Introducing Evolution Natural Selection Combined Lessons.ppt

(1)

Introducing

Evolution & Natural

Selection

(What do you think

you know?)

Australopithecus Homo erectus Homo

(2)

• Evolution is a theory on the origin of life?

– False – It is a theory explaining the origin of species

• _{How old is the human species (Homo sapiens)?}

– ~195,000 years old

• What is the name of the theory that teaches that

humans evolved from monkeys?

– No theory teaches that humans evolved from monkeys. Evolution indicates Humans and modern monkeys share a common ancestor

• _{Are major Catholic & Protestant Churches against}

teaching the theory of evolution.

– No (according to Voices for Evolution)

(3)

Evolution:

Charles Darwin’s Ideas

commons.wikimedia.org/wiki/Image:Charles_Darwin_1881.jpg commons.wikimedia.org/wiki/Image:DNA_double_helix_vertikal.PNG

(4)

What you will learn……….

• _{How did the idea of “evolution” evolve?}

• _{Early ideas of evolution……….}

• Darwin’s voyage on the HMS Beagle

• _{Natural Selection (The mechanism for}

evolution)

(5)

The Advent of Evolutionary Thought:

Geologic Time/Fossils and Strata

William Smith, his geology map & some of his fossil specimens

In the 1800’s geologists like William Smith were mapping the rocks and fossils of Britain. He and others showed that different species existed in the past compared with today.

(6)

Transmutation

en.wikipedia.org/wiki/Image:Giraffe_standing.jpg commons.wikimedia.org/wiki/Image:Jean-baptiste_lamarck2.jpg Jean Baptiste de Lamarck

• Around 1800, scientists began to wonder whether species could

change or transmute.

• Lamarck thought that if an

animal acquired a characteristic during its lifetime, it could pass it onto its offspring.

• Hence giraffes got their long necks through generations of straining to reach high branches.

(7)

Darwin’s Voyage on the

HMS Beagle

Voyage of the Beagle

• From 1831-1836, a young naturalist named Charles Darwin sailed the world on the HMS Beagle.

• He was amazed by the huge diversity of life he observed

• He started to wonder how such diversity might have originated

(8)

Darwin’s Discoveries

• Darwin began as a geologist, and

collected samples of animals and

plants on his voyage.

• _{On one trip into the Brazilian}

rainforest, he collected 68 different

species of beetle, even though he

wasn’t looking for beetles!

• Noticed patterns of diversity

(different plants and animals inhabited similar habitats in different areas)

(9)

On the islands of the Galapagos

Darwin noticed tortoises and birds

differed from island to island

• Each island had its own type of

tortoises and birds that were

(10)

Galapagos

Tortoises

(11)

In 1859- Darwin publishes

On the Origin of Species

describing a mechanism for the diversity of

species known as Natural Selection

(12)

Survival of the Fittest & Natural

Selection

en.wikipedia.org/wiki/Image:Darwin%27s_finches.jpeg

• In his Origin of Species, Darwin

proposed how one species might give rise to another.

•There is a natural and inherent variation among a population of a species

• Food and resources are limited and

competition means that only the fittest

would survive.

• This would lead to the natural selection

of the best adapted individuals and

eventually the evolution of a new

species. Darwin in 1860

Natural Selection explains adaption

(13)

(14)

(15)

(16)

(17)

(18)

(19)

(20)

Speciation

1. Founders arrive – a few individuals

2. Separation of Populations – usually due to geography

3. Changes in the Gene Pool – becoming adapted

4. Reproductive Isolation – they can no longer reproduce

5. Ecological Competition –

compete for resources

6. Continued Evolution –

(21)

The Tree of Life

en.wikipedia.org/wiki/Image:Phylogenetic_tree.svg

• All living things share a common ancestor

• We can draw a Tree of Life to

show how every species is related.

• Evolution is the process by which one species gives rise to another and the Tree of Life grows

(22)

It is a scientific theory that explains actual observations in the natural world

Scientific theories are explanations that are based on lines of evidence, enable valid predictions, and have been tested in many ways.

In contrast, the popular definition of theory— is a “guess” or “hunch.” These conflicting definitions often cause unnecessary confusion about

evolution.

(23)

Summary of Darwin’s Theory

1. Organisms differ; variation is inherited

2. Organisms produce more offspring than

survive

3. Organisms compete for resources

4. Organisms with advantages survive to pass

those advantages to their children

5. Species alive today are descended with

modifications from common ancestors

(24)

Classwork/Homework

• _{Read Section 15.2 (pgs 423-430) in your}

text.

• _{Complete section 2 of your study guide}

on chapter 15.

• Tomorrow we’ll simulate natural

(25)

Tomorrow….The Peppered Moth

Simulation Lab

(26)

Evidence for Evolution

• _{Geographic Distribution of Living}

Species

• _{Age of the Earth & Fossil Record}

• _{Anatomy & Physiology}

• _Embryology

• _Biochemistry

(27)

Evidence: Geography

evolution.berkeley.edu/evosite/lines/IVCexperiments.shtml en.wikipedia.org/wiki/Image:Kangaroo_and_joey03.jpg

Marsupials • Geographic spread of _{organisms also tells of} their past evolution. • Marsupials occur in two populations today in the Americas and Australia.

• This shows the group evolved before the

(28)

Geographic Distribution

(29)

• _{More Evidence for Evolution}

• _{The age of the Earth}

(30)

How old is the universe?

Its been about 14 to 15

billion years since the

Big Bang

(31)

How old is the Earth?

about 4.6 billion years old

How long ago did the earth cool enough for water vapor to condense and form oceans?

about 3.8 - 3.9 billion years ago

(32)

• How long has there been life on the Earth?

– about 3.5 – 3.9 billion years (~ water formed 1st)

• When did the first primates appear on earth?

– ~ 60 - 85 million years ago (fossil & genetic data)

• When did the first hominins develop?

– 5-8 million yrs ago

• _{When did the separation of man and ape from a common}

unnamed ancestor occur?

(33)

Evidence: The Fossil Record

dinosaurs humans bacteria

origins

http://en.wikipedia.org/wiki/Geologic_time_scale

en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png © World Health Org.

complex cells

The fossil record shows a sequence from simple bacteria to more complicated organisms through time and provides the most compelling evidence for evolution.

(34)

Evidence: Transitional fossils

en.wikipedia.org/wiki/Image:Archaeopteryx_lithographica_paris.JPG

Archaeopteryx

• Many fossils show a clear transition from one species, or group, to another.

• Archaeopteryx was found in Germany in 1861. It

share many characteristics with both dinosaurs and

birds.

• It provides good evidence that birds arose from

(35)

Primate Fossils

(36)

• _{More Evidence for Evolution}

• _{Anatomy &}

(37)

Homologous Body Structures

(38)

Evidence: Comparative Anatomy

en.wikipedia.org/wiki/Image:Primatenskelett-drawing.jpg Human and Gorilla

• Similar comparisons can be made based on anatomical evidence. • The skeleton of humans and

gorillas are very similar suggesting they shared a recent common

ancestor, but very different from the more distantly related

woodlouse…

yet all have a common shared characteristic: bilateral symmetry

(39)

Primate Bone structure

(40)

Evidence: Vestigial Structures

en.wikipedia.org/wiki/Image:Illu_vertebral_column.jpg The coccyx is a vestigial tail

• As evolution progresses, some structures get side-lined as they are not longer of use.

•These are known as vestigial structures.

• The coccyx (tail bone) is a much reduced version of an ancestral tail, which was formerly adapted to aid balance and climbing.

• Another vestigial structure in whales are useless leg bones

(41)

• _{More Evidence for Evolution}

• _Embryology

(42)

13. Evidence of

Evolution

Similarities in

Embryology

– In their early

stages of

development, chickens, turtles and rats look

similar, providing evidence that

they shared a common

(43)

Embryology

(44)

More Evidence: Biochemistry

en.wikipedia.org/wiki/Image:ATP-xtal-3D-sticks.png DNA for Information Transfer ATP for Energy Transfer

• The basic similarity of all living things suggests that they evolved from a single common ancestor.

• As we have already seen, all living things pass on information from generation to generation and to build proteins using DNA & RNA.

•_{All living things also use a molecule called}

(45)

DNA as Evidence of Evolution

• _{Studying DNA shows similarities between}

organisms

• The more similar the DNA the more

closely related species are

• _{Example: The DNA of Chimpanzees and}

Humans are ~ 96-98% similar. The DNA

of any two humans is ~99.9% similar

(46)

Similar Genes

HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA

• Evolution suggests we would expect that DNA in closely

related organisms to be more similar to one another than more distantly related organisms.

• Comparison of the human genetic code with that of other

organisms show that chimpanzees are nearly genetically identical (differ by less than 2-4%) whereas the mouse differs by 15%.

(47)

Evolution happens every day:

Antibiotic resistance

http://en.wikipedia.org/wiki/Image:Antibiotic_resistance.svg

en.wikipedia.org/wiki/Image:Staphylococcus_aureus%2C_50%2C000x%2C_USDA%2C_ARS%2C_EMU.jpg Staphylococcus

• We are all familiar with the way that certain

bacteria can become resistant to antibiotics

• This is an example of natural selection

in action. The antibiotic acts as an environmental pressure. It weeds out those bacteria with low resistance and only those with high resistance survive to reproduce.

(48)

A Real Example: Peppered Moth

http://en.wikipedia.org/wiki/Image:Biston.betularia.7200.jpg en.wikipedia.org/wiki/Image:Biston.betularia.f.carbonaria.7209.jpg en.wikipedia.org/wiki/J._B._S._Haldane

• The Peppered Moth is an

example of Natural Selection in

action discovered by Haldane

• During the Industrial Revolution the trees on which the moth

rested became soot-covered.

Haldane and the peppered moth

• This selected against the allele for pale color in the population (which were

poorly camouflaged from predators) and selected for the dark color allele.





(49)

Evolution is a Scientific Theory

– Just like Gravity & Relativity

• _{Evolution is a}

well supported

explanation for

an observable

set of facts

Remember……. A theory in science is a well

tested hypothesis, not just a guess!

(50)

Mechanisms of Evolution

• _{Hardy-Weinberg Principle}

• _{Genetic Drift}

• _{Founder Effect}

• _{Types of selection (stabilizing, directional,}

disruptive)

• Micro vs. Macro Evolution

• Patterns of Evolution(divergent &

convergent evolution)

(51)

The Hardy-Weinberg Theorem

Used to describe a non-evolving population -

mathematically.

In large populations – allele frequencies will remain constant if:

– No mutations occur – Random mating occurs

– No natural selection occurs – No migration occurs

• Deviation from H-W equilibrium usually results in evolution.

• Understanding a non-evolving population, helps us to understand how evolution occurs.

(52)

Assumptions of the

Hardy-Weinberg Theorem

Weinberg Theorem

• _{Large population size: small populations can}

have chance fluctuations in allele frequencies

(

e.g.

, fire, storm).

(53)

• _{Founder Effect:}

a cause

of genetic drift

attributable to

colonization by

a limited

number of

individuals from

a parent

(54)

No migration: immigrants can change the

frequency of an allele by bringing in new

(55)

Genetic Drift

Occurs when there

is a change in

relative frequency

of alleles

(56)

• _{Gene Flow:}

genetic exchange

due to the

migration of fertile

individuals or

gametes between

populations

(reduces

differences

between

(57)

No net mutations: if alleles change from one to

another, this will change the frequency of those

(58)

Random mating: if certain traits are more desirable, then individuals with those traits will be selected and this will not

(59)

No natural selection: if some individuals survive and reproduce at a higher rate than others, then their offspring will carry those genes and the frequency will change for the

(60)

What did you just learn?

1. What five things must occur to maintain

Hardy-Weinberg equilibrium?

– Large population

– No mutations

– No migration

– Random mating

(61)

2. What tends to happens if there is deviation

from H-W equilibrium?

Evolution

3. What is the founder effect?

An increase in the frequency of an allelic

variation in a small population separated

from the main population

4. What do mutations cause?

Variation in phenotypes

5. What is non-random mating?

When there is a preference to mate with

specific phenotypes

(62)

Types of Natural Selection

• _Directional

• _Stabilizing

(63)

Microevolution

The occurrence of small-scale changes in

allele frequencies in a population, over a

few generations, also known as change at

or below the species level.

– Ex. Bacteria developing antibiotic resistance

(64)

Galapagos Finches

(An example of Microevolution &

Adaptive Radiation)

(65)

Macroevolution

• _{Change above the level of species}

• _{Changes resulting in speciation}

(66)

Macroevolution

• Macroevolution: major

patterns and changes

among living

organisms over long

periods of time.

• The evidence comes

from 2 main sources:

fossils and

comparisons between

living organisms.

(67)

Species change over time. New species arise and

some disappear.

(68)

(69)

Types of Evolution:

Divergent Evolution

• Occurs when two or more biological characteristics

have a common evolutionary origin but have diverged

over evolutionary time.

(70)

Divergent

Evolution:

Causes

Macroevolution:

Species alive

today come

from species

that lived in the

past.

(71)

Types of Evolution

• _{Convergent Evolution-the process}

whereby organisms not closely related,

independently evolve similar traits as a

result of having to adapt to similar

(72)

(73)

All organisms on earth are united into a single tree

of life by common descent.

(74)

What did you just learn?

6. What are the three types of natural

selection?

–

Directional

– Stabilizing

(75)

7. What is Microevolution?

Small-scale changes in the occurrence of

phenotypes in a population that result in

change or adaptations at or below the

species level

8. What is Macroevolution?

Changes above the level of species that

results in speciation and the major

(76)

9. What is an example of adaptive radiation?

Galapagos Finches

10. What is divergent evolution?

When species have a common ancestor but

have traits that have diverged over time

(starts with adaptive radiation)

11. What is convergent evolution?

When organisms not closely related

independently evolve similar traits due to

living in similar environments

(77)

Evolution Re-cap

1. Individual organisms differ from each other. Why?

2. Organisms produce more offspring than can survive, and many that survive do not reproduce.

3. Members must compete for resources.

4. Each organism has advantages and disadvantages.

5. Individuals best suited to their environment survive and reproduce most successfully. They pass these traits on to their offspring. (What is this called?)

6. Species change over time. (What type of evolution?) New species arise and some disappear.

7. Species alive today come from species that lived in the past. (What type of evolution is this?)

8. All organisms on earth are united into a single tree of life by common descent. (Macroevolution)