http://dx.doi.org/10.3168/jds.2015-10560
© 2016, THE AUTHORS. Published by FASS and Elsevier Inc. on behalf
of the American Dairy Science Association®. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).
ABSTRACT
Milk protein is an important component of milk and a nutritional source for human consumption. To better understand the molecular events underlying synthesis of milk proteins, the global gene expression patterns in mammary glands of dairy cow with high-quality milk (>3% milk protein; >3.5% milk fat) and low-quality milk (<3% milk protein; <3.5% milk fat) were exam-ined via digital gene expression study. A total of 139 upregulated and 66 downregulated genes were detected in the mammary tissues of lactating cows with high-quality milk compared with the tissues of cows with low-quality milk. A pathway enrichment study of these genes revealed that the top 5 pathways that were differ-entially affected in the tissues of cows with high- versus low-quality milk involved metabolic pathways, cancer, cytokine-cytokine receptor interactions, regulation of the actin cytoskeleton, and insulin signaling. We also found that the G protein-coupled receptor kinase 2 (GRK2) was one of the most highly upregulated genes in lactat-ing mammary tissue with low-quality milk compared with tissue with high-quality milk. The knockdown of GRK2 in cultured bovine mammary epithelial cells en-hanced CSN2 expression and activated signaling mol-ecules related to translation, including protein kinase B, mammalian target of rapamycin, and p70 ribosomal protein S6 kinase 1 (S6K1), whereas overexpression of GRK2 had the opposite effects. However, expression of genes involved in the mitogen-activated protein kinase pathway was positively regulated by GRK2. Therefore, GRK2 seems to act as a negative mediator of milk-protein synthesis via the milk-protein kinase B-mammalian target of rapamycin signaling axis. Furthermore, GRK2 may negatively control milk-protein synthesis by acti-vating the mitogen-activated protein kinase pathway in dairy cow mammary epithelial cells.
Key words: mammary gland, G protein-coupled receptor kinase 2, lactation, proliferation
INTRODUCTION
Milk protein, which is composed primarily of casein and whey protein, is an important nutritional source for human consumption (Haug et al., 2007). Casein ac-counts for ~80% of total milk protein (Cerbulis and Farrell, 1975). The bovine casein consists of approxi-mately 40% αS1-CN, 10% αS2-CN, 37% β-CN, and 13% κ-CN (Stewart et al., 1987).
Milk-protein synthesis is tightly regulated by spe-cific genes (Bionaz and Loor, 2011). High-throughput transcription profiling has been used to evaluate global gene expression in mammary tissues in response to de-velopment and lactation. This information can provide insights into mechanisms contributing to milk synthesis. Microarray analyses used to study biologically relevant patterns of genes expression in mouse mammary gland development and lactation have been reported (Master et al., 2002; Rudolph et al., 2003). Similarly, for bovine mammary tissue, microarray analysis has been used to characterize changes in gene expression that may be re-lated to development (Suchyta et al., 2003), the onset of lactation (Finucane et al., 2008), or milking frequency (Connor et al., 2008). Recently, a digital gene expres-sion (DGE) study was used to profile gene expresexpres-sion changes in the bovine mammary gland before and after parturition (Gao et al., 2013). However, no study has directly compared the changes in gene expression in lactating dairy cow mammary glands associated with different lactation capacities.
Several genes have been identified that are involved in lactation, but the roles of some of these genes have not been characterized. The 7 known G protein-cou-pled receptor kinase isoforms (GRK; Pitcher et al., 1998) are members of the serine or threonine protein kinase family, and these proteins have important and various roles in regulating essential cellular processes (Jiang et al., 2009; Kahsai et al., 2010; Penela et al.,
The effect of G protein-coupled receptor kinase 2 (GRK2) on lactation
and on proliferation of mammary epithelial cells from dairy cows
Xiaoming Hou, Hongliu Hu, Ye Lin, Bo Qu, Xuejun Gao, and Qingzhang Li1 Key Lab of Dairy Science, Ministry of Education, Northeast Agricultural University, Harbin 150030, China
Received October 25, 2015. Accepted March 12, 2016.
2010). Among them, GRK2 is ubiquitously expressed throughout the body (Watari et al., 2014). The first identified function for GRK2 involved desensitization of GRK-receptor signaling by phosphorylating agonist-activated 7-transmembrane receptors (Benovic et al., 1986). Recently, evidence has accumulated document-ing GRK2 interactions with cytosolic proteins involved in signaling pathways, which are relevant to essential cellular processes (e.g., proliferation, migration, traf-ficking, cell cycle, and development; Penela et al., 2010). However, reports are currently not available concerning the roles of GRK2 in normal mammary epithelial cell proliferation and differentiation. The mitogen-activated protein kinase (MAPK)-signaling pathway has been associated with cell proliferation in response to growth factor stimulation in the mouse mammary gland (Fata et al., 2007). In vascular smooth muscle cell prolifera-tion, GRK2 appears to serve as a RhoA-activated scaf-fold protein for the ERK-MAPK cascade (Robinson and Pitcher, 2013). Whether GRK2 affects mammary epithelial cell proliferation by activating MAPK in the dairy cow mammary gland is not clear. Furthermore, the relationship between GRK2 and lactation has not been described.
For our study, lactating mammary glands from dairy cows with high- or low-quality milk were selected for the analysis of global gene expression profiles in dairy cow using the DGE approach. Among the DGE, we found that GRK2 was significantly expressed at a high level in the mammary glands of cows with low-quality milk compared with those of cows with high-quality milk. To address the role of GRK2 in mammary epithe-lial cell growth and lactation in the dairy cow, in vitro experiments with cultured mammary epithelial cells were carried out.
MATERIALS AND METHODS
Animals and Tissue Collection
All experiments involving animals were performed in strict accordance with the guidelines for the care and use of experimental animals at Northeast Agricultural University (Harbin, China).
For DGE profiling, 6 multiparous, lactating Holstein dairy cows were used. The cows were in the third par-ity, in the same lactation stage (90 DIM), and were separated into high-quality (33.9 ± 2.1 kg/d of milk yield; >3% milk protein; >3.5% milk fat) and low-quality (33.7 ± 0.5 kg/d of milk yield; <3% milk pro-tein; <3.5% milk fat) milk groups (3 cows per group) according to their milk protein and fat contents (Table 1). All cows were slaughtered at 90 DIM, and mam-mary parenchyma tissues were excised from the upper
third of the posterior area of one of their udders. These tissue samples were trimmed of connective tissue, cut into small blocks (~200 mg), and frozen in liquid ni-trogen until use for RNA isolation. For the culture of mammary epithelial cells, lactating mammary tissues were collected, rinsed in 0.9% (wt/vol) sterile aqueous saline solution, and brought back to the laboratory im-mediately.
Reagents and Antibodies
A short interfering RNA (siRNA) specific for dairy cow GRK2 and a scrambled siRNA (SCR) were purchased from Shanghai GenePharma Co., Ltd. (China). Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12, 12400–024), fetal bovine serum (FBS, 10082–147), TRIzol Reagent (15596–026), Opti-MEM I Reduced Serum Medium (31985–047), Lipofectamine 2000 Transfection Reagent (11668–019), and Hanks’ balanced salt solution (HBSS, 14175) were purchased from Life Technologies (Carlsbad, CA). PrimeScript RT reagents (RR037A), SYBR Premix Ex Taq (RR420A), EcoRI (1040A), and SalI (1080A) were purchased from TaKaRa Biotechnology Co., Ltd. (Dalian, China). Anti-GRK2 (ab137666), anti-phospho-protein kinase B (PKB, also known as AKT1, ab8932), and anti-phospho-mammalian target of rapamycin (mTOR, Ser2448, ab84400), anti-p70 ribosomal pro-tein S6 kinase 1 (S6K1, ab9366), and anti-phospho-S6K1 (Thr 389, ab126818) were purchased from Abcam (Cambridge, MA). Anti-cytokeratin 18 (sc-31700), AKT1 (sc-1618), mTOR (sc-8319), and anti-β-actin (sc-47778) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-p42/44 MAPK (#4695), anti-phospho-p42/44 MAPK (#9106), and SignalFire ECL reagent (#6683) were purchased from Cell Signaling Technology (Beverly, MA). Normal goat serum (ZLI-9021), normal rabbit serum (ZLI-9025), goat anti-rabbit IgG-horseradish peroxidase (HRP, ZB-2301), goat anti-mouse IgG-HRP (ZB-2305), and rab-bit anti-goat IgG-HRP (ZB-2306) were purchased from ZSGB-BIO (Beijing, China). Nitrocellulose membranes (P-66485) were purchased from Pall Corporation (Port Washington, NY). Insulin, prolactin, hydrocortisone,
Table 1. Components of milk from dairy cows with high or low quality milk
Component
Dairy cows with high-quality milk
Dairy cows with low-quality milk Protein (%) 3.27 ± 0.04 2.89 ± 0.02 Fat (%) 4.17 ± 0.01 3.20 ± 0.06 Lactose (%) 4.84 ± 0.03 4.52 ± 0.09 Dry materials (%) 11.93 ± 0.01 10.89 ± 0.03
and other reagents were purchased from Sigma-Aldrich (St Louis, MO), unless otherwise stated.
RNA Isolation
Total RNA was isolated from mammary tissue using TRIzol reagent as described (Wang et al., 2014a), and RNA quality was assessed according to its UV spectral characteristics (NanoDrop 2000c; Thermo Scientific, Wilmington, DE). As a control, RNA integrity was analyzed by agarose gel electrophoresis. The intensity of the 28S rRNA band was approximately twice that of the 18S rRNA band.
DGE Profiling
BGI Tech (Shenzhen, China) performed the DGE analyses. A false discovery rate of ≤0.001 and an abso-lute value of log2 ratio ≥1 were used as cutoffs to judge the significance of DGE. The functions of the DGE were assigned using the gene ontology (GO) functional enrichment module online (http://amigo.geneontol-ogy.org/cgi-bin/amigo/go.cgi). A corrected P-value of ≤0.05 was selected as the threshold for significant en-richment of the gene sets. Pathway enen-richment analysis for the DGE used the Kyoto Encyclopedia of Genes and Genomes (KEGG) database (http://www.genome. jp/kegg/). Pathways with P ≤ 0.05 were considered strongly enriched in DGE.
Quantitative Real-Time PCR
Selected gene expression data from the DGE study were confirmed by quantitative real-time (q)PCR. Each RNA sample was reverse transcribed with PrimeScript RT reagents to cDNA. Each gene was PCR amplified in a separate reaction, and each reaction was performed
in triplicate using SYBR Premix Ex Taq regents and a 7300 Real-time PCR system (Applied Biosystems, Grand Island, NY; Liu et al., 2015). Primers were designed using Primer Premier 5.0 (Premier Biosoft, Palo Alto, CA) and those used are shown in Table 2. The relative amount of an expressed gene pair was calculated using the comparative cycle threshold (Ct) method (Livak and Schmittgen, 2001). The expression of β-actin was not significantly different between lactat-ing mammary tissues with high- and low-quality milk and, therefore, was selected as the housekeeping gene. Thus, the expression values obtained were normalized against that of β-actin.
Mammary Epithelial Cell Isolation and Culture
Mammary epithelial cells were isolated from lactating mammary tissues with high-quality milk as described in Jedrzejczak and Szatkowska (2014) with minor modi-fications. Briefly, mammary tissues were minced with surgical scissors. Minced samples were washed with HBSS and digested with collagenase III for 2 h at 37°C. Each digest was filtered through a nylon mesh, and the filtrate was centrifuged for 10 min at 150 × g. Each pel-let was washed twice with HBSS, and the isolated cells were cultured in DMEM/F-12 medium supplemented with 10% (vol/vol) FBS, 100 U/mL of penicillin, 100 μg/mL of streptomycin, 5 μg/mL of insulin, 1 μg/mL of prolactin, and 1 μg/mL of hydrocortisone at 37°C in a humidified atmosphere containing 5% CO2. The primary cell cultures were trypsinized at ~80% conflu-ency with 0.25% (wt/vol) trypsin and 0.02% (wt/vol) EDTA and passaged to remove fibroblasts. Immunoflu-orescence was used to detect cytokeratin18 expression in the cultured cells to confirm that the isolated cells were purified mammary epithelial cells [Supplemental Figure S1 (http://dx.doi.org/10.3168/jds.2015-10560); Wang et al., 2014a].
Table 2. Primer sequences used for quantitative real-time PCR
Gene
GenBank accession
number Primer sequence (5c to 3c)
Product size (bp) GRK2 NM_174710.2 Forward: GAGGACACAAAAGGAATCAA Reverse: CGGTCCGTCTCAGCATTG 135 CSN2 NM_181008.2 Forward: AACAGCCTCCCACAAAAC Reverse: AGCCATAGCCTCCTTCAC 108
AKT1 NM_173986.2 Forward: TAAAGAAGGAGGTCATCGTGG Reverse: CGGGACAGGTGGAAGAAAA
181
STAT5A NM_001012673.1 Forward: GTCCCTTCCCGTGGTTGT
Reverse: CGGCCTTGAATTTCATGTTG
167
ELF5 NM_001024569.1 Forward: GCTGATTCCAGTTGCTTGA Reverse: AACCACCCGAAAAATACCTT
180 β-Actin NM_173979.3 Forward: AAGGACCTCTACGCCAACACG
Reverse: TTTGCGGTGGACGATGGAG
Plasmid Construction
Full-length GRK2 was PCR amplified from mamma-ry tissue cDNA and inserted into the EcoRI/SalI sites of the vector pGCMV-IRES-EGFP (Tiandz, Beijing, China). The forward primer was 5c-AAGATGGCG-GACCTGGA-3c, and the reverse primer was 5c-TTG-GCGGGAAAACAAATAATA-3c. Plasmid integrity was verified by DNA sequencing.
Transfection
Transient transfection was performed using Lipo-fectamine 2000 (Wang et al., 2014a). Briefly, mam-mary epithelial cells were plated into the wells of 6-well culture plates at 106 cells/well. When the cells reached 80% confluency, transfection was performed. For GRK2 knockdown, cells were transfected with GRK2 siRNA or with SCR as the negative control. For GRK2 overexpression, cells were transfected with the GRK2-containing pGCMV-IRES-EGFP-GRK2 plasmid or a pGCMV-IRES-EGFP empty plasmid as the negative control (Supplemental Figure S2; http:// dx.doi.org/10.3168/jds.2015-10560). The transfection efficiency was assessed by specific mRNA and protein levels in cell lysates isolated 24 h post-transfection. After 24 h of transfection, cells in triplicate wells were harvested for Western blotting.
Western Blotting
Abundance of proteins involved in cell proliferation (MAPK, phospho-MAPK, and cyclin D1) and milk-protein synthesis (β-CN, AKT1, phospho-AKT1, mTOR, phospho-mTOR, S6K1, and phospho-S6K1) were assessed by Western blotting as described (Wang et al., 2014b). Briefly, cells were lysed in ice-cold RIPA buffer [25 mM Tris-HCl (pH 7.6), 150 mM NaCl, 1% vol/vol NP-40, 1% wt/vol sodium deoxycholate, 0.1% wt/vol SDS]. Proteins were separated via SDS-PAGE (10% wt/vol acrylamide gel), and then transferred to a nitrocellulose membranes that was then blocked for 1 h at 37°C in 5% (wt/vol) BSA in Tris-buffered saline containing 0.1% (vol/vol) Tween 20 (TBST). Membranes were incubated overnight at 4°C with an antibody against GRK2 (1:500 dilution), MAPK (1:1,000 dilution), phospho-MAPK (1:2,000 dilution), cyclin D1 (1:1,000 dilution), β-CN (1:1,000 dilution), AKT1 (1:200 dilution), phospho-AKT1 (1:200 dilu-tion), mTOR (1:200 diludilu-tion), phospho-mTOR (1:400 dilution), S6K1 (1:250 dilution), or phospho-S6K1 (1:1,000 dilution). After washing 3 times with TBST, each membrane was incubated for 1 h at 37°C with HRP-conjugated goat anti-rabbit IgG (1:500 dilution),
goat mouse IgG (1:500 dilution), or rabbit anti-goat IgG (1:500 dilution). Each membrane was washed 3 times with TBST, and antibody-bound proteins were detected using the ECL detection reagent.
Statistics
Data from at least 3 independent experiments were subjected to statistical analysis and plotted using Prism 6.0 (Graph Pad Software, La Jolla, CA). Results are presented as the mean ± SEM. To analyze the effect of GRK2 on expression of β-CN and of the signaling molecules involved in milk-protein synthesis and cell proliferation, the 2-tailed unpaired t-test was used to compare means between the GRK2 knockdown or overexpression group and the control group. Statistical significance was set at P < 0.05.
RESULTS
Identification of DGE in the Lactating Mammary Glands of Dairy Cow
The DGE analysis showed that 205 genes were sig-nificantly differentially expressed in the lactating mam-mary tissues of cows with high-quality milk compared with the tissues of cows with low-quality milk. Among them, 139 genes were upregulated, and 66 genes were downregulated (Supplemental Table S1; http://dx.doi. org/10.3168/jds.2015-10560).
To understand their functions, all 205 DGE were mapped to GO database terms and their numbers com-pared with terms for the whole genome background. Figure 1A shows the top 10 GO terms in the molecular function, cellular component, and biological process categories. The majority of these DGE are associated with cellular processes in the biological process ontol-ogy category, with cell and cell part in the cellular com-ponent ontology category, and with binding activities in the molecular function ontology category. Pathway enrichment analysis revealed that the top 5 pathways associated with the DGE involved metabolic pathways, cancer, cytokine-cytokine receptor interactions, regu-lation of the actin cytoskeleton, and insulin signaling (Figure 1B).
Validation of the DGE Using qPCR
To confirm the DGE results, 5 genes which correlated with lactation (Sigl et al., 2014) were selected for qPCR analysis. Among these genes, the expression of CSN2, AKT1, the gene encoding signal transducer and activa-tors of transcription 5 (STAT5), and the gene encoding E74-like factor 5 (ELF5, an enhancer of STAT
signal-ing) was upregulated in the lactating mammary tissues of cows with high-quality milk compared with the tis-sues of cows with low-quality milk. The expression of GRK2 was significantly lowered in the tissues of cows with high-quality milk than in those with low-quality milk (Figure 1C). The qPCR results were consistent with the DGE analysis, indicating that the DGE profil-ing was valid.
GRK2 Negatively Regulates Lactation in Mammary Epithelial Cells of Dairy Cows
To analyze the potential effect of GRK2 on lacta-tion, we performed RNA interference experiments in cultured mammary epithelial cells. Our results showed that compared with control, GRK2 siRNA significantly decreased the mRNA expression and protein abundance of GRK2 24 h after transfection (P < 0.01, Figure 2). The knockdown of GRK2 in the mammary epithelial cells resulted in higher expression of β-CN (P < 0.05, Figures 2B and C).
The effect of overexpression of GRK2 on β-CN in mammary epithelial cells following transient transfec-tion with pGCMV-IRES-EGFP-GRK2 was investi-gated. Mammary epithelial cells transiently transfected with empty pGCMV-IRES-EGFP vector were used as the negative control. Compared with the pGCMV-IRES-EGFP-transfected cells, levels of both GRK2
Figure 1. Differentially expressed genes (DEG) in the lactating mammary tissues of dairy cows with high or low-quality milk. (A) Categories of DEG based on their assigned gene ontology functions. (B) The Kyoto Encyclopedia of Genes and Genomes database path-way classification of identified genes. (C) Relative mRNA levels of G protein-coupled receptor kinase 2 (GRK2), β-casein, protein kinase B (PKB, also known as AKT1), signal transducer and activators of tran-scription 5 (STAT5), and the gene encoding E74-like factor 5 (ELF5) in lactating dairy cows with high- versus low-quality milk. The RNA was extracted from lactating mammary tissues, and mRNA levels were measured by quantitative real-time PCR and normalized to the level of β-actin mRNA. Data are reported as the mean of 3 independent experiments and the uncertainty as the SEM; *P < 0.05, **P < 0.01. Color version available online.
Figure 2. Effect of G protein-coupled receptor kinase 2 (GRK2) knockdown on β-casein synthesis. (A) Relative mRNA levels of GRK2 in GRK2-knockdown mammary epithelial cells. The RNA was extract-ed from mammary epithelial cells that had been transiently transfec-tion with a GRK2-specific siRNA (RNAi) or SCR (Con). The mRNA levels were measured by quantitative real-time PCR and normalized to the level of β-actin mRNA. (B) The Western blots show the levels of GRK2 and β-casein in the GRK2-knockdown and SCR-transfected mammary epithelial cells. Lysates from the cells were probed with antibodies against GRK2, β-casein, and β-actin. β-Actin levels were used as the loading control. These are representative samples for show-ing results of Western blot analysis. (C) Quantification of GRK2 and β-casein levels in the Western blots shown in panel B. Data are re-ported as the mean of 3 independent experiments and the uncertainty as the SEM; *P < 0.05, **P < 0.01.
mRNA and protein significantly increased 24 h after pGCMV-IRES-EGFP-GRK2 transfection (P < 0.01; Figure 3). As expected, transient transfection with pGCMV-IRES-EGFP-GRK2 resulted in a lower ex-pression of β-CN (P < 0.05, Figures 3B, and C).
To explore the signaling pathway by which GRK2 negatively regulates β-CN expression, the abundance of AKT1, mTOR, and S6K1 proteins and their phos-phorylated forms, which mediate milk-protein synthesis (Bionaz and Loor, 2011), was examined by Western blotting. The levels of AKT1, phospho-mTOR, and phospho-S6K1 in GRK2-knockdown cells were significantly increased (P < 0.01; Figures 4A and B). In contrast, overexpression of GRK2 in the cells significantly decreased AKT1, phospho-AKT1, mTOR, phospho-mTOR, S6K1, and phospho-S6K1 levels (P < 0.05; P < 0.01; Figures 4C and D). Overall, these results suggested that GRK2 negatively regulates β-CN synthesis via the AKT1-mTOR signaling axis.
GRK2 Affects the Proliferation of Mammary Epithelial Cells of Dairy Cows
To investigate if GRK2 affects mammary epithelial cell proliferation, the protein abundance levels of sig-naling molecules involved in proliferation were analyzed
in cells transfected with GRK2 siRNA by Western blot-ting. The knockdown of GRK2 significantly decreased MAPK, phospho-MAPK, and cyclin D1 abundance in the cells (P < 0.01; P < 0.05; Figures 5A and B). In contrast, the overexpression of GRK2 correlated with increased of MAPK, phospho-MAPK, and cyclin D1 (P < 0.01; P < 0.05; Figure 5C and D). Taken together, these results suggest that GRK2 participates in the regulation of cell proliferation in the mammary gland of the dairy cow.
DISCUSSION
To better understand the relationship between gene expression in the lactating mammary glands of dairy cows and their production of high- or low-quality milk,
Figure 3. Effect of G protein-coupled receptor kinase 2 (GRK2) overexpression on β-casein synthesis. (A) Relative GRK2 mRNA levels in mammary epithelial cells overexpression GRK2. The RNA was extracted from control (Con) and cells overexpressing GRK2 (Overexpression). The mRNA levels were measured by quantitative PCR and normalized to that of β-actin mRNA. (B) Western blots showing the levels of GRK2 and β-casein in mammary epithelial cells overexpressing GRK2. Lysates from the control and cells overexpress-ing GRK2 were separated by SDS-PAGE and probed with antibodies against GRK2, β-casein, and β-actin. The β-actin levels were used as the loading control. These are representative samples for showing results of Western blot analysis. (C) Quantification of the GRK2 and β-casein levels in the Western blots shown in Figure 4B. In the control group, cells were transfected with pGCMV-IRES-EGFP. In the over-expression group, cells were transfected with pGCMV-IRES-EGFP-GRK2. Quantitative data are reported as the mean of 3 independent experiments and the uncertainty as SEM; *P < 0.05, **P < 0.01.
Figure 4. G protein-coupled receptor kinase 2 (GRK2) negatively regulates β-casein synthesis via activation of protein kinase B (PKB, also known as AKT1), mammalian target of rapamycin (mTOR), and p70 ribosomal protein S6 kinase 1 (S6K1). (A) Western blots showing the levels of signaling proteins involved in translation in the GRK2-knockdown (RNAi) and control (Con) mammary epithelial cells. (B) Quantification of the protein abundance levels in the Western blots shown in Figure 4A. (C) Western blots showing the levels of signaling proteins involved in translation in mammary epithelial cells overexpressing GRK2 (Overexpression) and control cells (Con). (D) Quantification of the protein abundance levels in the Western blots shown in Figure 4C. For A and C, these are representative samples for showing results of Western blot analysis. For B and D, quantitative data are reported as the mean of 3 independent experiments and the uncertainty as SEM; *P < 0.05, **P < 0.01.
we profiled the DGE in the glands of Holstein cows. A total of 205 differentially expressed genes, which included 139 upregulated and 66 downregulated genes, were identified. Pathway enrichment analysis suggested that metabolic pathways and cytokine-cytokine recep-tor interactions are affected by lactation capacity, in-dicating that cytokines play a role in the regulation of milk-protein synthesis. The insulin-signaling pathway appeared also to be involved in lactation capacity, which is consistent with the finding that insulin is essential for the expression of genes involved in milk-protein expres-sion and stimulates milk-protein synthesis in bovine mammary epithelial cells (Menzies et al., 2009).
Our DGE study suggests that the lactation capac-ity of dairy cows can be affected by GRK2 expression, which negatively correlates with β-CN expression in the lactating mammary glands of dairy cow. This reveals a previously unrecognized role of GRK2. We also showed that GRK2 knockdown enhances β-CN ex-pression in mammary epithelial cells which correlated with increased amount of phospho-AKT1. In lactating
mice, AKT1 is required for the synthesis of sufficient quantities of milk to support their offspring (Boxer et al., 2006). Transgenic expression of the AKT1 in mouse mammary gland enhances β-CN expression and results in more differentiated cells surviving in the tissue dur-ing lactation at a time when other receptor tyrosine kinases are nearly absent (Schwertfeger et al., 2001). In a mouse myeloid progenitor cell line, mTOR was found to be phosphorylated in vitro and in vivo by AKT1 (Sekuliü et al., 2000). In the present study, activation of AKT1 probably increased the expression of mTOR and its active form, phospho-mTOR, in the dairy cow cells. Numerous components involved in protein synthesis are regulated by mTOR, including initiation and elonga-tion factors and the ribosomes biogenesis (Wang and Proud, 2006). Research in ruminants has highlighted a role for mTOR in regulating milk-protein synthesis (Prizant and Barash, 2008). For the core proteins in-volved in mTOR signaling, the expression of FRAP1 (the gene encoding mTOR) was found to be signifi-cantly increased during lactation, and the expression pattern of FRAP1 was very similar to that of milk-protein expression (Bionaz and Loor, 2011). Ribosomal protein S6 kinase 1 is a known target of mTOR (Toerien et al., 2010) and its activation has been shown to be dependent on AKT1 and mTOR in mouse HC11 cells (Galbaugh et al., 2006). In the present study, activated mTOR probably phosphorylated S6K1, which in turn probably phosphorylates the ribosomal protein S6 and several other proteins to accelerate mRNA translation. Overall, our results reveal that GRK2 negatively regu-lates β-CN expression via the AKT1-mTOR-signaling pathway in mammary glands of dairy cows.
Our results also showed that GRK2 could activate the MAPK pathway and cyclin D1 expression in the mammary epithelial cells. The MAPK-signaling path-way activation is a common feature of many GRK2-receptor substrates (Lappano and Maggiolini, 2011). The MAPK-signaling pathway is also associated with cell proliferation in response to growth-factor stimula-tion in the mammary gland (Fata et al., 2007). Cyclin D1 is a central cell-cycle regulator (Arnold and Papa-nikolaou, 2005), the inactivation of which leads to an impaired mammary gland development in female mice (Sicinski et al., 1995). In the current study, we showed that GRK2 probably induces MAPK and cyclin D1 expression, suggesting a role for GRK2 on mammary epithelial cell proliferation.
During the lactation period, the increase in milk yield until it peaks has been correlated with an increase in cellular synthetic capacity rather than increased cell proliferation (Capuco et al., 2001). In the present study, we showed that GRK2 expression is lower in the lactating mammary glands of cows with high-quality
Figure 5. G protein-coupled receptor kinase 2 (GRK2) mediates mammary epithelial cell proliferation by regulating mitogen-activated protein kinase (MAPK) and cyclin D1 expression. These are repre-sentative samples for showing results of Western blot analysis. (A) Western blots showing the levels of MAPK, phosphorylated MAPK (pMAPK), and cyclin D1 in GRK2-knockdown (RNAi) and con-trol (Con) mammary epithelial cells. (B) Quantification of the pro-tein abundance levels in the Western blots shown in Figure 5A. (C) Western blots showing the levels of MAPK, pMAPK, and cyclin D1 in mammary epithelial cells overexpressing GRK2 (Overexpression) and control (Con). (D) Quantification of the protein abundance levels in the Western blots shown in Figure 5C. For A and C, these are repre-sentative samples for showing results of Western blot analysis. For B and D, quantitative data are reported as the mean of 3 independent experiments and the uncertainty as the SEM; *P < 0.05, **P < 0.01.
milk, suggesting that GRK2 upregulates milk-protein synthesis rather than cell proliferation. In mouse HC11 cells, inhibition of MAPK signaling seems to increase STAT5 expression, indicating enhanced mammary epi-thelial cell differentiation and milk synthesis (Faulds et al., 2004). Our in vitro experiments also demonstrated that GRK2 knockdown decreased the expression and activity of MAPK in mammary epithelial cells of dairy cows, whereas it increased milk-protein synthesis. Con-versely, members of epidermal growth factor family, such as the Neu differentiation factor and epidermal growth factor, have been reported to inhibit mammary epithelial cell differentiation, concomitant with stimula-tion of the Ras/Mek/Erk pathway in HC11 cells (Marte et al., 1995; Merlo et al., 1996; Cerrito et al., 2004). In the present study, GRK2 expression was greater in lac-tating mammary glands of cows with low-quality milk, suggesting that GRK2 may block the lactogenic dif-ferentiation of mammary epithelial cells, concomitant with the activation of the MAPK pathway. Overall, these results are consistent with the report that, in the bovine mammary gland at the onset of lactation, upregulation of genes involved in milk-protein synthesis is concomitant with inhibition of genes related to cell proliferation (Finucane et al., 2008).
CONCLUSIONS
Mammary epithelial proliferation and lactation are regulated by specific gene expression. In the lactating mammary gland of the dairy cow, GRK2 expression negatively correlates with milk-protein synthesis and occurs in concert with stimulation of mammary epithe-lial cell proliferation.
ACKNOWLEDGMENTS
This work was supported by grants from National Basic Research Program (2011CB100804) from the Ministry of Science and Technology of China and the National Natural Science Foundation of China (31200984 to X. Hou, and 31401109 to Y. Lin).
REFERENCES
Arnold, A., and A. Papanikolaou. 2005. Cyclin D1 in breast cancer pathogenesis. J. Clin. Oncol. 23:4215–4224.
Benovic, J. L., R. H. Strasser, M. G. Caron, and R. J. Lefkowitz. 1986. Beta-adrenergic receptor kinase: Identification of a novel protein kinase that phosphorylates the agonist-occupied form of the recep-tor. Proc. Natl. Acad. Sci. USA 83:2797–2801.
Bionaz, M., and J. J. Loor. 2011. Gene networks driving bovine mam-mary protein synthesis during the lactation cycle. Bioinform. Biol. Insights 5:83–98.
Boxer, R. B., D. B. Stairs, K. D. Dugan, K. L. Notarfrancesco, C. P. Portocarrero, B. A. Keister, G. K. Belka, H. Cho, J. C. Rathmell,
C. B. Thompson, M. J. Birnbaum, and L. A. Chodosh. 2006. Iso-form-specific requirement for Akt1 in the developmental regulation of cellular metabolism during lactation. Cell Metab. 4:475–490. Capuco, A. V., D. L. Wood, R. Baldwin, K. Mcleod, and M. J. Paape.
2001. Mammary cell number, proliferation, and apoptosis during a bovine lactation: Relation to milk production and effect of bST. J. Dairy Sci. 84:2177–2187.
Cerbulis, J., and H. M. Farrell Jr. 1975. Composition of milks of dairy cattle. I. Protein, lactose, and fat contents and distribution of pro-tein fraction. J. Dairy Sci. 58:817–827.
Cerrito, M. G., T. Galbaugh, W. Wang, T. Chopp, D. Salomon, and M. L. Cutler. 2004. Dominant negative Ras enhances lactogenic hormone-induced differentiation by blocking activation of the Raf-Mek-Erk signal transduction pathway. J. Cell. Physiol. 201:244– 258.
Connor, E. E., S. Siferd, T. H. Elsasser, C. M. Evock-Clover, C. P. Van Tassell, T. S. Sonstegard, V. M. Fernandes, and A. V. Capuco. 2008. Effects of increased milking frequency on gene expression in the bovine mammary gland. BMC Genomics 9:362.
Fata, J. E., H. Mori, A. J. Ewald, H. Zhang, E. Yao, Z. Werb, and M. J. Bissell. 2007. The MAPK(ERK-1,2) pathway integrates distinct and antagonistic signals from TGFalpha and FGF7 in morphogen-esis of mouse mammary epithelium. Dev. Biol. 306:193–207. Faulds, M. H., H. Olsen, L. A. Helguero, J. A. Gustafsson, and L. A.
Haldosén. 2004. Estrogen receptor functional activity changes dur-ing differentiation of mammary epithelial cells. Mol. Endocrinol. 18:412–421.
Finucane, K. A., T. B. McFadden, J. P. Bond, J. J. Kennelly, and F. Q. Zhao. 2008. Onset of lactation in the bovine mammary gland: Gene expression profiling indicates a strong inhibition of gene ex-pression in cell proliferation. Funct. Integr. Genomics 8:251–264. Galbaugh, T., M. G. Cerrito, C. C. Jose, and M. L. Cutler. 2006.
EGF-induced activation of Akt results in mTOR-dependent p70S6 kinase phosphorylation and inhibition of HC11 cell lactogenic dif-ferentiation. BMC Cell Biol. 7:34.
Gao, Y., X. Lin, K. Shi, Z. Yan, and Z. Wang. 2013. Bovine mammary gene expression profiling during the onset of lactation. PLoS ONE 8:e70393.
Haug, A., A. T. Høstmark, and O. M. Harstad. 2007. Bovine milk in human nutrition—A review. Lipids Health Dis. 6:25.
Jedrzejczak, M., and I. Szatkowska. 2014. Bovine mammary epithelial cell cultures for the study of mammary gland functions. In Vitro Cell. Dev. Biol. Anim. 50:389–398.
Jiang, X., P. Yang, and L. Ma. 2009. Kinase activity-independent reg-ulation of cyclin pathway by GRK2 is essential for zebrafish early development. Proc. Natl. Acad. Sci. USA 106:10183–10188. Kahsai, A. W., S. Zhu, and G. Fenteany. 2010. G protein-coupled
receptor kinase 2 activates radixin, regulating membrane pro-trusion and motility in epithelial cells. Biochim. Biophys. Acta 1803:300–310.
Lappano, R., and M. Maggiolini. 2011. G protein-coupled receptors: Novel targets for drug discovery in cancer. Nat. Rev. Drug Discov. 10:47–60.
Liu, L., Y. Lin, L. Liu, Y. Bian, L. Zhang, X. Gao, and Q. Li. 2015. 14–3-3γ Regulates lipopolysaccharide-induced inflammatory re-sponses and lactation in dairy cow mammary epithelial cells by inhibiting NF-κB and MAPKs and up-regulating mTOR signaling. Int. J. Mol. Sci. 16:16622–16641.
Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)). Methods 25:402–408.
Marte, B. M., M. Jeschke, D. Graus-Porta, D. Taverna, P. Hofer, B. Groner, Y. Yarden, and N. E. Hynes. 1995. Neu differentiation fac-tor/heregulin modulates growth and differentiation of HC11 mam-mary epithelial cells. Mol. Endocrinol. 9:14–23.
Master, S. R., J. L. Hartman, C. M. D'Cruz, S. E. Moody, E. A. Keiper, S. I. Ha, J. D. Cox, G. K. Belka, and L. A. Chodosh. 2002. Functional microarray analysis of mammary organogenesis reveals a developmental role in adaptive thermogenesis. Mol. Endocrinol. 16:1185–1203.
Menzies, K. K., C. Lefèvre, K. L. Macmillan, and K. R. Nicholas. 2009. Insulin regulates milk protein synthesis at multiple levels in the bovine mammary gland. Funct. Integr. Genomics 9:197–217. Merlo, G. R., D. Graus-Porta, N. Cella, B. M. Marte, D. Taverna,
and N. E. Hynes. 1996. Growth, differentiation and survival of HC11 mammary epithelial cells: Diverse effects of receptor tyro-sine kinase-activating peptide growth factors. Eur. J. Cell Biol. 70:97–105.
Penela, P., V. Rivas, A. Salcedo, and F. Mayor Jr. 2010. G protein-coupled receptor kinase 2 (GRK2) modulation and cell cycle pro-gression. Proc. Natl. Acad. Sci. USA 107:1118–1123.
Pitcher, J. A., N. J. Freedman, and R. J. Lefkowitz. 1998. G protein-coupled receptor kinases. Annu. Rev. Biochem. 67:653–692. Prizant, R. L., and I. Barash. 2008. Negative effects of the amino acids
Lys, His, and Thr on S6K1 phosphorylation in mammary epithe-lial cells. J. Cell. Biochem. 105:1038–1047.
Robinson, J. D., and J. A. Pitcher. 2013. G protein-coupled receptor kinase 2 (GRK2) is a Rho-activated scaffold protein for the ERK MAP kinase cascade. Cell. Signal. 25:2831–2839.
Rudolph, M. C., J. L. McManaman, L. Hunter, T. Phang, and M. C. Neville. 2003. Functional development of the mammary gland: Use of expression profiling and trajectory clustering to reveal changes in gene expression during pregnancy, lactation, and involution. J. Mammary Gland Biol. Neoplasia 8:287–307.
Schwertfeger, K. L., M. M. Richert, and S. M. Anderson. 2001. Mam-mary gland involution is delayed by activated Akt in transgenic mice. Mol. Endocrinol. 15:867–881.
Sekuliü, A., C. C. Hudson, J. L. Homme, P. Yin, D. M. Otterness, L. M. Karnitz, and R. T. Abraham. 2000. A direct linkage be-tween the phosphoinositide 3-kinase-AKT signaling pathway and the mammalian target of rapamycin in mitogen-stimulated and transformed cells. Cancer Res. 60:3504–3513.
Sicinski, P., J. L. Donaher, S. B. Parker, T. Li, A. Fazeli, H. Gardner, S. Z. Haslam, R. T. Bronson, S. J. Elledge, and R. A. Weinberg. 1995. Cyclin D1 provides a link between development and onco-genesis in the retina and breast. Cell 82:621–630.
Sigl, T., H. H. Meyer, and S. Wiedemann. 2014. Gene expression anal-ysis of protein synthesis pathways in bovine mammary epithelial cells purified from milk during lactation and short-term restricted feeding. J. Anim. Physiol. Anim. Nutr. (Berl.) 98:84–95.
Stewart, A. F., J. Bonsing, C. W. Beattie, F. Shah, I. M. Willis, and A. G. Mackinlay. 1987. Complete nucleotide sequences of bovine alpha S2- and beta-casein cDNAs: Comparisons with related se-quences in other species. Mol. Biol. Evol. 4:231–241.
Suchyta, S. P., S. Sipkovsky, R. G. Halgren, R. Kruska, M. Elftman, M. Weber-Nielsen, M. J. Vandehaar, L. Xiao, R. J. Tempelman, and P. M. Coussens. 2003. Bovine mammary gene expression pro-filing using a cDNA microarray enhanced for mammary-specific transcripts. Physiol. Genomics 16:8–18.
Toerien, C. A., D. R. Trout, and J. P. Cant. 2010. Nutritional stimu-lation of milk protein yield of cows is associated with changes in phosphorylation of mammary eukaryotic initiation factor 2 and ribosomal s6 kinase 1. J. Nutr. 140:285–292.
Wang, L., Y. Lin, Y. Bian, L. Liu, L. Shao, L. Lin, B. Qu, F. Zhao, X. Gao, and Q. Li. 2014a. Leucyl-tRNA synthetase regulates lacta-tion and cell proliferalacta-tion via mTOR signaling in dairy cow mam-mary epithelial cells. Int. J. Mol. Sci. 15:5952–5969.
Wang, X., and C. G. Proud. 2006. The mTOR pathway in the control of protein synthesis. Physiology (Bethesda) 21:362–369.
Wang, Z., X. Hou, B. Qu, J. Wang, X. Gao, and Q. Li. 2014b. Pten regulates development and lactation in the mammary glands of dairy cows. PLoS ONE 9:e102118.
Watari, K., M. Nakaya, and H. Kurose. 2014. Multiple functions of G protein-coupled receptor kinases. J. Mol. Signal. 9:1.
