A variant insulin promoter in
non-insulin-dependent diabetes mellitus.
L Olansky, … , P Zimmet, M A Permutt
J Clin Invest. 1992;89(5):1596-1602. https://doi.org/10.1172/JCI115754.
To test the hypothesis that alterations in regulatory regions of the insulin gene occur in a subset of patients with non-insulin-dependent diabetes mellitus (NIDDM), the promoter region was studied by polymerase chain reaction (PCR) amplification directly from genomic DNA, followed by high-resolution polyacrylamide gel electrophoresis under nondenaturing conditions. By using this method a previously identified HincII polymorphism (GTTGAC to GTTGAG at position-56) in American Blacks was readily detected, indicating that single base changes could be observed. In the course of screening the insulin promoter from 40 American Black subjects with NIDDM, an apparent larger allele was found in two
individuals. Both patients were shown to have in addition to a normal allele, a larger allele containing an 8-bp repeat, TGGTCTAA from positions -322 to -315 of the insulin promoter. To facilitate rapid screening for the 8-bp repeat, a high-resolution agarose gel
electrophoretic analysis was adopted. DNA from American Black NIDDM subjects (n = 100) and nondiabetic subjects (n = 100) was PCR amplified and analyzed. The 8-bp repeat was present in five NIDDM subjects, and one nondiabetic subject. DNA from Mauritius Creoles, also of African ancestry, was analyzed, and the 8-bp repeat was present in 3 of 41 NIDDM subjects, and 0 of 41 nondiabetic subjects. Analysis of glucose metabolism in three
presumed normal sibs of an NIDDM patient with […]
Research Article
Find the latest version:
A
Variant Insulin Promoter in Non-insulin-dependent Diabetes Mellitus
Leann Olansky,* Cris Welling, Stephen Giddings, Stuart Adler, Raymond Bourey, GaryDowse,*Susan Serjeantson,' PaulZimmet,tand M.Alan Permutt
MetabolismDivision, DepartmentofInternalMedicine, Washington University Medical School, St. Louis, Missouri63110;*Department
ofInternal Medicine, Universityof Oklahoma, OklahomaCity, Oklahoma 73190;tDepartmentofInternal Medicine, International
DiabetesInstitute, Caulfield South, Victoria 3162, Australia; andIDepartmentofInternal Medicine, John Curtin School ofMedical
Research, Canberra,AustralianCapitalTerritory 2601, Australia
Abstract
Totest the hypothesis that alterations in regulatory regions of theinsulingene occur in a subsetofpatientswith non-insulin-dependent diabetes mellitus (NIDDM), the promoterregion
wasstudied by polymerase chainreaction (PCR) amplification
directly fromgenomicDNA,followedbyhigh-resolution
poly-acrylamidegelelectrophoresisundernondenaturing conditions.
Byusing thismethod apreviously identified HincII
polymor-phism (GTIGACtoGTTGAGatposition -56)inAmerican
Blacks was readily detected, indicating that single base changes could be observed. In thecourseofscreeningthe insu-lin promoter from40American Blacksubjectswith NIDDM, anapparent larger allele was found intwoindividuals. Both
patientswereshown to have inadditionto anormalallele, a
larger allelecontainingan8-bp repeat,TGGTCTAAfrom po-sitions -322 to -315ofthe insulinpromoter.
Tofacilitate rapid screeningfor the8-bprepeat, a high-re-solution agarose gel electrophoretic analysis was adopted.
DNA fromAmericanBlack NIDDMsubjects (a = 100)and
nondiabetic subjects (a = 100)was PCRamplified and ana-lyzed. The 8-bprepeat was present infiveNIDDMsubjects, and one nondiabetic subject. DNA from Mauritius Creoles,
alsoof Africanancestry,wasanalyzed,andthe8-bprepeatwas
present in 3of41 NIDDMsubjects, and0 of41 nondiabetic
subjects. Analysis of glucose metabolism in three presumed
normal sibs of an NIDDMpatientwithan8-bprepeat revealed thatonesib hadovertdiabetes,andtwosibswereglucose intol-erant, but there was no consistent
segregation
ofthe insulin promoter variant with the diabetesphenotype.Thevariant pro-moterwasnotpresent in 35 Caucasian NIDDMpatientsorin 40 Pima Indians.To test thebiologicalconsequences of the
8-bp
repeatse-quence in the insulin promoter,anormal and variant promoter were subcloned into a luciferase plasmid, and reporter gene
activityassessedbytransienttransfection intomouse
insulin-oma
(ITC1)
and hamster insulinoma(HIT)
cells. The pro-moteractivityof the variant allelewasfoundtobereducedto37.9 ± 10.3% ofthe activityofthenormal promoter in HIT cells(P<0.01,n =4),and 49.1±6.4%infTClcells
(P
<0.01,
n=6).Thesedatathussuggest thatanaturally
occurring
vari-AddressreprintrequeststoDr.Permutt, MetabolismDivision, Wash-ington UniversitySchool ofMedicine,660 SouthEuclidAvenue, Box 8127,St.Louis,MO63110.
Receivedfor publication 8October 1991 andin revisedform 11 December1991.
antoftheinsulinpromoter may contribute to the diabetes phe-notype in 5-6% of Black NIDDM patients. (J. Cli& Invest.
1992. 89:1596-1602.) Key words: human insulin promoter. insulinoma cells * non-insulin-dependent diabetes mellitus
-polymerase chain reaction*reporter gene activity
Introduction
Structuralgenemutationshave been observed in a small num-berof individuals with non-insulin-dependentdiabetes melli-tus
(NIDDM)1
(1). These mutationshave been associated witheither failure ofconversion ofproinsulinto insulin,
orabiologi-cally defective insulin resultinginhyperinsulinemia.Most indi-viduals with NIDDM, however, have insulin resistance and
islet
(3-cell
insulin production is not sufficient to meet en-hanced insulin demand (2). Diminished insulin production would more likelyresultfrom decreased transcription of the gene,perhaps duetovariations intheinsulinpromoterregion,or toalterationsin the genes that regulatetranscriptionof the
insulin gene. These transcriptional mutations, if they exist, would be difficult to detect since human islet tissue is not
readily available for analysis.BecauseDNA is easily obtained
from subjects with NIDDM,a number of studies have used DNApolymorphismsat the insulin locus to evaluate this
possi-bility.
Ahypervariable region ofDNA, composedofvariable num-bersoftandem repeatsresultingin manydifferent sizedalleles, is located 375 base
pairs (bp)
upstream from thetranscrip-tion initiatranscrip-tion site oftheinsulin gene(3). Initialreportsofa
positive association ofalargeclass3allelewithNIDDMwere
notconfirmedin later studiesoflargerracially uniform
popula-tions (see reference4forreview). Linkage analysisinfamilies with maturityonsetdiabetes oftheyoung (5, 6), the autosomal
dominant subtype of NIDDM, and inmore
typical
Northern EuropeanCaucasian (7)andAmericanBlack(8)NIDDM fami-lies,concluded that therewasnolinkage ofthe insulingene and NIDDM, and thatinsulingenedefectsare not amajor factor predisposingto NIDDM.Ifthediseasewerepolygenic,
how-ever, thisinterpretationmaynotbecorrect.Evidence has been presented that NIDDM is a complex metabolic disorder unlikelyto bethe result ofa singlegene
defect (9, 10).Becauseofthelimitationsofrestriction
fragment
lengthpolymorphismRFLPanalysisinpopulationsand link-ageanalysisin families whenconsideringpolygenicand multi-factorialdiseasessuchas NIDDM
(1
1),thecurrentstudywasundertaken to evaluate insulin genesdirectly atthegenomic
1.Abbreviationsusedinthispaper:NIDDM,non-insulin-dependent diabetesmellitus; PCR, polymerase chain reaction; RFLP, restriction
fragment
lengthpolymorphism; SSCP, single-strand conformational polymorphism.J.Clin.Invest.
© The AmericanSocietyfor ClinicalInvestigation,Inc. 0021-9738/92/05/1596/06 $2.00
level. Twonewtechniques made this analysis possible. The first consists of amplification of specific regions of the insulingene
directly from genomic DNA by the polymerase chain reaction
(PCR), followed by separation ofthe amplified alleles by a
highly sensitive electrophoreticmethod(12, 13). This method
involves incorporation oflabeledprimers into the amplified
DNA fragment during PCR, followed by denaturation ofthe two strands, andelectrophoresis onnondenaturing gels. The mobility ofthe fragmentsunder theseconditions is determined by base composition aswell assize(single-strand conforma-tional polymorphism [SSCP]), and under appropriate condi-tionssingle base changescanbe detected.Using thesemethods
wefoundavariant of the human insulinpromoterwhich
ap-pears tohavediminishedpromoteractivity, andmaybe
asso-ciated with NIDDMinBlacks.
Methods
Subjects. AllAmerican Black andCaucasian subjectswererecruited from the Washington University Medical School Clinics or from the Diabetes Registry, andsigned consent wasobtained accordingto a protocol approved by the Human Studies Committee. Pima Indian DNA wasobtained from Drs.Steven LilliojaandClifton Bogardus, NationalInstitutesofHealth, Phoenix, AZ, as partofastudy to evalu-atecandidategenesfor diabetes susceptibility.DNAfrom Mauritius Creoleswasobtained throughthe1987 MauritiusNoncommunicable Disease and Risk Factor Prevalence Survey.Mauritius isanislandin the southwesternIndianOceaneastofMadagar.Creolesare ofAfri-canandMalagasy ancestry withvariousamountsofCaucasianand to a lesserextentIndiangeneticadmixture (14). NIDDM wasdefined as described (14) by thisgroup. AllWashington University patientswith NIDDM wereidentifiedbypersonalhistoryandmedicalrecords, and plasma glucose was measured on the sample obtained for DNA. Con-trolsubjectsweredefinedaspatients>35 yrofage,without a personal orfamily history of diabetes,andconfirmedto have afastingplasma glucose< 15mg/dl,or apostprandialplasma glucose<140 mg/dl. A positive family history fortheAmericanBlacks wasdefinedasdiabetes diagnosed by historyingrandparents,parents,uncles, aunts,sibs,or offspringof theprobands.
PCR
amplification
of genomicDNA. Polymerase chain reactionswerecarried out in
10-g1
volumeswith25 ng of EcoRI-digested geno-mic DNA, 200MMeach dNTP, and 1 U Taq polymerase (Amplitaq, Perkin Elmer/Cetus, Norwalk, CT) under standard buffer conditions (15),withMg2e
optimized to 1.25 mM, with annealing phase 1 min atHVR
cctggggaca
ggggtcctgg
g caggggt ctggg cag cagcgcaaagitgqtctas
Cagcgscgccc tgcagcctcc agctctcctg
gtctaatgtg
gaaagtggcc E64°C, extension1minat72°C,anddenaturation1min at 94°C for 30 cycles inaPerkin-Elmer Thermocycler. The oligonucleotide primers, 20-25-mers chosen tocontain - 50%GCwithGorC on the 3' end,
weresynthesized on an model 380B DNA synthesizer (Applied Biosys-tems, Inc., FosterCity, CA) by theWashington University Protein ChemistryLab, ethanol-precipitated, and used withoutfurther purifica-tion. PrimersusedareindicatedinFig.1.
Electrophoresis.For SSCP, the reverse primer was 5' end-labeled for 45 min at 37°C in a25-Alreactioncontaining 25 pmol primer, T4 polynucleotide kinase buffer, 40
MCi[LY-32PIATP
at 5,000 Ci/mmol (AmershamCorp.,Arlington Heights, IL), and 5 U T4polynucleotide kinasebeforethe PCRreaction.Reactionproducts were then electro-phoresed on 8% or 10% acrylamide 89 mMTris,89 mM borate, 2 mM EDTA,pH8 (TBE) gels at 40 Wfor 5'/2h at room temperature as describedbyOritaet al.(12, 13).Although 10%glycerolwasused in someSSCP gels, itspresencewasnotnecessarytoobserve the variants describedinthisreport.Screening gelswere4%NuSieve (3:1)in TBE buffer, stainedwithethidium bromide.Cloning andsequenceanalysis.The insulin promoter variantswere
subcloned into M13and/orBluescript plasmids bystandard methods (16). Sequencing ofthefragments subclonedin Ml 3wasbythe di-deoxy chain termination method using Sequenase (USP)and
[35S]-dATP(Amersham Corp.)with either the universal M 13primeror syn-theticoligonucleotidesasdescribed bythe manufacturer.Sequencing
directly fromgenomicDNAwas aspreviouslydescribed(17).
Transienttransfections andluciferaseassays.flTC1 (mouse insu-linoma) (18, 19)and HIT(hamsterinsulinoma) (20)cellsweregrown andpassagedin DME with 16.5 mMglucose(5.5mMglucoseDME withglucose addedto 16.5mM)supplementedwith 10% FBS. Cells wereplatedatadensity of2X 106 cells per 100 mMdish2 dbefore transfection. Approximately4hbeforetransfection,cellswererefed. Eachplate receivedaCa-phosphate solutioncontaining 10Mgofan
insulin-luciferase fusionplasmid plus 10Magofsalmon DNA carrier (21).Afteranovernight incubationin 5%C02,cellswereshocked for 2 min with 20%glycerolinDME, washed, andrefed. Cellswere har-vested in 700Mlof50 mM Tris-2(N-morpholino)ethane sulfonicacid (MES)(pH7.8), 1 mM DTT, 1%TritonX-100,48 hrsafterglycerol
shock.Luciferaseactivitywasassayed usingaMonolightmodel 2010 instrument (Analytical Luminescence Laboratory, San Diego, CA),
primed with I mMD-luciferin,andintegrating lightunitsover 10s.
Reactions (300 Ml)contained 50 mM Tris-MES (pH 7.8), 10 mM Mg(OAc)2,2 mMATP,333MLMD-luciferin,
167MgM
DTT,and 0.17% Triton X-100.Results obtainedarepresentedaslight minusbackground±SEM
from multiple identical plates for each ofseveral experiments. Al-though expression levels changed for each experiment, variation
-351
-301
caggtgaggg ctttgctctc ctggagacat ttgcccccag ctgtgagcag -251
ggacaggtct ggccaccggg cccctggtta agactctaat
gacccgctgg
49 F D
tcctgaggaa gaggtgctga
cgaccaacgra
gatcttcccg
cagacccagc Aaccagggaaa tggtccggaa attgcagcct cagcccccag ccatctgccg g acccccccac
cccaggccct
aatgggccag
gcggcaggggttgacaggta
ggggagatgg gctctgagac tataaagcca gcgggggccc agcagccctc
agccctccag gacaggctgc
atcagaagag
gccatcaagc aggtctgttcB
-201
-151 FigureI. Sequenceof thehuman insu-lin gene promoter region including a _101 portion of thehypervariableregion,
composed of 14-15-bp tandem repeats -51 (3),indicated(HVR).ThePCRprimers,
described in Methods, and their orien--1 tationsareindicatedby arrows. The
HincIl RFLP at -56, and the 8-bp re-+50 peat(TGGTCTAA)at-315,arealso
amongidentical plates within anexperimentaveraged < 10% (see Ta-ble II). Because of the inherentreproducibility oftheseresults, the relatively lowsignals,and thepossibility ofinterferencefrom inclusion ofotherplasmids, additional plasmidsbased on another reporter sys-temfor internal standardization of transfectionefficiencywere not in-cluded.
Luciferasereporter plasmids. Luciferase plasmids are derivatives of pSV2A A5'L(22), withtheinsulinpromotersreplacingtheSV40 se-quenceslocated 5' to theluciferasegene.Insulinpromoter sequences arefrom -366to +42and arederived from eitherthenormal allele or theallelecontainingthe8-bprepeat.
Clinical studies. Oral glucose tolerance testswereperformedwith 75 g ofglucose according to a standard protocol. Hyperglycemic clampswere performed to assesstheinsulin response to a constant plasma glucose aspreviously described (23).Plasmaglucose concentra-tion was measuredbyan automatedglucose oxidasemethod(Beckman Instruments, Inc., Fullerton, CA). Serum insulin concentration was measured byradioimmunoassay.
Statistical analysis. All experimental data are expressed as mean±standard errorofmean(SEM). Statistical analyseswere per-formedusing pairedorunpairedtwotailed Student'st tests orx2 analy-sisasappropriate.Probabilityvalues P<0.05wereconsidered
signifi-cant. Calculationswereperformed usingtheCLINFO DataAnalysis
System ofWashingtonUniversity (General ClinicalResearch Center RR00036)supported by theDivision ofResearchoftheNational Insti-tutesofHealth.
Results
Confirmation thatSSCP candetectsingle base changes in the insulin promoter. To confirm that PCR amplification ofthe promoter region of the insulin gene and electrophoresis by SSCP wouldpermit detection ofdifferences, a known poly-morphism wasfirststudied. A HinclI site at positions -61 to -56(GTTGAC) had been shown to be absent in 40%of Ameri-can Blacks(24). We sequenced the promoter region directly fromgenomic DNA of several individuals previously typed at
this locus, anddeterminedthat HincIH minus alleles had the sequenceGTTGAG. PCRamplificationofanumberof unre-lated individual with32P5'-end-labeledprimer 7096(A) at
po-sition-183 andreverseprimer 10594(B)atposition+42, indi-cated inFig. 1, andelectrophoresisunder SSCP conditions
re-sulted inclearly identifiable allelespositiveornegativeforthe
HincIH site (Fig. 2).
Avariantofthe insulin promoter, detectedby screening with
PCR-SSCP. Analysis ofthe insulin promoter from -183 to +42 of20 American Black NIDDM patients (40 alleles) by
PCR-SSCP and by directgenomic sequencingrevealed only theHinclI polymorphismatposition-56. Next the promoter
+/e +14-/-+//- +/+ ±/+
Figure2. A225-bpfragmentof the human insulin promoter(-183to +42) wasPCR-amplified from genomic DNA of a number of indi-viduals with primersA(32Pend-labeled) and B as in Fig. 1, and elec-trophoresed bySSCPasdescribed in Methods."+"referstothe presence of aHincIl site atposition-56(GTTGAC),and"-"tothe absence of the site(GTTGAG).
1 2
....;vA"w1_
4I*
. _.
0
Figure 3. Analysis of the insulin promoter frompositions -365 to -164 by PCR-SSCPfromtwoindividuals,lanes1and 2. Three bands are seenin lane 1. These samethree bands are also seen in lane 2, aswell asthree apparently larger corre-spondingbands.
from -365 to-164 was evaluated by PCR-SSCP with primer
10593 (C) and reverse primer 10595(F), as shown in Fig. 1. The SSCPpattern of a normal individual is seen in Fig. 3, lane 1.
Only one of the primers was labeled, and thus only onemajor
band would bepredicted. The two less intense bands represent minorconformations of this same amplifiedfragment. In the
first analysis of20 individuals, a single variant pattern was
found as showninFig. 3 (lane 2), which suggested thepresence of anormal andalarger allele in one individual. Analysis of
DNA from 20 additional NIDDM patients revealed another person withanapparent larger allele.
Molecular basis for the variant promoter. The molecular
basis for this variant insulin promoter was defined by
subclon-ing the amplified promoter of both individuals in M13 and
determining the sequences. Both patients were heterozygous
for anormal and a larger allele. Examples of the sequences
from one patient are seen in Fig. 4. Initially the sequences,
reading from 5'-3' were identical, until the 8-bp sequence
G
A T
C
G A
T
C
nzS...
G
T
G ~ ;f :.Z.
T A A T
TG
G T
G G
T T
A A
A~~~~~~~~~~~~
T 4UT~
C
TT
I nsert
Norma
I1 2 3 4 5 6 7 8 Figure5.Analysis of the insulinpromoterof eight individuals from positions-340 to-198 by PCRamplification using primersEand D (Fig. 1)fromgenomic DNA, followed by elec-trophoresison a 4% NuSieve (3:1) agarose gel in TBEbuffer,and stained withethidiumbromide. Individualsin lanes1, 2,6, and 7 haveone normal and one larger allele, while those in lanes 3-5 and 8 arehomozygous for normal alleles.
TGGTCTAAwasrepeatedintandeminthelargerallele.This
same8-bprepeat was present in otherpatients,asconfirmedby sequencing a variant allele from another American Black
NIDDMpatient, andaMauritius Creole patientwith NIDDM
(seebelow).
Frequencyof the variant allelein threeracialgroups. To
determinethefrequencyof the variant allele inpopulations,a morerapidanalytical method wasdevised. Knowing that the variantwas an8-bp larger allele,wePCR-amplifiedarelatively
smallfragmentoftheinsulin promoter(142 bp)withprimersE
andD(Fig. 1),andwereabletoseparatelargeandsmallalleles
on a 4%agarose(NuSieve) gelasshown inFig.5.Thissensitive and morerapid screeningmethod enabledustoevaluatethe promoterregion from 100 nondiabetic American Black indi-viduals, andanequal number with NIDDM.Asshown in Ta-bleI, the variantwaspresent in fivepatientswith NIDDM and onenondiabeticsubject (P=0.24).
Next the presence ofvariant alleles was evaluated in 35 Caucasian NIDDM patientsand40 PimaIndians, and none werefound. Mauritius Creoles, like AmericanBlacks, are
Afri-candescendants withpartialEuropean Caucasianadmixture,
and withahigh prevalenceofNIDDM(14). We had the
oppor-tunityto determine thefrequency ofthevariant insulin pro-moterinasmaller numberof MauritiusCreoles, and the
vari-ant wasidentified in threesubjectswith NIDDM, but innone
ofthenondiabetic individuals(Table I,NS).
Clinical evaluationof the
effects
of thevariantinsulinpro-moter. All five ofthe NIDDM patients with variant insulin
promoters wereconsideredfordifferences inclinical character-istics. The numberof subjectswassmall, andnoobvious
differ-enceswereapparentinage, ageofdiagnosisofdiabetes,body
mass index, or insulin requirements. At least three of these
patientshadapositive family history ofNIDDM.Onepatient
(L.M.) hadasister(S.L.) with knowndiabetes,andfour sibsnot
knowntohavediabetes,asshown inthepedigreeinFig.6. The sisterwithNIDDM(S.L.) didnothaveavariant insulin pro-moter,and thus in thisfamilythe insulinpromotervariantwas notnecessaryfor diabetes. We had the opportunityto study
threeofthe reportednondiabetic sibs(W.L., J.L., and L.P.).
The resultsofa3-h oralglucosetolerance testinthe three
reported nondiabetic sibs oftheprobandare showninTableII. Thesister (L.P.), positive for the variantpromoter, wasfound
tohaveovert NIDDM, witha fastingplasma glucose of 302 mg/dl,and a poorinsulinsecretoryresponse.Thetwo brothers, onewithtwonormal alleles(W.L.),and theotherwitha nor-mal andvariant insulinpromoter (J.L.),showed virtually iden-tical glucoseresponses,diagnosedasglucoseintolerant by
crite-Table I.Individuals with Variant Insulin Promoters byDiabetesStatus
Insulin promoter alleles Normal Vanant
American Blacks
Nondiabetic 99 1
NIDDM 95 5
P=0.24, Yates correction Mauritius Creoles
Nondiabetic 41 0
NIDDM 38 3
P=0.239, Yatescorrection
ria of FBS< 140 mg/dl, 30-90 min glucose> 200mg/dl, and 120minglucose> 140mg/dl.Theinsulin secretoryresponse
appeared less in J.L. relativetoW.L.(totalareaunder thecurve
4,268 vs. 8,693
gU
*min/ml), suggestingeitheranislet(-celldefectin J.L., orthat J.L. wasinsulin sensitiverelativetohis
brother.
Islet(-cell functionwasfurther assessedby measuringthe
insulinresponseofthetwobrothersto anidentical intravenous glucosechallenge. Hyperglycemicclampswereperformedfor3
h byinfusingglucosetoraiseandmaintain plasma glucoseat
270 mg/dl (15 mM). The results ofthese studies (Table III)
revealed that J.L.(positive forthe variantpromoter)hada40%
greaterearlyphase (0-10min) insulinresponse,butasimilar late-phase(15-180min)response,andnearly identical insulin concentrationsat180 min(66vs.67
,uU/ml).
JLwasalsoappar-entlymoreinsulin-sensitivethan his brotherasthemean
glu-cosedisposal rate for thenear-steady-state 150-180 min
pe-TableII. Reporter Gene Activity of the Normal and Variant
InsulinPromoters
Transfected
intoHamster (HIT) or Mouse((3TCI)
Insulinoma CellsPromoteractivity
Experiment n Normal Variant % P HITcells
1 6 9,744±632 852±48 8.7 0.0001
2 2 21,683±3565 12,300±379 56.7
3 6 3,544±146 1,642±145 46.3 0.0001 4 3 2,416±52 963±165 39.9 0.0011
X=37.9±10.3
(3TC1
cells1 6 1,305±124 772±78 59.2 0.0044
2 3 2,388±200 592±67 24.8 0.013
3 3 5,081±206 3,334±204 65.6 0.011 4 3 1,029±29 447±25 43.4 0.0001
5 3 574±55 232±30 40.4 0.0056
6 4 783±35 477±35 60.9 0.0018
X=49.1 ±6.4
TableIII.GlucoseMetabolic Studies of Three Previously Reported Nondiabetic MembersoftheL.M.Family (Fig.6). A. Oral glucose tolerancetest:plasma glucose/serum insulin
Time
min
0 30 60 90 120 180 Area
(mg/dl)/1(U/mn) mg.min/dloryU.min/ml
100 174 226 232 170 93 30,900
7.6 20.7 26.7 35.4 29.9 10.8 4,268
87 179 224 220 141 118 29,880
W.L.
(N/N)--<4.0 43.6 64.0 74.3 49.7 33.3 8,693
302 393 470 467 488 385 77,940
L.P. (N/V)
11.1 17.8 20.7 11.6 13.7 13.9 2,703
B. Hyperglycemicglucoseclamp
Plasmaglucose Plasma insulin Glucose
(15-180 min) response disposal rate
Age BMI Mean cv 0-10 min 15-180min (150-180 min)
yr mg/dl % min* sU/ml mg/kg/min
J.L.(N/V) 46 21.1 272 6.3 192 6,321 18.2
W.L.(N/N) 52 25.8 274 7.4
135
7,455
11.4 TheprobandL.M.wasidentifiedbecause shehadavariantinsulinpromoter.Insulinpromoter genotypesofhersibsareindicated: N,normal;V,variant.
riodwas60%greater atsimilarmean seruminsulin
concentra-tions (61 vs. 59,uU/ml).
Promoter activity assay. To determine whether the pres-ence ofthe 8-bp tandem repeat within the promoterregion conferred different transcriptional
activity,
areporter gene as-say wasdeveloped. Both normal andinsert-containing
insulin proinoters (from-366to+42)weresubclonedupstreamofthefirefly-luciferase coding region,and thesefusiongeneplasmids transfected intomouse
(3TC
1)andhamster (HIT) insulinomacells.Transient expression ofthesechimericgenesin both cell
linesrevealed that the variant insulinpromoterhad<50%of
thepromoteractivityof the normal allele(TableII).
Discussion
Direct genomic analysis ofthe insulin gene promoter from
NIDDM patients revealed apreviously undescribed 8-bp re-peat,TGGTCTAA, 315bpupstreamofthestartof
transcrip-tion of thegene.Thisrepresentsthefirstvariant insulin pro-moterdescribed.Thecurrentstudiesdefinedthefrequenciesof
the variant in four racialgroups, and addressed the possible
biologicalandclinicalconsequencesofthevarianton carbohy-dratemetabolism. Thestrategiesused were(a)toexamine clin-ical phenotypes, (b) perform linkage analysis inafamily,along
with metabolic studiesonselected members, (c) compare the
frequencies ofthevariant in populations of NIDDM patients
vs. controls,and (d)assesspromoteractivitybytransient
ex-pressioninculturedinsulinoma cells.
Theclinical consequences of the variant insulin promoter
are notclearfromexamination of thephenotypes.Asonlyone
affected allelewas presentin allsubjectswhere thevariantwas
detected, a modest effect on insulin gene
transcription
mayhave littleeffect, giventhattranscription from the normal
pro-motershould beunaffected. The capacitytoproduce insulin might be altered, however, and manifested perhaps only in obeseindividualswithhigherinsulinrequirements. Therewere no obvious differences in phenotypes of the five American Black NIDDM patients with the variant allele however.
Asoneof thesepatients hadafamilyavailablefor analysis,
wehadtheopportunitytodolinkageanalysis and observethe
possible clinical consequencesofthevariant (Fig. 6). This
fam-ily appearedtohaveothergenesand/or factors predisposingto
NIDDM, in that one sister(S.L.) of the proband (L.W.) had
NIDDM without the variant insulinpromoterallele.A second
sister withavariantpromoter(L.P.)wasfoundontestingtobe
diabetic. Whilethiscomplicatestheanalysis, thissame
prob-lemmaybeencountered inmostfamilies with NIDDM, ifthis
disorder is polygenic. We attemptedto assessinsulin
produc-tion in thetwo brothers, onewith and the other withoutthe
variant promoter, by oral glucose tolerancetestsand hypergly-cemic glucose clamps. During the glucose tolerancetests, both
appearedtobe glucose intolerant by standard criteria.As the
relationship between insulin sensitivityandp3-cell functionis
complex and difficult to interpret, the brotherswere further assessed by hyperglycemic clamps with a fixedglucose
chal-lenge. Although therewereminor differences in early insulin responses, overall theresponses werecomparable. It hasnever
been easy to assess insulin producing capacity in vivo (25). Both brothersarelean, whereasthediabetic sistersareobese. One might speculate that obesity andgenes whichpromote
insulin resistancemaybe necessaryto uncoverdefects in insu-lin production. These hypotheses are difficult to test in hu-mans, but have been addressed in experimental animal models
Ageat 54 time of study
Age atdiagnosis 50
Phenotype gestationa DM age 25 obese at diagnosis
oral agent
Genotype N/V
53 52 49 47 44
obese diet
N/N
lean not
tested
N/N
lean
N/V
44 50
Figure 6.Patient L.M.pedigree.Theproband,L.M.(arrow),wasidentified because she has NIDDM andavariant insulinpromoter inoneallele.
Thephenotypes andgenotypesof heraffected (solid)andunaffected (empty) relativesareindicated.N, normalallele; V,variant allele.
Thevariant insulinpromoterappearedtooccur more fre-quently in apopulation of AmericanBlack NIDDMpatients relativetonondiabetic controls (5% vs. 1%, Table I), but the sample sizewas toosmall to indicate whether this apparent differencewasreal. The variantwasnotpresent in70 Cauca-sian or 80 Pima Indian alleles. We were fortunate to have Mauritius CreoleDNAavailableaspartof anotherstudy,and found that the variant insulin promoter occurredin 3of 41 (7.3%) NIDDM patients. Thus the variantpromoterwasfound only in patients of Africanancestry.Thefrequency of the vari-ant appearedtobemore common inNIDDM subjectswhen both American Blacks and Mauritius Creoleswereconsidered together (5.7%vs.0.7%,P=0.042, Yates correction). Because
of known genetic admixture with Caucasian genes (28), one might predict that the frequency of the variantpromotermay beevengreaterinAfrican Blacks with NIDDM. This hypothe-sis iscurrentlybeing addressed.
Whether the variant insulinpromoteraffects transcription of thegene in vivo wasevaluated by transient expression in cultured insulinoma cells. The results of four independent-transfections in HIT cells and six independent-transfections in
flTC1
cells suggested a significant reduction in promoteractivity of the variant(Table II). Both HIT andOTC
1 cells have been widelyused tostudy expression of insulin genes (29-31), but these cellsareimperfect models of regulated expression, being defec-tiveininsulinresponsestoglucose (18, 20). In this regard, HIT and
OTCI
cellswerecultured in5, 16, and 25mMglucose for48 hafter transfections, and the results with the normal and variantpromotersdidnotdifferfrom those described in Table
II.Nonetheless, the differences observed between the activities
of normaland variantpromotersinbothcelltypesarehighly suggestive, and would encourage more definitive studies in vivo using transgenic technology,aswellasin cultured
insulin-omacells engineeredtorespondmorephysiologicallyto
glu-cosestimulation. In thisrespectthe relationships between the effects of the variant insulinpromoter on insulin production
andglucose-stimulated insulinsecretion in thepatientsmaybe morereadily appreciated.
The human insulinpromoteristranscriptionallyactivein rodent insulinoma cells (29-31) andin transgenic mice (32, 33). An insulin promoter-chloramphenicol acetyltransferase reporter transfection experiment showed that 879 bp of 5'-flanking DNAconferred tissue specific expressionin insulin-omacells, whereas onlysequences upto-258werenecessary
for full promoter activity (31). Sequence specific binding of transcription factorswas recently demonstrated withnuclear extractsfromratinsulinoma cells (29, 30). Gel retardationand methylation-interferenceassaysrevealedspecificbinding with high affinity to two regions of the human insulin promoter (nucleotides -217 to -210, and -84to -77), andto athird region (-320 to -313) with low affinity. The consensus se-quencefor high-affinity bindingwasC(T/C)CTAATG,while the sequence at the low affinity site -320 to -313 is GTCTAATG, differing onlyintheG/Cat-320. Thesequence of the insert variant, TGGTCTAATGGTCTAATG (-330to
-313) containstwoofthelow-affinity transcription factor
bind-ing sites,versus onebinding site in the normal allele. Gel retar-dation assayswith oligonucleotides containing therepeat re-gion showed additional high molecular weight retarded species relativetothat with the normal allele (Andrew Clark and Kevin Docherty, unpublished observations). Whether these differ-encescorrespondtodifferencesintranscription of the insulin geneinvivo, however, hasnotbeen determined.
Previous studies of the insulingeneinpopulations of sub-jects and in families with NIDDM ledto the conclusion that this locus did notcontribute ina majorwayto the inherited risk for NIDDM inanyracialgroup(4, 5, 7, 8).The results of the current studyat least partially explain failureto find an
association of this locus with NIDDM in American Blacks. In the current study screening the promoter region of 100 NIDDMpatients bydirect genomicanalysisrevealedavariant inarelativelysmallnumber(5%)whichmaycontributetothe
obese insulin
diabetes phenotype. This small number of variants wouldnot havebeendetected by traditionalRFLPanalysis. Subsequent to the current analysis,additionalSSCPanalysisof thecoding regions of theinsulin gene from these patients revealed only silent mutationsorvariants within introns(manuscript in
prep-aration).
Theclinical significance of thepresenceofavariantinsulin promoteris that it may serve as a genetic marker for NIDDM in Blacks. The observations of thepresenceofthe variant in1
of 100 nondiabetic American Black individuals, and the ab-senceof the variantin95 of 100NIDDMpatients,areentirely consistent withpredictionsinamultifactorial disease (34). A
single genedefect is neither sufficient, nor necessary forthe occurrence ofthe disease. Itmight be mentionedinthis context that uncommon variations ofpotential butunproven signifi-cance have alsobeen describedinthe insulinreceptor (35)and
muscle/adipose tissue glucose transporter (GLUT-4) (36) genes of NIDDMsubjects. For the insulin gene, the frequency of the variant in Mauritius Creoles and American Blacks suggests there may beanassociation with NIDDM. Thesedata,along with thesuggestion that the variant has diminished promoter
activityin cultured insulinomacells, suggest that the variant insulin promoter increases the risk ofdeveloping NIDDM, per-haps through impaired insulin biosynthesis at the
transcrip-tionallevel. Thishypothesis remainstobe tested.
Acknowledgments
Theauthorswish to thank Drs. KenChiuand JanetMcGill fortheir assistance incollecting AmericanBlackDNA,and Dr.Clifton Bogar-dus(National Institutes of Health, Phoenix, AZ) forDNAfromPima Indians. We also wish to thank Dr. Glenn Wilson(University ofSouth Alabama,Mobile, AL) for,3TCIcells,Dr.LarryMoss(Baylor Univer-sity Medical School, Houston, TX) forHITcells,Andrew Clark and Kevin Docherty (Queen Elizabeth Hospital, Birmingham, England) forperforming gelmobility shiftassays, andJeannieWokurkafor help inpreparingthemanuscript.
This work wassupported byNationalInstitutes of Health grant DK16746 (Dr.Permutt),and VA Research Funds(Dr.Giddings).
References
1.Haneda,M.,K.S.Polonsky,R.M. Bergenstal,etal. 1984.Familial hyper-insulinemiadue to astructurally abnormal insulin: definition ofa newmerging
newclinicalsyndrome.N.Engl.J.Med. 310:1288-1294.
2. Porte,D.,Jr. 1991. Bantinglecture 1990: Beta-cells in type IIdiabetes mellitus.Diabetes. 40:166-180.
3.Bell,G.I.,M. J.Selby,and W. J. Rutter. 1982. Thehighlypolymorphic regionadjacenttothe5'endofthe humaninsulingene. Proc.Nat!. Acad.Sci. USA.78:5759-5763.
4.Permutt, M. A., and S. C.Elbein.1990.Insulingene indiabetes:analysis throughRFLP.Diabetes Care. 13:364-374.
5.Andreone, T.,S. Fajans,P.Rotwein,M.Skolnick,and M. A. Permutt. 1985. Insulin geneanalysisinafamilywithmaturityonsetdiabetes of the young.
Diabetes.34:108-114.
6.Fajans,S. S. 1990.Scopeandheterogeneousnatureof MODY.Diabetes
Care. 13:49-64.
7.Elbein,S.C., L. Corsetti, D. Goldgar, M.Skolnick,and M. A. Permutt. 1988. Insulin genelinkage in familial NIDDM: lack oflinkagein Utah Mormon
pedigrees. Diabetes.37:569-576.
8.Cox,N.J., P. A.Epstein, and R. S. Spielman. 1989. Linkage studies on NIDDMandtheinsulin andinsulin-receptor genes. Diabetes. 38:653-658.
9.O'Rahilly, S.,J. S.Wainscoat,and R.C. Turner. 1988. Type 2
(non-insulin-dependent) diabetes mellitus. Newgeneticsfor old nightmares. Diabetologia. 31:407-414.
10.O'Rahilly,S., R. S. Spivey, R. R. Holmann, Z. Nugent, A. Clark, and R. C. Turner.1987. Type IIdiabetes of early onset: a distinct clinical and genetic syn-drome? Br. Med. J. 294:923-928.
I 1.Permutt, M.A.1991. TheuseofDNApolymorphisms forgenetic analysis
of non-insulin dependent diabetes mellitus.InTheGeneticsofDiabetes Part II. B.D.Tait and L. C.Harrison,editors. BalliereTindall,London.495-526.
12.Orita, M., Y. Suzuki, T. Sekiya, and K. Hayashi. 1989. Rapid and sensi-tivedetection ofpointmutations and DNA polymorphisms using the polymerase chain reaction. Genomics. 5:874-879.
13. Orita, M., H. Iwahana, H. Kanazawa, K. Hayashi, and T. Sekiya. 1989. Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformationpolymorphisms. Proc. NatL. Acad. Sci. USA. 86:2766-2770. 14.Dowse, G. K., H. Gareeboo, P. Z. Zimmet, K. G. M. M. Alberti, J.
Tuomilehto,D.Fareed, L. G. Brossonnette, and C. F. Finch. 1990. High preva-lenceofNIDDMandimpairedglucose tolerancein Indian, Creole, and Chinese Mauritians. Diabetes.39:390-396.
15.Innis,M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White. 1990. PCR
Protocols. AGuideto Methods and Applications. Academic Press, Inc., San Diego, CA.
16.Maniatis,T., E. F. Fritsch, and J. Sambrook. 1989. Molecular Cloning: A Laboratory Manual. 2nd edition. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
17.Matsutani,A., R. Janssen, H. Donis-Keller, and M. A. Permutt. 1992. A
polymorphic (CA)n repeat element maps the human glucokinase GCK
(E.C12.7. 1.2) gene to chromosome 7p. Genomics. 12:319-325.
18.Efrat, S., S. Linde,H.Kofod,D.Spector, M. Delannoy, S. Grant, D. Hanahan, andS.Baekkeskov.1988.Beta-celllines derived from transgenic mice expressingahybrid insulingene-oncogene. Proc.NatL.Acad. Sci.USA.
85:9037-9041.
19.Kazuyuki,K., and E. H.Leiter.1990.Comparison ofcytokine effects on mousepancreatica-cell and(8-cell lines. Viability, secretory function,and MHC
antigen expression. Diabetes. 39:415-425.
20.Santerre,R.F., R. A.Cook,R.M. D.Crisel,J. D.Sharp, R. J.Schmidt,
D.C.Williams,andC.P.Wilson. 1981. Insulinsynthesis in a clonal cell line of
simian virus 40-transformed hamster pancreatic betacells. Proc.Nat!.Acad.Sci.
USA. 78:4339-4343.
21. Chen, C.,and H. Okayama. 1987.High efficiencytransformation of
mammalian cellsbyplasmidDNA.Mol. Cell.Biol.7:2745-2752.
22. DeWet, J. R., K. V., Wood, M. DeLuca, D. R.Helinski,and S.
Subra-mani.1987.Firefly luciferasegene: Structureandexpressioninmammalian cells.
Mol.Cell. Bio.7:725-737.
23.King,D.S.,G. P.Dalsky,W. E.Clutter,D. A.Young, M. A.Staten, P. E.
Cryer, andJ.0. Holloszy. 1988. Effects of lack of exerciseoninsulin secretion
andaction in trainedsubjects.Am.J.Physiol.254:E537-E542.
24.Elbein,S.C.,L.Corsetti,and M. A. Permutt.1985.Newpolymorphisms
attheinsulinlocusincreaseitsusefulnessas ageneticmarker.Diabetes. 34:1139-1144.
25. Permutt,M. A., K.Kakita,P.Malinas, I.Karl, G. C. Bonner-Weier,and
S. J.Giddings.1984.Anin vivoanalysisofpancreatic proteinandinsulin biosyn-thesisina ratmodel fornon-insulin-dependent diabetes.J.Clin.Invest.73:1-7. 26.Leiter,E.H.,M.Prochazka,D. L.Coleman,D. V.Serreze, and L. D. Shultz. 1986.Genetic factorspredisposingtodiabetessusceptibility in mice.In TheImmunology of Diabetes Mellitus.G. D. Mollnar and M. A.Jaworski,
edi-tors.Elsevier,Amsterdam. 29-36.
27.Kaku, K.,M.Province,and M.A.Permutt. 1989.Geneticanalysis of obesity-induced diabetes associated withalimitedcapacitytosynthesize insulin inC57BL/KS mice: evidence for polygeniccontrol.Diabetologia.32:636-643.
28. Adams, J.,and R. H.Ward. 1973.Admixture studiesandthedetection of selection. Science(Wash. DC). 180:1137-1143.
29. Boam,D.S. W.,A.R.Clark,and K.Docherty. 1990. Positive and
nega-tiveregulationofthehumaninsulingenebymultiple trans-actingfactors.J. Biol.
Chem. 265:8285-8296.
30. Boam,D.S.W.,and K.Docherty. 1989.Atissue-specificnuclearfactor bindstomultiplesites in the humaninsulin-geneenhancer.Biochem.J.
264:233-239.
31.Walker,M.D.,T.Edlund,A.M.Boulet,and W. J. Rutter.1983. Cell-spe-cificexpression controlled bythe5'-flanking regionof insulinandchymotrypsin
genes. Nature(Lond.). 306:557-561.
32.Fromont-Racine, M.,D.Bucchini, 0. Madsen,P.Desbois,S.Linde,J. H.
Nielsen,C.Saulnier,M-A.Ripoche,J.Jami,and R. Pictet. 1990. Effect of
5'-flankingsequencedeletionsonexpression ofthe humaninsulingene in trans-genicmice.Mol.Endocrinol.4:669-677.
33.Selden,R.F.,M. J.Skoskiewicz,K. B.Howie,P. S.Russell,and H. M. Goodman. 1986. Regulation ofhumaninsulin geneexpressionintransgenic
mice. Nature(Lond.).321:525-528.
34.Lander,E.S.,and D.Botstein. 1986.Strategies forstudying heterogeneous
genetictraits in humansbyusingalinkagemap of restrictionfragment length polymorphisms.Proc.Natl. Acad.Sci. USA. 83:7353-7357.
35.O'Rahilly,S.,W. H.Choi,P.Patel,R.C. Turner, J. S.Flier,andD. E.
Moller. 1991.Detection of mutations ininsulin-receptorgene in NIDDM
pa-tients by analysis of single-stranded conformation polymorphisms. Diabetes.
40:777-782.
36. Kusari, J.,J. B. Buse, R. R. Henry,andJ.M. Olefsky. 1991. Analysisofthe genesequencesof the insulin receptor in the insulin-sensitiveglucosetransporter
(GLUT-4)inpatientswith common-typenon-insulin-dependentdiabetes