ofourrepeatingunit butincluded 20
nonhomolo-gous bases at the 5' end, terminating in a Sau3AI site.
Presumably, the insert of pJCP601 wasderivedfromoneof
the nontandem copies of the repeated element, which in-cluded 20 bases offlanking chromosomalDNAendingina
Sau3AI site (the 1,046-bp tandemly repeated element does
nothaveinternal Sau3AI sites thatwouldgeneratea188-bp
fragment). There are 12 base differences (five substitutions
andsevendeletions) betweenoursequencefor the repeated
element and that of McLafferty et al. (14). For all the substitutions and five of the deletions, our dataare consis-tent withthe(incomplete) sequencedata of Parketal. (17). Their sequence, however, included a further five base
dif-ferences(three deletions andtwosubstitutions) withrespect toboth thepresentstudyand that of McLaffertyetal. (14). Thus, it appears that the DNA sequence of the repeated
element ofB. pertussis is not absolutely conserved. The existence of this sequence variation, particularly the
dele-tions, makes it extremely unlikely that the repeatedelement
encodes aprotein product.
Detection ofB.pertussisbyPCRamplificationofpartof the
repeatedelement. Oligonucleotides flankinga153-bpregion
ofthe repeated element (Fig. 3)weresynthesizedand used as primers for PCRamplificationas described in Materials B
1 2
E 1 2
p 12
C 1 2
J.CLIN. MICROBIOL.
Ai"
v VIq7-Ë".
4
-:=
-P.i. iw..:
on April 12, 2020 by guest
http://jcm.asm.org/
PCR DIAGNOSIS OF PERTUSSIS 1985
A
B
A B
A e C
CAGCTGTGAAGATTCAATA GGTTGTATGCATGGTTCATCCGAACCGGATTTGAGAAACTGGAAATCGCC AACCCCCCAG TTCACTCAAGGAGCCCGGCC
150 200
...
... ...GGATGAACACCCATAAGCAT GCCCGATTGA CCTTCCTACGTCGACTCGAAATGGTCCAGCAATTGATCGCCCATCAAGTTTGTGTGCCTGAAGCGGCCCG
250 300
...
... ...
CGCCTATGGGGTCACCGCGCCGACTGTGCÇ CAAATGGCTGGGCCGCTTCCTGGCTCAGGGCCAGGCGGGCTTGGCCGATGCGTCCTCGCGCCCGACGGTC
...
. AG..-..
350 400
A ... G.. CC...c...
B TCGCCCCGAGCGATTGCGCC GGCCAAGGCG CTGGCTATCG TGGAGCTCCG --G-AAGCGGCTGACCCAAGCGCGCAT-GCCCAGGCGCTGGGCGTGTCAG
C ... C
450 500
A ...
B CCAGCACC6TCAGCCGCGTC CTGGCCCGCG CCGGTCTGTC GCACCTGGCCGACCTGGAGC -GGCCGAGCC GGTGGTGCGCTACGAGCATCAGGCCCCCGG
C ... ... ... ...
550 600
A ... 8 CGATCTGCTGCACATCGACA TCAAGAAGCT GGGACGTATCCAGCGCCCTG GCCACCGGGT CACGGGCAAC CGACGCGATA CCGTTGAGGG GGCCGGCTGG C ... ... ... ... ... ...
650 700
A ...
B GACTTCGTCTTCGTGGCCAT_AT6GACCAC GCCCGCGT-GCCTTCACCGA CATCCACCCC GACGAGCGCTTCCCCAGCGCCGTCCAGTTC CTCAAGGACG
C ... G .6. ... ...
Clal
750 800
A ... ... ... ....
B CAGTGGCCTA CTACCAGCGC CTGGGCGTGACCATCCAGCGCTTGCTCACC6ACAATGGCT CGGCCTTTCGCAGCCG-GCC TTCGCCGCGCTGTGCCATGA
C ... ... ... ...
850 900
A ... ... ...r... ...
B GCTGGGCATC AAGCACCGCTTTACCCGACC TTACCGCCCACAGACCA'ATGGCAAGGCCGA ACGCTTCATC CAGTCGGCCTTGCGTGAGTGGGCTTACGCT
C ... ... ... ... ...
950 1000
A ...
B CACACCTACC AGAACTCCCAACACCGAGCC GATGCCATGA AATCCTGGCT ACACCACTAC AACTGGCATCGACCCCACCAAGGCATCG66CGCGCTGTAC
C ... ... ... ... ...
1050 A ...ATC.
B CCATCTCCAGACTCAACCTGGACGAATACA ACCTATTGACAGTTéCACAC
TAG-C ...C
FIG. 3. DNA sequence of theB. pertussis repeated element. The complete DNA sequence shown (B) is that of the insert ofpJCP602,
aligned with data of McLafferty etal. (14) (A) and data of Park etal. (17) (C). Forsequences AandC, a dot indicates base identitywith
sequence
B,
whereas a dash in any of the sequencesindicates a basedeletion. The location of the regionamplified byPCR is indicated by the arrows, which underscorethe position of annealing of the two primer oligonucleotides. The ClaI recognition site at position 620 is underlined.and Methods. In initial experiments, proteinase K-treated suspensions of various bacteria were tested. PCR product was detected by agarose gel electrophoresis and ethidium bromide staining. This isarapid technique which is suitable for analyzing large numbers of samples, and photography under UV illumination provides a permanent record. Fur-thermore, assessment of the size of the PCR product is an added check on specificity. PCR-amplified extracts of B. pertussis showed the presence of an intensely stained DNA band of the expected size (153 bp). A very weak band of approximately the same size was seen in amplified extracts of B. bronchiseptica, but no bands were seen inamplified extracts of B. parapertussis. No DNA bands were detected in the amplified extracts of any of the other bacteriatested earlier by hybridization or with human DNA as the template (results not shown). Thus, the specificity of the PCR ampli-fication when the chosen oligonucleotide primers wereused was the same as that shown for direct hybridization to the insert ofpJCP602.
The sensitivity of the PCR assay for detection of B. pertussis was then examined. A fresh (24-h) culture ofB. pertussis was serially diluted inTrypticase soy broth (BBL Microbiology Systems, Cockeysville, Md.), and
50-ktl
ali-quots were immediately plated on charcoal agarfor deter-mination of the number of viable bacteria. Samples(50,ul) from each dilution were also treated with proteinase K, amplified by PCR, and electrophoresed, as described in Materials and Methods (Fig. 4, lanes1 to 7). A153-bpDNA band was still detectable in the reaction mixturethatinitially contained approximately 3 viable bacteria (lane5) and was faintly discernible in the reaction mixture supposedly con-taining 1/10 of this amount (lane 6). No bandwas seenwhenproteinase K-treated diluentwas
amplified (lane
7)
orwhen further dilutions of the bacterialsuspension
weresimilarly
treated (resultnot
shown).
The PCR assay was then used to detect B.
pertussis
in NPA collected from children withsuspected
pertussis,
asdescribed in Materials and Methods
(Fig. 4,
lanes 8 to12).
The resultsofthePCR assaywerethen
compared
with those obtained by IF or culture. Ingeneral,
aspirates
yielding
amoderate to
heavy
growth
of B.pertussis
werestrongly
positive
by PCR,
whilethoseyielding
scantygrowth
(which
were usually negativeby
IF) resulted in a less intense but neverthelessclearly
positive
PCR result. A subset ofNPA samples (6positive
and 14negative)
wasretestedinanother laboratory with identicalresults,
demonstrating
therepro-ducibility
of the PCR assay.The results obtained for a total of332 NPA are
summa-rized in Table 1. ThePCR test
yielded
positive
results in atotalof98
samples,
compared
with 66 for culture and 33for direct IF. AlloftheIF-positive
samples
were PCRpositive,
as were 63 of thesamples
from which B.pertussis
was eventually cultured. The threeculture-positive,
PCR-nega-tive samples grew fewer than five colonies each. Two hundred thirty-onespecimens
which werenegative by
IF andculture werealsonegative
in thePCR assay.However,
33 culture- and
IF-negative
specimens
werepositive
by
PCRassay;atleast threeofthese
specimens
were collectedfromclose contacts of
culture-proven
pertussis
patients
andtwowere follow-up
specimens
from recentculture-confirmed
patients. Sera were available from 10 of the
remaining
patients, and when these were tested
by
enzyme-linked
immunosorbent assay
(11)
forimmunoglobulin
A(IgA),
IgG,
VOL. 28,1990
on April 12, 2020 by guest
http://jcm.asm.org/
1986 GLARE ET AL.
FIG. 4. PCRamplification ofrepetitiveDNAsequencesfor directdetection ofB.pertussis.SamplesweretreatedwithproteinaseK,PCR
amplified, electrophoresed, and stained with ethidium bromide, as described in thetext. Lanes: 1, amplified purified B.pertussis DNA
(positive control); 2to6,amplifiedB.pertussis cultureextractscontaining(approximately) 3,000, 300, 30, 3,and0.3CFU,respectively,in
the total PCRmix; 7, amplified diluent(negative control); 8 and 9, culture- andIF-negative NPA;10and11,culture- andIF-positiveextracts; 12,culture-positive, IF-negative extract; 13,DNAsize markers(500,404, 331, 242,190, 147,and110bp,respectively,from toptobottom).
and IgM antibodies to B. pertussis, 5 showed serological evidence ofrecent infection(results not shown).
DISCUSSION
ThecompleterepetitiveDNAsequence inB.pertussis has been shown in this study tobe 1,046bp long, with unique ClaIand AccIrestrictionendonucleasesites. Whengenomic DNA was digested with either ClaI or AccI, a prominent 1-kbp repetitive band was easilyobserved in ethidium bro-mide-stainedgels. Hence,many ofthe repeatsarearranged intandem on thechromosome.We haveclonedthecomplete repetitive unitas a ClaI fragment
(pJCP602)
afterisolating therepetitiveDNAbandfromelectrophoresed ClaI-digested
genomicDNA.
Thechromosomalarrangementofthe repeat appearstobe conserved between strains ofB. pertussis. When genomic DNAfromsevenclinical isolatesand threeNational Collec-tion ofTypeCultures strainsofB.pertussis wassubjectedto restriction fragment length polymorphism analysis (result not presented), only minor differences in restriction frag-mentlengthsand bandintensities wereobserved. In partic-ular, all strains had repetitive 1-kbp bands of consistent intensities in ClaIdigests. Thehigh degree of conservation offragments bearingtherepetitivesequenceimpliesthat the repeatis notinvolved in DNArearrangements as has been suggested elsewhere (1, 15).
All isolates of B. pertussis tested in the present study contained therepeated DNAsequence, which (apart from a very weak
hybridization
with B. bronchiseptica) wasabsent from allother species of bacteria tested. B. bronchiseptica,TABLE 1. Detection of B. pertussis in NPA by PCR assay comparedwithcultureand IF'
No. of results
PCR
result IF+, IF-, IF +, IF- Total
culture+ culture+ culture- culture
-+ 31 32 2 33 98
- O 3 0 231 234
aNPA weretreatedwith proteinaseKandamplifiedbyPCR aftersamples
hadbeenwithdrawnforcultureand IFanalysis. The numberofspecimens yielding a positive (+) or negative (-) result for the various assays is
indicated.
however,is a very rare (0.1% ofallisolated bordetellae[10]) and clinically unimportant bacterium in humans (6). This suggested that this sequence would be an ideal target for diagnostic probes for B. pertussis. The limit of detection when the 32P-labeled repeated sequence was used toprobe dot blots of B. pertussis suspensions was approximately 1,000 organisms after overnight autoradiography (resultnot
shown), and this limit is clearly inadequate for clinical testing. However, the use of syntheticoligonucleotide prim-ers for PCR amplification of part of the repeated element, although vastlyincreasing the sensitivity, couldconceivably becomplicated by variations in the precise DNA sequence from one strain of B. pertussis to another. Indeed, we detected a totalof 12 base differences (five substitutions and seven deletions) between the sequence of our clone (pJCP602) and that of McLafferty et al. (14). In the present study, the region of the repeated element from bases 12 to 164(inclusive) was chosen for amplification by PCR because it is a region of absolute sequence identity between the insertsofpJCP601 and pJCP602 and that ofMcLaffertyetal. (14). Furthermore, our Southern blot experiments using the inserts of pJCP601 and pJCP602 as probes indicated that virtuallyallcopies (completeorotherwise) of thereiterated sequences in the B. pertussis genome included thisregion.
Under ourconditions, the PCR assay for direct detection of B.pertussis had an apparent sensitivity limitof less than oneviableorganism (i.e., CFU).Itispossible, however,that the diluted cell suspensions tested included nonviable B. pertussiscells,andthereforeitisuncertainwhetherless than one B. pertussis genome (which would contain approxi-mately 100 copies ofthe target sequence) could have been detected. The theoretical limitofdetectionby PCR assay is onecopy of thetarget sequence, and therefore it should be possible to increase the sensitivityofour assay. This could beachievedbyincreasingthenumber of amplification cycles or by increasing the sensitivity of PCR product detection (comparedwithethidiumbromide staining) by hybridization with a labeledoligonucleotide probe specific for a section of theamplifiedsequence which did not overlap with the primer sequences. It wasdecided, however, that these steps would increasethe time ofthe assay to a point at which a same-day resultwould not beachievable in the clinical setting.
Formalassessmentof thespecificity and sensitivity of new methods for diagnosis of pertussis is complicated by the absence of asatisfactory "gold standard" with which
com-J. CLIN. MICROBIOL.
on April 12, 2020 by guest
http://jcm.asm.org/
parsons can be made. Culture, for example, is highly specific, but its sensitivity is very poor, with positive results obtained in at most 50% ofcases (12). In the present study,
IF,while specific, was even less sensitive than culture.
Also,
serological studies may yield false-negative results early in thecourse of infection and in children under 4 months of age (11). Furthermore, it is not acceptable to use clinical criteria alone as a gold standard, because some pertussis cases presentatypically and the classical pertussis symptoms can also be produced by other infectious agents, such as adeno-virus or Mycoplasma pneumoniae. Consideration should be given to developing gold standard criteria based on an appropriate combinationofthe methods described above as well as otherdiagnostic methods.
Notwithstanding the limitations described above, the PCR assayappeared to perform well in comparison with the other diagnostic techniques currently in use in our clinical labora-tory. Under optimum conditions, the PCR result was avail-able within 5 h ofcollection of the NPA, whereas culture tookatleast 3 or 4 days. The PCR results were negative in only 3 of 66 samples from which B. pertussis was cultured, andthese samples grew fewer than five colonies each. NPA weresubmitted for PCR assay only after samples had been removed for culture and IF analysis. For both these tech-niques, parts ofthe specimen containing mucus were con-sidered more likely to contain the organism and were sam-pledpreferentially. Also, a much larger inoculum was used for culture than for PCR (100 to 200 ,ul for each of three cultureplates,comparedwith20 ,ulfor PCR). Thus, the PCR assays were conducted on much smaller and probably infe-rior-qualitysamples. Giventhe small number of B. pertussis colonieswhich grew from the three aspiratesyielding appar-ently false-negative PCRresults, it seems probable that the samples assayed by PCR did not actually contain any B. pertussis atall. ThePCRassay was positive, however, ina further 35sampleswhichwerenegative by culture;2of these were positive by IF. Classification of the remaining 33 culture- and IF-negative, PCR-positive samples as either true-positiveorfalse-positive isdifficult.For severalofthese specimens, there is strong circumstantial evidence that the PCR result is genuine, as they were collected either from symptomatic family contacts of culture-proven pertussis patients or were follow-up specimens from patients who werepreviously culture positive (and PCR positive)but were culture negative at the time of follow-up sampling. The maximum durationbetweencollection ofthe twospecimens was6weeks. Inaddition, appropriate serumspecimensfor assessment of serological response to B. pertussis by
en-zyme-linked immunosorbent assay wereavailable for 10 of the remaining
PCR-positive,
culture- and IF-negative pa-tients, and five oftheseyielded positive
results. Unfortu-nately, sera werenotavailable fromtheremaining patients.
Thus, PCR
amplification
ofreiterated B.pertussis-specific
DNA sequences has the
potential
to be a rapid, highly sensitive, andspecific
method forlaboratory
diagnosis ofpertussis.
ACKNOWLEDGMENTS
We aregratefulto AndreaMcAdam,Michael Summerford, and AndrewMooreforassistance withthePCR assays,IFanalyses,and
culture analyses, respectively. We also thank John Cox and Anne Berryfor helpful discussions and Peter Griffiths for synthesis of the oligonucleotides.
This work wassupported by a grant from the National Health and Medical ResearchCouncil of Australia.
LITERATURE CITED
1. Alsheikhly, A.-R.,and S. Lôfdahl. 1989. Identification of a DNA fragment in the genome ofBordetella pertussis carrying re-peatedDNAsequences also present in other Bordetella species. Microb.Pathog. 6:193-201.
2. Brown, D. R., and C. D. Parker. 1987.Cloning of the filamen-toushemagglutinin of Bordetella pertussis and its expression in Escherichia coli. Infect. Immun. 55:154-161.
3. Brown, M. C. M., A. Weston, J. R. Saunders, and G. O. Humphreys. 1979.Transformation ofE. coliC600 by plasmid DNA at different phases of growth. FEMS Microbiol. Lett. 5:219-222.
4. Clark-Curtiss, J. E., and M. A. Docherty. 1989. A species-specific repetitive sequence in Mycobacterium lepraeDNA. J. Infect. Dis. 159:7-15.
5. Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabelingDNA restriction endonucleasefragmentsto high specific activity. Anal. Biochem. 132:6-13.
6. Goodnow, R. A. 1980. Biology of Bordetella bronchiseptica. Microbiol. Rev.44:722-738.
7. Higgins, C.F., G. F.-L.Ames, W. M.Barnes, J. M. Clement, and M. Hofnung. 1982. A novel intercistronic regulatory ele-mentofprokaryotic operons. Nature (London)298:760-762. 8. Kleckner, N. 1981. Transposable elements in prokaryotes.
Annu. Rev.Genet. 15:341-404.
9. Kraft, R., J.Tardif,K. S.Krauter, and L. A. Leinwand. 1988. Using miniprepplasmid DNAforsequencing double stranded templateswithSequenase. Biotechniques6:544-546.
10. Lautrop,H. 1960. Laboratorydiagnosis of whooping coughor Bordetella infections. Bull. W.H.0.23:15-35.
11. Lawrence, A. J., and J. C. Paton. 1987. Efficacy of enzyme-linked immunosorbent assayfor rapid diagnosis of Bordetella pertussisinfection. J. Clin. Microbiol. 25:2102-2104.
12. Linneman, C. C. 1978.Host-parasite interactions inpertussis, p. 3-18. In C. R. Manclark and J. C. Hill (ed.), International symposium onpertussis. U.S. Departmentof Health, Educa-tion, and Welfare, Bethesda, Md.
13. Maniatis, T.,E. F. Fritsch,andJ. Sambrook. 1982. Molecular cloning: alaboratory manual. ColdSpring Harbor Laboratory, ColdSpring Harbor,N.Y.
14. McLafferty, M. A., D. R. Harcus, and E. L. Hewlett. 1988. Nucleotide sequence and characterization ofarepetitive DNA elementfrom the genome of Bordetellapertussiswith charac-teristicsofaninsertion sequence. J. Gen. Microbiol. 134:2297-2306.
15. McPheat,W. L.,andT. McNally. 1987. Phase IandphaseIV strains ofBordetella pertussis carryarepeatedDNAsequence notfound in other Bordetella species. FEMS Microbiol. Lett. 41:357-360.
16. McPheat,W.L.,and T.McNally. 1987.Isolation ofarepeated
DNA sequencefrom Bordetella pertussis. J. Gen. Microbiol. 133:323-330.
17. Park,I.,W.Saurin,and A. Ullmann.1988.Ahighlyconserved 530base-pair repeatedDNA sequence specific for Bordetella pertussis. FEMSMicrobiol. Lett. 52:19-24.
18. Southern, E. M. 1975. Detection ofspecific sequences among DNAfragmentsseparated bygelelectrophoresis. J. Mol. Biol. 98:503-517.
19. Yanisch-Perron, C., J. Vieira,andJ. Messing. 1985.
Improved
M13 phage cloning vectors and host strains: nucleotide
se-quences oftheM13mpl8andpUC19vectors.Gene33:103-119.