Molecular analyses of EGFR: mutation and amplification detection

(1)

Molecular analyses of EGFR:

mutation and amplification detection

Petra Nederlof,

Moleculaire Pathologie NKI

Amsterdam

(2)

Outline presentation

Molecular assays to detect

• EGFR activating mutations

• KRAS mutations

• EGFR gene amplification

• NKI approach, results, validation

• Technical issues

(3)

(4)

COSMIC database

AA subst.

Complex mutations

In frame deletions EGFR

(5)

Mutation analysis EGFR

• Type of mutations

– Point mutations activating in exons 18-21 – Deletions in exon 19

• methods

– Direct sequencing – fragment analysis – Melting analysis – Real Time PCR

• Assays

– In-house tests – Commercial kits

(6)

Current protocol NKI

KRAS sequencing Codon 12

<=60% tumor cells >=60 tumor cells

Fragment analysis exon 19 Enrichment Exon 21 Sequence analysis Direct sequencing Exon 18,19,20,21 EGFR CISH

(7)

Sensitivity

• Limiting factors material

– Tumor cell percentage

• may be low

– Paraffin material:

• cross-linked and fragmented DNA

– Biopsies / cytological preps

• Limited amount of material

(8)

Direct sequencing

• PCR fragments preferably <250 bp

• Complete sequence readable in two

directions (forward and reverse)

• Compare with wt sequence same run

• Check for SNP’s

(9)

Primer_ID Naam F/R Label Amplificatie Sequentie 5' - 3' 2244 2244-EGFRexon18F F Geen Exon 18 GCT GAG GTG ACC CTT GTC TC

2245 2245-EGFRexon18R R Geen Exon 18 CTC CCC ACC AGA CCA TGA 2231 2231-EGFRex19F F Geen Exon 19 CAT GTG GCA CCA TCT CAC A 2232 2232-EGFRex19R R Geen Exon 19 CAG CTG CCA GAC ATG AGA AA 2229 2229-EGFRexon20F F Geen Exon 20 CAT GCG TCT TCA CCT GGA A 2230 2230-EGFRexon20R R Geen Exon 20 AGC AGG TAC TGG GAG CCA AT 2295 2295-EGFRex21A-F F Geen Exon 21 GAA TTC GGA TGC AGA GCT TC 2296 2296-EGFRexon21A-R R Geen Exon 21 TGC CTC CTT CTG CAT GGT AT 2297 2297-EGFRex21B-F F Geen Exon 21 GAG GAC CGT CGC TTG GTG 2298 2298-EGFRexon21B-R R Geen Exon 21 ATC CTC CCC TGC ATG TGT TA 2237 2237-EGFRex19F-FAM F FAM Exon19 6CATGTGGCACCATCTCACA

2242 2242-EGFRex19R R Geen Exon 19 GTGTCTTCAGCTGCCAGACATGAGAAA

9700 /mpdiag/EGFR 4 min 94 °C 1 cyclus 0.5 min 94 °C 1.00 min 58 °C 1.00 min 72 °C 35 cycli 7 min 72 °C 1 cyclus soak temp 15 °C Size of PCR fragments Exon 18 137 bp Exon 19 230 bp Exon 20 248 bp Exon 21A 220 bp Exon 21B 238 bp

Sequence analysis not with M13-tails, but with same primers as initial PCR Results in cleaner sequences

(10)

(11)

(12)

Exon 19 del18 sequence

Female, 64y, PA diagnosis: NSCLC Paraffin embedded biopsy

(13)

Exon 19 del18 sequence

(14)

Exon 19 del18 sequence

(15)

Exon 19 del15 deletion

15 nucl

Tumor cell percentage 70% KRAS: no mutation

(16)

Cells from pleural fluid

(17)

Point mutation exon 21

Exon 21B F Exon 21A R

(18)

Problems

• Tumor cell percentage <60%

• Complex mutations

– Difficult to determine exact location of

aberration (inframe?)

• Some exons to large for 1 PCR reaction

– Split exon 21 in two fragments with overlap

• Point mutations more difficult to detect

than deletions

• Not always Forward and Reverse good

sequence

(19)

Rare but recurrent problems

extra peaks may obscure mutation Artifact sequencer?

(20)

Rare but recurrent problems

extra peaks may obscure mutation Artifact sequencer?

(21)

Zelden zo slecht! Kan komen door slechte DNA kwaliteit, Meestal niet te verklaren (slechts 1 exon 1 richting slecht)

(22)

What to do in case of low tumor cell %

• 70% no problems

• <60% sometimes difficult

• Sensitivity of direct sequencing enough?

• Alternatives?

– Fragment analysis of exon 19 deletions

– Use restriction sites in wt and mutants

• Is that an option?

(23)

Most common mutations

• In COSMIC database

– N=11266 cases

– 2803 mutated cases

• 1063 p.L858R exon 21 (38%) • 1161 deletions in exon 19 (42%) • Together 80% of mutations

(24)

Fragment analysis

wt wt del 15 del 15 del 18 wt Primers round common

deletions in exon 19 • Size of the deletion

• exact position not known • Sensitive: 20% tumor

cell percentage detectable

WT EGFR Exon 19

MUT EGFR Exon 19 FAM

(25)

exon 21 c.2573 T>G p.L858R

• Restriction site in wt, not in mutant

• Fragment analysis

• Enrichment for mutant

MscI

TGGCCA wt GGGCCA mut

(26)

Enrichment for mutation

exon 21 c.2573 T>G p.L858R

• 1st PCR exon 21

• Cut wt sequence with restriction enzyme MscI mutant is not cut

• 2nd PCR exon 21

• Analyze on agarose gel cut/uncut PCR products • Confirm by sequence analysis both cut and uncut

product

TGGCCA wt GGGCCA mut

(27)

Sensitivity assay

70% cut Un cut 30% 5%

Mix tumor DNA mut (estimated 70% tumor cells) with wt DNA

70%, 60%, 50%, 40%, 30%, 10%, 5%

(28)

PCR RFLP based analysis

EGFR exon 21 L858R

Exon 21 CGG

Sau 96I Sau 96I

FAM

PCR

Digest with SAu96I

or

180 bp (wild type)

91+180 bp (mutant)

H3255 L858R WT sample

(29)

FAM 101 bp (wild type) 92 bp (mutant) 92 101 H1975 T790M 101 WT sample

PCR RFLP based analysis

EGFR exon 20 T790M

(30)

KRAS mutation analysis

• Methods

– Direct sequencing codon 12/13

• Sensitivity

– Tested on tumors with different tumor cell %

– Mutation determined earlier with sensitive

radioactive dot-blot assay

– Sensitivity higher than with EGFR mutations

caused by loss of wt allel in tumor?

(31)

KRAS sensitivity

10% tumor cells 15% tumor cells

20% tumor cells _{50% tumor cells} 60% tumor cells Wt control

(32)

Material NKI 2005-2007

• Total

182 • Biopsy

101 (56%)

• Cytol. Prep

15 (8%)

6 mutations EGFR

• Resection/excision

66 (36%)

• Female 121

(67%)

(33)

NKI 2005-2007

• 166 tumors

• 37 EGFR mutations detected

• 24 female with mutation (24/113 =21%)

• 13 male with mutation (13/53 =25%)

(34)

KRAS and EGFR analyses 2006

• 27 cases KRAS & EGFR mut analyses

• 1 no results

• 3 mutation detected EGFR (11%) no mut KRAS • 23 no mutation EGFR 17 no mut KRAS

6 mut KRAS

Conclusion

6/27 KRAS mutation (22%) all without EGFR mut

KRAS mut en EGFR mut never together

(35)

KRAS en EGFR analyses 2007

• 49 cases KRAS & EGFR mut analyses

• 8 no results

• 7 mutation EGFR (14%) no mut KRAS • 34 no mutation EGFR 24 no mut KRAS

10 mut KRAS

Conclusion

10/49 KRAS mutation (20%) no EGFR mut

(36)

NKI EGFR mutations

EGFR no mut exon 18 exon 19 exon 19 exon 21 exon 20 exon 21 N 2005 60% 6% 17% 0% 3% 14% 35 2006 88% 0% 5% 0% 0% 7% 42 2007 80% 0% 14% 1% 1% 4% 85 totaal 126 2 20 1 2 11 162

2007 KRAS mut KRAS geen MUT N EGFR mut 0% 100% 7 EGFR geen mut 29% 71% 34

(37)

(38)

Real Time PCR assay

• DXS EGFR29 Mutation Test kit

• detects 1% mutant in a background of wt genomic DNA • 19 deletions in exon 19

(39)

Wild Type Mutant

Single Stranded Conformation

Polymorphism (SSCP)

WT

G12C WT G12A

(40)

DHPLC WAVE system

transgenomics

Fragment collection followed by direct sequencing

(41)

summary

• Advantage of sequencing strategy

– All mutations can be detected if tumor cell percentage is adequate

• Advantage of fragment analysis

– Sensitive but: only known mutations and limited by availability of specific enzymes

• Advantage other techniques

– High sensitivity but frequently confirmation by sequencing needed

– Expensive/special equipment required – Kits may be expensive

(42)

CISH for EGFR amplification

• our still limited experience!

• Kit tested:

Zytovision

– Zyto dot SPEC EGFR probe

(43)

Method

1 2 3 4 5 DAB peroxidase

Critical step, needs optimizing

Staining in automatic stainer used for IHC

(44)

Method

• 5μ

paraffin section

• Probe:

Digoxigenylated(Dig)-EGFR

1 2 3 4 5 DAB peroxidase

(45)

(46)

• F:\2008\06-13246 EGFR CISH 20x

ampl contrast.jpg

(47)

(48)

(49)

Pro’s and Con’s

Not yet Normal microscope CISH special microscope easy read-out FISH

misses low amplification low costs 2 € Costs 50 € routine Costly, deterioration of material by decay colorful sensitivity varies easy IHC CON PRO test