0095-1137/94/$04.00+0
Identification of Bordetella pertussis Infection by Shared-Primer PCR
ZHONGMINGLI,'*
DEBORAH L. JANSEN,' THERESA M. FINN,' SCOTTA. HALPERIN,2 ALICIA KASINA,STEVEN P. O'CONNOR,3 TATSUOAOYAMA,4 CHARLES R. MANCLARK,' AND MICHAEL J. BRENNAN' Division of Bacterial Prodlucts, Center for Biologics Evalulation and Research, U.S. Food andDrug Administration,
Bethesda, Maryland20892,' Dalholusie University, Halifax, Nova ScotiaB3J3G9, Canada2;Divisionof Bacterial andMycotic Diseases, NationalCenterfor InfectiousDiseases, CentersforDisease Control andPrevention,
Atlanta, Georgia303333; and Kawasaki Municipal Hospital, Kawasaki, Japan4
Received 20 August 1993/Returned for modification 12 October 1993/Accepted 9December 1993
Ashared-primer PCR method for the detection of infection was developed by using primers derived from DNA sequences upstreamof the structural genes for the porin proteins of Bordetella pertussis and Bordetella parapertussis. This method resulted in a 159-bp PCR product specific for B. pertussis and a 121-bp DNA fragmentspecificfor B.parapertussis and allowed for the simultaneous detection of these pathogens. The PCR procedure was shown to be very specific since noPCR product was obtained from 36 non-Bordetella bacterial DNAs. Nasopharyngeal aspirates (NPAs) from children suspected ofhaving pertussis wereevaluatedby the PCR method, culture, and the Chinese hamster ovary (CHO) cell assay, which detects pertussis toxin. B. pertussis was cultured from 119 of 205 NPAs assayed, and the presence ofpertussistoxin was detected in 69 of
the NPAsby theCHO cell assay. When ethidium bromide staining was used to detect PCRproducts,100 NPAs gave positive results by shared-primer PCR; 94 of these NPAs were also positive by culture. The result indicated a sensitivity of 79% for PCR when culture was used as the standard. The sensitivity of PCR was increased to 95% when adigoxigeninimmunoblot system was used. Anadditional 20 NPAs frompatientswith suspectedpertussisthatwereculturenegativealsogavepositiveresultsby PCR. Thespecificand sensitive PCR methoddescribed here should be useful for both the clinical diagnosis ofpertussisand caseidentification in vaccine trials.
The detection of Bordetella pertussis infection in a timely manner by sensitive techniques is very important for the managementofpertussis disease. Also, the specific identifica-tion of pertussis cases in vaccine trials is essential for an accurateassessmentof vaccineefficacy. Current rapid methods ofpertussis diagnosis are relatively insensitiveor nonspecific. At present,bacterialculture is the standardtechnique used for the diagnosis of pertussis. However, the organism is slow growing, and in many clinical situations, such as with the concurrentadministration ofantibiotics,isolationrates arelow (19). Relianceonculture aloneforthediagnosis of pertussisin a placebo-controlled vaccine trial may lead to falsely high estimatesof vaccineefficacy (6). Inaddition, Bordetella parap-ertussis can complicate the diagnosis since it is a human pathogenreportedto cause approximately 5% of documented Bordetella infections (14). AlthoughB. pertussis can routinely be cultured, rapid diagnostic methods with improved sensitiv-itiesand specificities,that are easier to use, and that allow for the simultaneous detection of other pathogenic Bordetella species are needed.
In the present study, a shared-primer PCR method was developed byusingtwoprimers derived from theuniqueDNA sequences upstream of the porin genes of B. pertussis and B. parapertussis and a third primer, which is shared by both species, derived from theDNA sequenceadjacenttotheporin genes. The specificity and sensitivity of this method were comparedwiththoseof culture and theChinese hamsterovary (CHO)cell assaybytesting nasopharyngeal aspirates (NPAs) obtainedfrompatients suspectedofhaving pertussis.A
digoxi-*Corresponding author. Mailingaddress: Laboratory of Pertussis, Division of Bacterial Products, Centcr for Biologics Evaluationand Research,U.S. Food and DrugAdministration, 880() Rockville Pike, Bethesda, MD
2(1892.
Phone: (301) 496-4288. Fax: (301) 402-2776.genin immunoblot system was developed to increase the sensitivity of the PCR.
MATERIALSAND METHODS
Bacterial strains and chromosomal DNA. B. pertlussis To-hama I, Tohama III, 347, 18323, and 10901, B. parapertussis 482, 500, and 23054, and Bordetella bronchiseptica 058, 11OH, and 207 were obtained from the Laboratory of Pertussis Culture Collection, the Center for Biologics Evaluation and Research, U.S. Food and Drug Administration. Bacterial culture and chromosomal DNAextractionwereperformed as described previously (13). Chromosomal DNAs from eight differentBordetellaavium specieswereobtained from Claudia Gentry-Weeks, National Institute of Dental Research, Be-thesda, Md. Chromosomal DNAs from 36 different bacteria representing 18 genera were obtained from the Centers for Disease Control and Prevention, Atlanta, Ga.
Reagentsandsynthetic oligonucleotideprimers.Rcstriction enzymes and T4 DNA ligase were purchased from Bethesda Research Laboratories (Gaithersburg, Md.). Taq DNA poly-merase and the Carry-Over prevention kit were purchased from Perkin-Elmer Cetus (Norwalk, Conn.). Digoxigenin-11-dUTP and a digoxigenin detection kit were obtained from Boehringer Mannheim Biochemicals(Indianapolis, Ind.). The TA cloningvector wasobtained from Invitrogen (San Diego, Calif.).Oligonucleotide primersweresynthesized byLofstrand Laboratories Ltd. (Gaithersburg, Md.). The Sequenase DNA sequencingkit waspurchased from UnitedStatesBiochemicals
(Cleveland, Ohio).
Collection andpreparationofsamples.NPAswereobtained by syringe aspirationwith afine flexiblecatheter from children suspected of having pertussis and from family members of patients diagnosedwithpertussis.Of 239 NPAs, 212specimens
783
on May 15, 2020 by guest
http://jcm.asm.org/
including 7 samples collected from patients without pertussis who were confirmed to have respiratory syncytial virus infec-tions were obtained from the Izaak Walton Killam Children's Hospital, Halifax, Nova Scotia, Canada. Culture and the CHO cell assay were performed at the Izaak Walton Killam Child-ren's Hospital. Another 27 NPAs including 8 sequential sam-ples from two children collected at intervals ofbetween 2 and 5 dayswere from the Kawasaki Municipal Hospital, Kawasaki, Japan. Following aspiration, mucus was expelled and rinsed from thecatheter with 0.8 ml ofphosphate-buffered saline-I % Casamino Acids. Samples of diluted NPAs were plated onto mediafor bacterial culture before storage at - 20°C and were sent tothe Center for Biologics Evaluation and Research, U.S. Food and DrugAdministration, for analysis by PCR.
Bacterial culture. For culture, 50 jil ofdiluted NPAs from each clinical sample was plated onto charcoal blood agar containing cephalexin (40
Kg/ml),
asdescribed by Regan and Lowe (20), and the plate was incubated at 37°C. The plate was examined at 72 h and then daily for 7 days. Suspect colonies were identified by Gram stain morphology, immunofluore-scense, and agglutination by using B. pertussis- and B. parap-ertussis-specific antisera (8).Pairedserology assay. Serum samples taken from patients at their initial visit and during convalescence were used in a paired serology assay. Antibodies were measured by immuno-globulin G (IgG) and IgA enzyme immunoassay (8) by using pertussis toxin and filamentous hemagglutinin as antigens. The criterion for positivity was a fourfold rise in either IgG or IgA antibody titer to either antigen in the convalescent-phase serumsamplecomparedwith that in the initial serum sample. CHO cell assay. The CHO cell assay was performed as described previously (7). CHO cells (3 x 104) and diluted NPAs (50
[l)
were added to each well of a96-well microtiter plate containing 250[l
of medium (Ham's F-12 medium containing10% fetal calf serum) per well. After incubation for 20h inaCO2incubator at 37°C, the cells were examined under amicroscope todetermine the extent of clustering, which is a measure of the presence ofpertussis toxin.PCR amplification of porin genes.Several pairs of synthetic
oligonucleotideprimers derived from the porin gene sequence
of B. pertussis (13) were used for amplification of DNA fragments of theB.pertussis, B. parapertussis,B.bronchiseptica, andB. aviumporin genes. PCRamplification was conducted in a
30-[il
reaction mixture containing 3[l
of template of each chromosomalDNA(3 ,ug/ml),20pmol of each primer, 125p.M(each) dATP, dCTP, dGTP, and dTTP, 2.5 U of Taq poly-merase, and 3 pl of 10x reaction buffer (100 mM Tris [pH 8.4], 500mM KCl, 0.1% Triton X-100, 1.0% gelatin, 15 mM
MgCl2).Thereaction mixturewascoveredwith mineral oil and
was amplified for 30 cycles in a Perkin-Elmer Cetus thermal cycler. Each cycle consisted of 1 min each of denaturation, annealing, and elongation stepsattemperaturesof 94, 50, and 72°C,respectively. Theamplified PCR products were detected after electrophoresis through 2% agarose gels in the presence of0.5
Kig
ofethidium bromide permlforapproximately I h at 10V/cm; thiswasfollowed by photography under UV illumi-nation.Inverse PCR and DNA sequencing. Chromosomal DNAs (0.5
[ig)
ofB.pertussis TohamaI,B.parapertussis 23054, and B. bronchiseptica 058wereeach digested with Sall. The enzyme was inactivated by phenol extraction, and the Sall DNA fragments were self-ligated with T4 DNA ligase in a dilute DNA concentration (1p.g/ml)
that favors the formation of monomeric circles (2). Inverse PCR wasperformed on these circular DNAtemplates fromB.pertussis,B.parapertussis, and B.bronchiseptica by using primers derivedfromtheN-terminalDNA andC-terminal DNA of the B. pertussis porin gene (see Fig.IA). Amplification was performed as described above. For nucleotide sequence analysis, the B. parapertussis inverse PCR product was then inserted into the TA cloning vector. This insert was sequenced with the Sequenase DNA sequencing kit by using the dideoxy chain-termination method, and the se-quence result was confirmed by Lark Sequencing Technology Inc., Houston, Tex.
Shared-primer PCR. A shared-primer PCR protocol was developed by using two primers derived from unique DNA sequences upstream of the porin structural genes of B.pertussis and B.parapertussis. A third primer was derived from the DNA sequence common to both species (see Fig. 2). This PCR method amplifies a 159-bp DNA fragment specific for B. pertussis and a 121-bp DNA fragment unique to B. parapertus-sisand allows for thesimultaneous detection of B. pertussis and B.parapertussis.
For PCR, NPAs were initially prepared by liquefying a
35-p,l
sample with an equal volume of a 1:9 solution of 20% N-acetylcysteine and 0.5 N NaOH (11). The mixture was vortexed for 30 s and was incubated at room temperature for 15 min. The samples were then centrifuged at 14,000 x g for 10min inaMicrofuge, and the pellet was resuspended in 30pl
ofthe PCR mixture.The PCR mixture contained 1 x reaction buffer, the three primers at 20 pmol each (Fig. 2), 2.5 U of Taqpolymerase, 125
jiM dATP, 125 jiM dCTP, and 125 jiM dGTP. To prevent
carryover contamination (16), 0.5 U of uracil N-glycosylase (UNG) was added and 250 jiMdUTP was substituted for 125
FiM
dTTP (UNG and dUTP weresupplied in the Carry-Over prevention kit). Samples were incubated at 37°C for 10 min and thenfor 10 min at 94°C to inactivate the UNG and lyse the bacteria.Two-temperature DNA amplification (3) was used for 40 cycles. Denaturation and annealing were carried out at 94 and 65°C for 30 s each. Elongation occurred during the 1°C/s change in temperature from 65 to 94°C. Positive controls of B. pertussis and B. parapertussis DNAs and a negative control from apool of NPAs from five healthy adults were included in each PCR run. Apositive PCR result was detected by ethidium bromide staining of agarose gels after electrophoresis.
Digoxigenin immunoblot system. In the detection system described here, sample treatment and DNAamplification were completed as described above, except that 1 nmol of
digoxi-genin-11-dUTP was included in the PCR mixture (15). The
digoxigenin-labeled PCR products were first analyzed by ethidium bromide staining after electrophoresis and were then transferred onto nitrocellulose sheets (Schleicher & Schuell, Keene, N.H.) without DNA denaturation. Digoxigenin detec-tion was performed according to the manufacturer's protocol. Briefly, filter membranes containing the immobilized PCR products were first incubated in 10 ml of blocking solution provided by the digoxigenin detection kit at roomtemperature for 30 min. Following a brief wash with 50 mM Tris-buffered saline (TBS; pH 7.5), membranes were incubated for 1 h with a 1:1,000 dilution of alkalinephosphatase-conjugated antibody against digoxigenin in TBS. Membranes were washed three times for 10 min each time with TBS and were thendeveloped in 10 ml ofdeveloping buffer (100 mM Tris [pH 9.5], 100 mM NaCl, 50 mMMgCl2)containing 50 ,ulof Nitro Blue Tetrazo-lium and 37.5
[l
of5-bromo-4-chloro-3-indolylphosphate so-lutions. Color development was terminated after 10 min by a brief washingin TEbuffer and air drying.on May 15, 2020 by guest
http://jcm.asm.org/
B
PrimeF Brgmer
ORFofB.perrussis poringene SaI
723
bp
----
359bp
123 bp _
1 2 3 4
FIG. 1. InversePCR andamplified products.(A)Primers derived fromB. pertussisN-terminaland C-terminalDNAsareindicated witharrows.
TherestrictionenzymeSall site is shown. ORF,openreading frame. (B) Inverse PCR products amplified fromcircularized Sall DNA fragments of B.pertussis,B.parapertussis,and B. bronchiseptica. The positions of the 123-bpDNAladder marker (lane 1), the 359-bp PCRproduct found in B.pertussis Tohama I (lane 2), and the 723-bp PCR productsfound in B.parapertussis 23054 (lane 3) and B. bronchiseptica 058 (lane 4)are
shown.
RESULTS
PCR amplification of porin genes and inverse PCR. The
porin gene of B. pet-tussis has recently been cloned and sequenced (13). When chromosomal DNAs from various strains of B. pertussis, B. parapertussis, and B. bronchiseptica
weredigested with the restrictionenzymeSall and probed with a DNA fragment from the N-terminal portion of the porin gene, a 1.5-kb band from B.pertussis DNA and a 1.7-kb band
fromB.parapertussisorB. bronchiseptica DNAweredetected by Southern blotting (13). Several pairs of primers derived fromtheB.pertussisporingene wereused forPCR withDNA
templates from different Bordetella species. None of these primers amplifiedaPCRproduct from B. avium DNA. Similar
PCR products were obtained from B. parapertussis and B.
bronchiseptica DNAs when theprimersderived from the DNA
sequence within the B. pertussis porin structural gene were
used, but when a pair of primers derived from the region
upstream of the porin gene was used, PCR products were
made only from B. pertussis DNA (data not shown). This
suggests that bothB.parapertussis and B. bronchiseptica have similarporin structuralgenescompared with that of B.
pertus-sis, but that the DNA sequences upstream ofthe porin gene are different. To characterize the upstream DNAsequences,
inverse PCRwasperformed and theamplified PCR products of both B.parapertussis and B.bronchisepticaweredetermined
to be 364 bp longer than the B.pertussis PCR product (Fig.
IB). The inverse PCR product from B. parapertussis was
inserted into the TAcloningvector,andthe DNAupstreamof the B. parapertussis porin gene was sequenced (Fig. 2). The
DNAsequencesof B.pertussisand B.parapertussisare
identi-cal up to nucleotide 210 upstream ofthe start codon of the porin structural gene (Fig. 2; note arrow). At this site, a
1,053-bprepetitive, transposon-like DNAsequence is inserted
intothe B. pertussis chromosomal DNA(13, 18).Three24-mer oligonucleotide primers from this region were designed; P1
(5'-TGCAACATCCTGTCCCCTTAATCC-3') is derived from the DNAsequencewhich isidenticalbetweenB.pertussis and B. parapertussis, P2 (5'-ATGCTTATGGGTGTTCATC CGGCC-3') isspecificfor B.pertussis,and P3(5'-CGTCCAC CAGGGGTGGTAGGAGAT-3') isspecific for B.
parapertus-sis (Fig. 2).
Specificity and sensitivity of shared-primer PCR. By using the three primers mentioned above, shared-primer PCR was
evaluated by amplifying DNAs from Bordetella and
non-Bordetella species. The results showed that a 159-bp PCR
productwasdetectedon2%agarosegelsonlyfrom B.pertussis
DNA (Fig. 3, lanes 2 and 3). A 121-bp PCR product was
detected when DNA from either B.parapertussis(Fig. 3, lanes 2and 4) orB. bronchiseptica (Fig. 3, lane5) wasused as the
PCR template. A doublet (159- and 121-bp fragments) was
obtained when DNAs from both B. pertussis and B.
paraper-tussis were present (Fig. 3, lane 2). No PCR product was
identified on the ethidium bromide-stained agarose gel after amplification of DNA from B. avium (Fig. 3, lane 6). Similar resultswere obtained when DNAs from 12 B. pertussis, 6B. parapertussis, 8 B. bronchiseptica, and 8 B. avium strainswere
tested. In addition, no PCR products were obtained when human genomic DNAorDNAs from 36 non-Bordetellaspecies
representing 17 genera including Streptococcus, Neisseria,
Escherichia, Haemophilus,Mycobacterium, Pseudomonas, Bru-cella, Mycoplasma, Staphylococcus, Salmonella, Candida, Al-caligenes,
Chlamydia,
Proteus, Legionella, Klebsiella, and Moraxella weretested.Thesensitivity of shared-primer PCRwasevaluatedbyusing
purified chromosomal DNA.The results showed that aslittle
as 500 fg of B. pertussis or B. parapertussis DNA allowed
amplification of the expected 159- or 121-bp DNAfragment, respectively. However, by using a digoxigenin immunoblot
system forthe detectionofPCR products, as little as 5 fg of
DNAasstarting materialcould be detected withno apparent
loss ofspecificity (data not shown).
Comparison of culture, CHO cell assay, and PCR. NPAs
were obtained from children suspected ofharboring pertussis
infectionsandfromfamily members of patients diagnosed with pertussis. Of 205 NPAstested,B.pertussiswascultured from
119NPAsamplesby standard techniques (Table 1), butnoB.
parapertussis infectionswere identified.
The presence of pertussis toxin in NPAs, an indication of
pertussisinfection,wasinvestigated bytheCHOcellassay,and 69 positive NPAs were identified when the 205 NPAs were
assayed. The CHO cell assay detected 65 of the 119
culture-positive samples, while 4 culture-negative samplesgave
posi-tiveCHOcellassayresults.Thesefoursampleswere,however,
positive by PCR (Table 1). This indicates that although the CHO cell assay can detect pertussis toxin in some patients
from whom B. pertussis cannotbe cultured, it isunlikely that
A
SalI
1 5KbSal fragmenlt ---.
t
on May 15, 2020 by guest
http://jcm.asm.org/
Sal
I
ATG Sal
ORF of B. Pertussis Porin Gene
P2 P1
Sal I ATG Sal
P3 P1
---o ~-,
ORF of B. parapertussis PorinGene
Primer P2
Pert. ATGCTTATGGGTGTTCATCCGGCCGGGCTCCTTGACTGAACTGGGGGGTCGGCGATTTCCAG
Para. cgggcgggcacgggcacacttggtgaggtcgggcgaatcgtccaccaggggtggtaggagat
Primer P3 V
Pert. TTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAGTTAGCCCG
Para. cggcgcggggcaggcgggcaggagcttgttgcattgcgatgcgccgccctagggttagcccg
Pert. CGCGCGATTCCGGATTAAGGGGACAGGATGTTGCAACTTACCAACAATGGGGCGGG:::::: Para. cgcgcgattccggattaaggggacaggatgttgcaacttaccaacaatggggcggg::::::
Primer P1
Pert. : ::::::::ATG ORF of B.pertussis Porin Gene
Para. :::::::::::::::::atg ORF of B.parapertussis Porin Gene
FIG. 2. Primers used for shared-primer PCR. Regions whereB.pertussis(Pert.)and B. parapertussis(Para.) DNAsequencesdifferareindicated
initalics.The B.pertussis-specific 1,053-bp repetitive DNAsequence insertion site is designated withan arrowhead. The three primers used for shared-primer PCR (P1, P2,andP3)areunderlined witharrows.P1is derived from theDNAsequencewhich is identical betweenB.pertussisand B.parapertussis. ORF,openreading frame.
1 2
3 4 5
6
FIG. 3. Specificityofshared-primer PCR. The 123-bpDNAladder marker(lane 1)andPCRproductsfrom B.pertussis TohamaIandB. parapertussis 23054DNA(lane 2),B.pertussis TohamaIDNA(lane 3), B.parapertussis23054 DNA(lane 4),B.bronchiseptica058 DNA(lane 5),and B.aviumGOBLI24 DNA(lane 6).A159-bpPCRproductwas
amplifiedfrom B.pertussis DNA,a121-bpPCRproductwasamplified
from B.parapertussisorB. bronchiseptica DNA,andnoPCRproduct wasamplifiedfrom B. avium DNA.
thetestwilldetect additional positive NPAs not identified by PCR.
By using the ethidium bromide staining method to detect PCRproducts, 100 positive NPAs among 205 specimens tested wereidentified by shared-primer PCR. Among them, 94 were culture positive, indicatingasensitivity of79%. PCR did not detect 25 of theculture-positive patients (Table 1). However, when themore sensitive digoxigenin immunoblot system was used, 95% of the 119 culture-positive samples were then detectedby PCR(Table1). Seven culture-negativeNPAsfrom
TABLE 1. Detection of B. pertussis in NPAs by PCR and the CHO cell assaycompared with thatby culture
No.ofNPAs PCR"
Culture CHO cell Ethidium Ethidium
result assay bromide bromide
bromiden
stainingorstaining immunoblotting"
+ - + _ +_
+ 65 54 94 25 113 6
- 4 82 6 80 20 66
Anadditional seven NPAs(notshownhere)collected frompatientswithout
pertussisand which wereconfirmedasbeinginfected withrespiratoryviruswere
allnegative byPCR.
* Because of the lackof sample, PCR results were not detectedby both ethidium bromidestainingandimmunoblottingin allcases.
on May 15, 2020 by guest
http://jcm.asm.org/
TABLE! 2. Comparison ofcharacteristics ofPCR-positive, culture-negative patientswithPCR-negative, culture-negativepatients
PCR Culture Corroboratingevidence No. ofpositive
result result forpertussis patients
+ - CHO cellassay 4(20)"
Paired serology 1(6)
Epidemiologiclink" 4(13)
Clinically compatiblec 9(1t)d
No supportiveevidencee 1(16Y
- - CHOcellassay 0(66)
Paired serology 14(38) Epidemiologic link 6(35) Clinically compatible 15(28)C
Nosupportiveevidence 13(29k
aValuesinparenthesesarethe total number ofsamplesexamined.
bDiagnosis was madebyexposurehistorywithout laboratory confirmation. Epidemiologiclink includesfamily member withapositivecultureforB.pertussis
orapatient having priororsubsequent positive culture of NPAs.
cDiagnosismadebythe presence ofclinicallycompatiblesymptomswithout laboratory confirmation. Clinically compatible symptoms include paroxysmal cough, cough with whoop,orcough ending with vomiting.
dp=0.04(chi-square test).
'Nolaboratoryorepidemiologic supporting evidence in which both additional
laboratorytests(CHOand/orserology)andhistorical andepidemiologic infor-mationwereavailable.
fP = 0.008(chi-squaretest).
1 2 3 4 5 6 7 8 9 10 11 12 13
FIG. 4. Use ofthedigoxigenin immunoblotsystemfor the detec-tion of B.pertussisDNA inclinicalsamples. PCR resultsweredetected by ethidium bromidestaining (A) orby the digoxigenin immunoblot
system (B). Lane 1, 123-bpDNAladdermarker; lanes 2 through 11, NPAsfrompatients suspected ofhaving pertussis; lane 12,NPApool
from normaladultsas anegative control; lane 13, 1 pgofB.pertussis DNAas apositive control.
patientswithout pertussis whowere confirmed to have
respi-ratoryvirus infectionswereincluded in thisexperiment,and all
werenegativebyPCR. Examplesof the PCR results obtained
byethidiumbromidestainingand with thedigoxigenin
immu-noblot system are compared in Fig. 4. Ten clinical samples were evaluated; seven were culture positive. Four culture-positive samples were PCR positive (Fig. 4, lanes 5 to 8) by ethidiumbromidestaining. However,allsevenculture-positive
sampleswere identified byPCR whenthedigoxigenin
immu-noblot systemwasused (Fig. 4, lanes4to9 and11).
Twenty PCR-positive samples, including6samplesthatwere
positive by ethidium bromide staining and 14 samples that
were positive by immunoblotting, were detected in those
samples thatwere negative byculture (Table 1). The
charac-teristics ofPCR-positive, culture-negative patients compared with those of PCR-negative, culture-negative patients are
giveninTable 2. Four of thePCR-positive sampleswerealso positive in the CHO cell assay (one was positive by paired
serologyandthepatient presentedwithaclinically compatible
illness), and four had strong epidemiologic links to culture-positive patients, including an individual whose NPA was
previously positiveonculture.An additionaleight individuals
had clinicalsymptoms,including paroxysmal cough, cough with whoop,orcough endingwithvomiting,whichwerecompatible
withpertussis.Onlyonepatient withrespiratory illness hadno
laboratory, clinical, or epidemiologic evidence of pertussis
(Table2). Noclinicalorepidemiologic informationwas
avail-ablefor threepatients.Aclinically compatibleillnesswasless
common in culture-negative, PCR-negative samples (P =
0.04). In addition, more samples from this group ofpatients
hadnolaboratory, clinical,orepidemiologicevidence
support-iveof pertussis(P= 0.008). Inanadditionalstudy,sequential
NPAs taken fromtwoJapanesechildren whoweretreated with antibioticswereevaluatedbytheshared-primerPCR. Atotal of eight samples from the two patientswere obtained. Four sampleswerecollected from eachpatientatintervalsof 2to5 days followingthe initial visit. Whileonlythreespecimensfrom the first and secondsamplingswerepositive byculture for B.
pertussis, all eight NPAs were determined to be positive by PCRbyusingthedigoxigenin immunoblotsystem.Thisresult indicates that PCRmaydetect B.pertussisinpatientswhohave been treated with antibiotics and whose NPAs give negative resultsbyculturetechniques.
DISCUSSION
A rapiddiagnosticmethod for thedetection of B.pertussis will allow for theearlydetection andtreatmentofpatientswith activepertussis. Prompt prophylactic treatment ofhousehold members and other contactswith antibiotics may help
inter-ruptdisease transmission andpreventfurther illness.In addi-tion, aspecificand sensitivediagnosticmethod forpertussis is
essential for theaccurateassessmentof theefficacies of vaccine trials.Atpresent,confirmation bybacterialculture isthemost
specifictestforthediagnosisofpertussis,butit takes
investi-gators or clinicians at least 4 or 5 days to obtain results. Moreover, thesensitivityofthe culture methoddecreases with disease duration and antibiotic treatment. Additional time is alsoneeded for the confirmation of thepresenceof B.pertussis in culturesby usingfluorescent-antibody orbacterial
aggluti-nation assays. The serological response to specific pertussis antigensis usedtoverifyinfection(17),but this method suffers from thelack ofanantibodyresponseduringtheearlycourse
of infection and in children under4months ofage. Itappears
that nosingle testwill beappropriate forthe diagnosis of all suspected casesofpertussis.
In the present study, the specificity and sensitivity of a
A
B
on May 15, 2020 by guest
http://jcm.asm.org/
shared-primer PCR technique were assessed by culture and the CHO cellassay,which measuresthepresence ofpertussis toxin, a protein secreted by viableB. pertussis cells. Ethidium bromide staining of PCR products in agarose gelsyielded 94 PCR-positive samples in the set of 119 samples (79%) from which B. pertussis could be cultured. When the digoxigenin immunoblot system was applied, 95% (113 of 119 samples) of the culture-positive samples were PCR positive. In the digoxi-genin immunoblot system described here, digoxidigoxi-genin-11- digoxigenin-11-dUTP was added to the PCR mixture and the PCR products were detected with conjugated digoxigenin-specific antibody. The digoxigenin immunoblot system increased the sensitivity of PCR for detecting B. pertussis DNA by approximately 100-fold over that by ethidium bromide staining and had no apparent effect on specificity (data not shown).
Anadditional 20 PCR-positive NPAs were detected among culture-negative NPAs. The PCR technique described here appears to be more sensitive than culture for detecting B. pertussis in patients with mild disease or those treated with antibiotics, as indicated by reviewing the clinical histories of thesepatients. PCR may be able to detect B. pertussis DNAin samples from which organisms cannot be cultured, perhaps because of the fastidious nature of the organism, the timing of the specimen collection, or prior antimicrobial use. A paired serologic assay was performed on samples from 79individuals. Samples from 14patients were positive by serologic testing but negative by culture and PCR. The frequency of negative PCR results forpatients with positive serologic results suggests that, like culture,diagnosis by PCR may be most useful early in the course of illness (Table 2).
Detection of B. pertussis DNA in clinical samples by PCR wasimproved in the present studies by combining the anneal-ing andextension steps under stringent temperature conditions (3). By using atwo-temperature (65 and94°C) PCR protocol and modifying the DNA transfer procedure, the PCR immu-noblotting technique was conducted within 8 h and the results were obtained on the same day. Before DNA amplification, clinical samples need to be treated toremove Taqpolymerase inhibitory factors (21) and to release the DNA from cells. Many different approaches can be used to prepare clinical samples for PCR (10). In our hands, treatment of the NPAs frompatients suspected of having pertussis with the mucolytic agent N-acetyl-L-cysteine at high pH (11) facilitated the cen-trifugation of the organisms and eliminated Taq polymerase inhibitory factors. In other studies, samples were treated, before PCR amplification, with proteinase Kat 65°C for 1 h and were heated for 10 min at 100°C in order to release the DNAfromcells (5,9). However, in the present study, incuba-tion of the sample for 10min at94°C was sufficient to release the DNAfrom the bacteria. In addition, the use of PCR for sensitive detection is complicated by the fact that amplified molecules can potentially contaminate subsequent amplifica-tions of the sametarget sequence (12). In thepresent study, dUTPwassubstituted for dTTP in thePCRmixture, resulting in incorporation of dU in place of dT in the amplified PCR products. Since digoxigenin is linked to dUTP, carryover contamination can also be prevented by using UNG in the digoxigenin immunoblot system (16), which can be universally appliedfor thediagnosis of other infectious diseases by PCR. B.parapertussis iscapable of producing mild upper respira-tory tractdisease, and patients with severe cases of infection maypresent with dualinfections with both B. pertussis and B. parapertussis (14). The shared-primer PCR described here is also capable of detecting B.pertussis and B. parapertussis in NPAssimultaneously without adjusting the relative concentra-tions of different primersor staggering the amplifications (1,
4). In our analysis of 27 samples obtained from Japan, one B. parapertussis infection was detected (data not shown) by the shared-primer PCRmethod. B. parapertussis was not found in the 205 NPAs collectedin Canada. Although it is impossible to distinguish B. parapertussis fromB. bronchiseptica on the basis of an evaluation of PCR products on agarose gels, human infection with B. bronchiseptica is very rare and the clinical symptoms of lower respiratory tract infections can be distin-guished from thoseof upper respiratory tract infections caused by B.parapertussis (22). The simultaneous detection of differ-ent Bordetella pathogens in clinical specimens by shared-primer PCR may aid in the epidemiologic analysis of the respiratory illnesses caused by these organisms.
Anumber oflaboratory methodsused to diagnose pertussis were compared in the present study. The CHO cell assay appeared to be very specific, but it was somewhat less sensitive than culture. Negative results may be obtained at the early stages of the disease, when theconcentration of pertussis toxin is too low to bedetected. Bacterial culture has been used as the standard for the diagnosis of pertussis, but many factors may affect the laboratory's ability to culture B. pertussis, particularly the time ofsample collection and the use of antibiotics. The molecular diagnostictechniques described here providerapid, sensitive, and reliable methods for the diagnosis of pertussis and should beconsidered for use in the laboratory diagnosis of pertussis in clinical trials.
ACKNOWLEDGMENTS
We thank Claudia Gentry-Weeks, National Institute of Dental Research, for B. avium DNA, Annette Morris, Dalhousie University, Halifax, Nova Scotia, Canada, for compiling the clinical data on the patients; and Sheldon Morris and Bruce Meade, Center for Biologics Evaluation and Research, U.S. Food and Drug Administration, for helpful comments.
REFERENCES
1. Bej, A. K., M. H.Mahbubani, R. Miller, J. L. DiCesare, L. Haff, and R. M.Atlas. 1990. Multiplex PCRamplification and immobi-lized capture probes for detection of bacterial pathogens and indicators in water. Mol. Cell. Probes 4:353-365.
2. Collins, F. S., and S. M.Weissman. 1984. Directional cloning of DNA fragments at a large distance from an initial probe: a circularization method. Proc. Natl. Acad. Sci. USA81:6812-6816. 3. Dodson, L. A., and J. A. Kant. 1991.Two-temperature PCR and heteroduplex detection: application to rapid cystic fibrosis screen-ing. Mol. Cell. Probes 5:21-25.
4. Frankel, G., J. A. Giron, J. Valmassoi, and G. K. Schoolnik. 1989. Multi-gene amplification: simultaneous detection of three viru-lence genes indiarrhoeal stool. Mol. Microbiol. 3:1729-1734. 5. Glare, E. M., J. C. Paton, R. R.Premier, A. J. Lawrence, and I. T.
Nisbet. 1990.Analysis of a repetitive DNA sequence from
Borde-tellapertussis and its application to the diagnosis of pertussis using
thepolymerase chain reaction. J. Clin. Microbiol. 28:1982-1987. 6. Hallander, H.0., J. Storsaeter, and R. Mollby. 1991. Evaluation of
serology andnasopharyngeal cultures for diagnosis of pertussis in avaccine efficacy trial. J. Infect. Dis.163:1046-1054.
7. Halperin, S. A., R.Bortolussi, A. Kasina, and A. J. Wort. 1990. Use of a Chinese hamster ovary cell cytotoxicity assay for the rapid diagnosis of pertussis. J. Clin. Microbiol. 28:32-38.
8. Halperin, S.A.,R.Bortolussi, and A. J. Wort. 1989. Evaluation of culture, immunofluorescence, and serology for the diagnosis of pertussis. J. Clin. Microbiol. 27:752-757.
9. Houard, S., C. Hackel, A. Herzog, and A. Bollen. 1989. Specific identification of Bordetella pertussis by the polymerase chain reaction. Res. Microbiol. 140:477-487.
10. Kawasaki, E.S. 1990. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White (ed.), PCR protocols: a guide to methods and applications, p. 146. Academic Press, Inc., San Diego, Calif. 11. Kubica, G.P.,W. E. Dye,and M. L. Cohn. 1963. Sputum digestion
on May 15, 2020 by guest
http://jcm.asm.org/
and decontamination with N-acetyl-L-cysteine-sodium hydroxide forculture of mycobacteria. Am. Rev. Respir. Dis.87:775-779. 12. Kwok, S., andR.Higuchi.1989.Avoiding false positives with PCR.
Nature (London) 339:237-238.
13. Li,Z. M.,J.H.Hannah, S. Stibitz, N. Y. Nguyen, C. R. Manclark,
andM. J. Brennan. 1991.Cloning and sequencing of the structural genefor theporin protein of Bordetella pertussis. Mol. Microbiol. 5:1649-1656.
14. Linnemann, C. C.,Jr.,and E. B. Perry. 1977.Bordetella
paraper-tussis. Am. J. Dis. Child. 131:560-563.
15. Lion,T.,and0.A. Haas. 1990.Nonradioactive labeling of probe
with digoxigenin by polymerase chain reaction. Anal. Biochem. 188:335-337.
16. Longo, M. C., M. S. Berninger, and J.L. Hartley. 1990. Use of uracil DNA glycosylase to control carry-over contamination in polymerase chain reactions. Gene 93:125-128.
17. Manclark,C.R., B.D. Meade,and D. G.Burstyn. 1986. Serolog-icalresponsetoBordetella pertussis,p.388-394. In N. R. Rose, H.
Friedman, and J. L. Fahey (ed.), Manual of clinical laboratory immunology, 3rd ed. American Society forMicrobiology, Wash-ington, D.C.
18. McLafferty, M. A., D. R. Harcus, and E. L. Hewlett. 1988. Nucleotide sequence and characterization of a repetitive DNA
element from thegenomeofBordetellapertussiswith characteris-tics ofaninsertionsequence.J.Gen. Microbiol. 134:2297-2306. 19. Onorato,I.M., and S.G. F. Wassilalk 1987. Laboratory diagnosis
ofpertussis: thestateof theart. Pediatr.Infect.Dis. J.6:145-151. 20. Regan, J., and F. Lowe. 1977. Enrichment mediumforthe isolation
ofBordetella. J. Clin. Microbiol. 6:303-309.
21. Walsh,P.S., D. A. Metzger, and R.Higuchi.1991.Chelex100as medium for simple extraction of DNA for PCR-based typing from forensicmaterial.BioTechniques 10:506-513.
22. Woolfrey, B. F., andJ.A. Moody. 1991. Humaninfections associ-ated with Bordetella bronchiseptica. Clin. Microbiol. Rev. 4:243-255.