Study of antibiotic resistance pattern and incidence of pathogenic genes of mgtC, spi4R, agfA, invE/A and ttrC in Salmonella infantis isolated from clinical specimens

Download (0)

Full text

(1)

442

Original Article

Study of antibiotic resistance pattern and incidence of pathogenic genes of

mgtC, spi4R, agfA, invE/A and ttrC in Salmonella infantis isolated from

clinical specimens

Aghdasi-Araghinezhad R, Amini K*

Department of Microbiology, Faculty of Basic Sciences, Saveh Branch, Islamic Azad University, Saveh, I. R. Iran.

Received November 13, 2016; Accepted May 29, 2017

Abstract:

Background: The importance of the health of red meat, poultry and eggs in human nutrition

is very high. One of the factors that jeopardize the health of poultry food products is the

bacterial family of

Enterobacteriaceae

, especially

Salmonella

. The aim of this study was to

detect pathogenic genes in

Salmonella

infectious bacteria isolated from stool specimens

using the multiple PCR assay.

Materials and Methods: Selective and specific media for isolation of

Salmonella

were

used. Primary isolation was carried out using Peptone water, Rapaport, selenite cysteine,

MacConky agar and xylose-lysine deoxycholate agar. To confirm the diagnosis, biochemical

tests including TSI, urea, endodontic, and citrate were used. The

Salmonella

Polyvalent Kit

was used to determine

Salmonella

groups and

mgtC

,

spi4R

,

agfA

,

invE

/

A

and

ttrC

genes

were studied in 60 samples by the multiple PCR method.

Results: The results showed that all samples had 2 genes

mgtC

and

ttrC

, and none of the

samples showed resistance to cefepime. Of the 60 samples of

Salmonella

, none were

resistant to cefepime and ceftriaxone; 38.8% of the samples were resistant to amoxicillin,

53% to erythromycin and 38.3% to sulfamethoxazole.

Conclusion: It can be concluded that cefepime is the best selective drug for the treatment of

Salmonella

infections. Identification and validation of genes in the region's bacteria can play

a role in the broad epidemiological examination, antibiotic resistance, vaccine production,

level of virulence, prevention and treatment. Also, evaluation of these genes in the samples

for their virulence index is very important.

Keywords:

Salmonella infantis

, Pathogenic genes, Antibiotic resistance, Multiple PCR

* Corresponding Author.

Email: dr_kumarss_amini@yahoo.com Tel: 0098 912 545 4074

Fax: 0098 8642 241 511 CCoonnfflliicctt ooff IInntteerreessttss:: NNoo

Feyz, Journal of Kashan University of Medical Sciences, December, 2017; Vol. 21, No 5, Pages 442-449

Please cite this article as: Aghdasi-Araghinezhad R, Amini K. Study of antibiotic resistance pattern and incidence of pathogenic genes of

mgtC, spi4R, agfA, invE/A and ttrC in Salmonella infantis isolated from clinical specimens. Feyz 2017; 21(5): 442-9.

(2)

ﻲﺳرﺮﺑ

ﻲﺘﻧآ

ﺖﻣوﺎﻘﻣ

يﻮﮕﻟا

ﻲﻜﻴﺗﻮﻴﺑ

زوﺮﺑ

و

نژ

يرﺎﻤﻴﺑ

يﺎﻫ

از

ي

mgtC

،

spi4R

،

agfA

،

invE/A

و

ttrC

يﺮﺘﻛﺎﺑ

رد

ﻳا

ﻼﻧﻮﻤﻟﺎﺳ

ﺲﻴﺘﻨﻔ

اﺪﺟ

هﺪﺷ

ﻪﻧﻮﻤﻧ

زا

يﺎﻫ

ﻲﻨﻴﻟﺎﺑ

ﻲﻗاﺮﻋﻲﺳﺪﻗاﺎﻳور داﮋﻧ 1 ﻲﻨﻴﻣاثﺮﻣﻮﻴﻛ، 2 * ﻪﻣﺪﻘﻣ ﻲﻠﻋ هداﻮﻧﺎﺧﻲﮔﺪﻴﭽﻴﭘﻢﻏر ا ،ﻪﺳﺎﻳﺮﺘﻛﺎﺑوﺮﺘﻧ ﺮﺘﻤﻛ زا 20 ﺲﻨﺟ نآ زاﺶﻴﺑﻞﻣﺎﻋﺎﻫ 95 ﺖﻧﻮﻔﻋزاﺪﺻرد ﻲﻣهﺪﺷدﺎﺠﻳايﺎﻫ ﺪﻨﺷﺎﺑ . هدور ﻲﻌﻴﺒﻃ رﻮﻠﻓ ﻪﻜﻨﻳا ﺮﺑ هوﻼﻋ هداﻮﻧﺎﺧ ﻦﻳا يﺎﻀﻋا زا ﻲﺧﺮﺑ ﻲﻣتﺎﻧاﻮﻴﺣونﺎﺴﻧا ﺑ،ﺪﻨﺷﺎﺑ هدﺮﺘﺴﮔرﻮﻃ زا ،كﺎﺧ،بآ و يﺰﺒﺳ -ﻲﻣ اﺪﺟ ﺎﻫ ،ﺪﻧدﺮﮔ ﻦﻴﻨﭽﻤﻫ و ﺎﻀﻋا زا ﻲﻀﻌﺑ هداﻮﻧﺎﺧ ﻦﻳا ي يرﺎﻤﻴﺑ از هدﻮﺑ دﻲﻀﻌﺑو ﺖﺻﺮﻓﺖﻧﻮﻔﻋﻞﻣﺎﻋﺮﮕﻳ ﻲﻣﺐﻠﻃ ﺪﻨﺷﺎﺑ . دوﺪﺣرد 30 ﺎﺗ 35 ﺖﻧﻮﻔﻋزاﺪﺻرد زاﺶﻴﺑ،نﻮﺧيﺎﻫ 70 ﺪﺻرد ﺖﻧﻮﻔﻋزا ﺖﻧﻮﻔﻋزايرﺎﻴﺴﺑويراردايرﺎﺠﻣيﺎﻫ هدوريﺎﻫ رديا يﺮﺘﻛﺎﺑﻪﺑﻲﮔدﻮﻟآﺮﺛا ﻲﻣدﺎﺠﻳاهداﻮﻧﺎﺧﻦﻳايﺎﻫ ﺪﻧﻮﺷ . 1 ﺶﻧاد ﻪﺘﺧﻮﻣآ ﻲﺳﺎﻨﺷرﺎﻛ ،ﺪﺷرا هوﺮﮔ ،يژﻮﻟﻮﻴﺑوﺮﻜﻴﻣ ﺪﻜﺸﻧاد ه مﻮﻠﻋ ،ﻪﻳﺎﭘ ﺪﺣاو ،هوﺎﺳ هﺎﮕﺸﻧاد دازآ ،ﻲﻣﻼﺳا ،هوﺎﺳ ناﺮﻳا 2 ،رﺎﻳدﺎﺘﺳا هوﺮﮔ ،يژﻮﻟﻮﻴﺑوﺮﻜﻴﻣ هﺪﻜﺸﻧاد مﻮﻠﻋ ،ﻪﻳﺎﭘ ﺪﺣاو ،هوﺎﺳ هﺎﮕﺸﻧاد دازآ ،ﻲﻣﻼﺳا ،هوﺎﺳ ناﺮﻳا * لﻮﺌﺴﻣهﺪﻨﺴﻳﻮﻧﻲﻧﺎﺸﻧ : هﺎﮕﺸﻧاد دازآ ،ﻲﻣﻼﺳا ،هوﺎﺳﺪﺣاو هﺪﻜﺸﻧاد مﻮﻠﻋ هوﺮﮔ،ﻪﻳﺎﭘ يژﻮﻟﻮﻴﺑوﺮﻜﻴﻣ ﻦﻔﻠﺗ : 09125454074 ﺲﻳﻮﻧرود : 08642241511 ﻚﻴﻧوﺮﺘﻜﻟاﺖﺴﭘ :  dr_kumarss_amini@yahoo.com   ﺖﻓﺎﻳردﺦﻳرﺎﺗ : 1395/8/23 ﻲﻳﺎﻬﻧشﺮﻳﺬﭘﺦﻳرﺎﺗ : 1396/3/8 ﺖﻧﻮﻔﻋ ﻛﺎﺑﻂﺳﻮﺗ هﺪﺷدﺎﺠﻳا يﺎﻫ يﺮﺘ ﻪﺳﺎﻳﺮﺘﻛﺎﺑوﺮﺘﻧا هداﻮﻧﺎﺧ يﺎﻫ ﻲﻣ ﻣﻚﻳزاﺪﻨﻧاﻮﺗ ـ ﻲﻧاﻮﻴﺣنﺰﺨ ﮔﺐﻠﻏاﺪﻨﻧﺎﻣ ـ ﻪﻧﻮ وﻼﻧﻮﻤﻟﺎﺳيﺎﻫ ،ﺎﻴﻨﻴﺳﺮﻳ ﻚﻳ ﻪﻧﻮﮔﺪﻨﻧﺎﻣﻲﻧﺎﺴﻧاﻞﻗﺎﻧ وﻼﻧﻮﻤﻟﺎﺳوﻼﮕﻴﺷيﺎﻫ ﺰﻴﻧ زا ﺪﻌﺘﺴﻣنارﺎﻤﻴﺑردﻢﺴﻴﻧﺎﮔراﻲﻧوردرﺎﺸﺘﻧا ﺪﻨﻧﺎﻣ ﻲﻠﻛﺎﻴﺸﻳﺮﺷا ءﺎﺸﻨﻣ ﻲﻣﻊﻗاوردوﻪﺘﻓﺮﮔ ﺪﺑزاﻲﻳﺎﺟﺮﻫﺪﻨﻧاﻮﺗ ﺮﻴﮔردارناﻮﻴﺣونﺎﺴﻧان ﺪﻨﻳﺎﻤﻧ ] 1 ، 2 .[ شور ﺎﻫ ﻲﻟﻮﻜﻟﻮﻣ ي نآ ﻲﻳﺎﻫ ﻪﺑ ﻪﻛ رد ﻊﻴﺳو رﻮﻃ ﻲﻣ هدﺎﻔﺘﺳا ﺎﻫﻼﻧﻮﻤﻟﺎﺳ ﻚﻳژﻮﻟﻮﻴﻣﺪﻴﭘا تﺎﻌﻟﺎﻄﻣ دﺮﮔ زا ﺪﻨﺗرﺎﺒﻋ : ،ﮓﻨﻴﭙﻳﺎﺗﻮﺒﻳر ،ﮓﻨﻴﭙﻳﺎﺗ ﺪﻴﻤﺳﻼﭘ RCCS ﺖﺸﮕﻧا ،ﮓﻨﻴﭙﻳﺎﺗ يرﺎﮕﻧ ﺮﺻﺎﻨﻋ IS200 ﺖﺸﮕﻧا اﺮﻴﺧا و يرﺎﮕﻧ يﺎﻫ PFGE و AFLP . ﺖﻓﺮﺸﻴﭘ ﺎﻫ شورردﺮﻴﺧاي ﻲﻟﻮﻜﻟﻮﻣيﺎﻫ نژﻲﻳﺎﺳﺎﻨﺷ نﺎﻜﻣاﻦﻳاﺎﻫ يﺮﺘﻛﺎﺑ ناﻮﺘﺑ ﺎﺗ ﺖﺳا هدﻮﻤﻧ ﻢﻫاﺮﻓ ار تﺎﻴﺻﻮﺼﺧ سﺎﺳاﺮﺑ ار ﺎﻫ ﻪﺘﺳد ﻲﭙﻴﺗﻮﻧژ دﺮﻛ يﺪﻨﺑ . شور ﺮﺑ ﻲﻟﻮﻜﻟﻮﻣ يﺎﻫ يﺎﻨﺒﻣ DNA يﺪﻴﻤﺳﻼﭘ و نژ ﻲﻳﺎﺳﺎﻨﺷ ﻖﻳﺮﻔﺗ ﺖﻬﺟ يﺪﻴﻤﺳﻼﭘ تﺪﺣ يﺎﻫ ﻪﻳﻮﺳ ﻼﻧﻮﻤﻟﺎﺳيﺎﻫ ﻪﺑ ﻲﻣرﺎﻛ ﺪﻨﻳآ . رد ﻚﻳ ﻖﻴﻘﺤﺗ ﺎﺸﻣ ﻪﺑ شورزاﺰﻴﻧ PCR ﻪﻧﺎﮔﺪﻨﭼ ﺖﻳﻮﻫ ﻦﻴﻴﻌﺗ ﺖﻬﺟ ﻲﻔﻴﺗ ﻼﻧﻮﻤﻟﺎﺳ مﻮﻳرﻮﻣ و ﻼﻧﻮﻤﻟﺎﺳ ﺲﻳﺪﻴﺘﻳﺮﺘﻧا و نژ ﻦﻴﻴﻌﺗ تﺪﺣ ﺪﻴﻤﺳﻼﭘ يﺎﻫ (SPV) ﺪﺷهدﺎﻔﺘﺳا ﺖﺳاه ] 3 .[ شور ﻦﻴﺑﻼﻧﻮﻤﻟﺎﺳﺺﻴﺨﺸﺗلواﺪﺘﻣيﺎﻫ 3 ﻲﻟا 5 ﻲﻣﺖﻗوزور شورزاﻪﻛﺖﺳاﻦﻳاﺮﺑﻲﻌﺳزوﺮﻣاودﺮﻴﮔ -ﮔﮋﻳو ﺎﺑ و سﺎﺴﺣ ﺎﻣا ﻊﻳﺮﺳيﺎﻫ دﻮﺷ هدﺎﻔﺘﺳا ﻻﺎﺑ . تﺎﺸﻳﺎﻣزآ ﻪﺻﻼﺧ : ﻪﻘﺑﺎﺳ فﺪﻫ و : ﺰﻣﺮﻗﺖﺷﻮﮔﺖﻣﻼﺳﺖﻴﻤﻫا ، ﻢﺨﺗوغﺮﻣ ردغﺮﻣ نﺎﺴﻧاﻪﻳﺬﻐﺗ ﺖﺳادﺎﻳزرﺎﻴﺴﺑ . زاﻲﻜﻳ ﻲﻠﻠﻋ ﺮﻓﺖﻣﻼﺳﻪﻛ آ هدرو يﺎﻫ ﻪﺑاررﻮﻴﻃﻲﻳاﺬﻏ ﻲﻣهﺮﻃﺎﺨﻣ يﺮﺘﻛﺎﺑدزاﺪﻧا ﺳﺎﻳﺮﺘﻛﺎﺑوﺮﺘﻧاهداﻮﻧﺎﺧ يﺎﻫ ﻪﺑﻪ ﻲﻣﻼﻧﻮﻤﻟﺎﺳهﮋﻳو ﺪﺷﺎﺑ . زافﺪﻫ ﻦﻳا نژﻲﻳﺎﺳﺎﻨﺷ ﻖﻴﻘﺤﺗ يﺎﻫ يرﺎﻤﻴﺑ از يﺮﺘﻛﺎﺑرد يﺎﻫ ﻼﻧﻮﻤﻟﺎﺳ ﻳا ﺲﻴﺘﻨﻔ هﺪﺷاﺪﺟ زا ﻪﻧﻮﻤﻧ شورﺎﺑعﻮﻓﺪﻣيﺎﻫ PCR ﻪﻧﺎﮔﺪﻨﭼ د . شور و داﻮﻣ ﺎﻫ : ﻂﻴﺤﻣزا ﺶﻴﭘيﺎﻫ وﻲﺑﺎﺨﺘﻧا يزﺎﺳاﺪﺟياﺮﺑﻲﺻﺎﺼﺘﺧا ﺪﺷهدﺎﻔﺘﺳاﻼﻧﻮﻤﻟﺎﺳ . ﻪﺑ رﻮﻈﻨﻣ ﻟوايزﺎﺳاﺪﺟ ﻪﻴ زا ﻂﻴﺤﻣ يﺎﻫ بآ ،ﻪﻧﻮﺘﭙﭘ ﻚﻣ،ﻦﻴﺌﺘﺴﻴﺳﺖﻴﻨﻠﺳ،ترﻮﭘﺎﭘار ﻧﺎﻛ رﺎﮔآﻲ و XLD ﺪﺷهدﺎﻔﺘﺳا . ﺪﻴﺋﺄﺗﺖﻬﺟ ﺺﻴﺨﺸﺗ ﺖﺴﺗزا ﻲﻳﺎﻴﻤﻴﺷﻮﻴﺑيﺎﻫ ﻞﻣﺎﺷ TSI ، هروا ، ولوﺪﻧا تاﺮﺘﻴﺳ ، و ﺪﻳدﺮﮔهدﺎﻔﺘﺳاﺖﻛﺮﺣ . ﻦﻴﻴﻌﺗياﺮﺑ ﺖﻴﻛزا،هﺪﺷاﺪﺟيﻼﻧﻮﻤﻟﺎﺳهوﺮﮔ ﻲﻠﭘ نﻻاو ﻼﻧﻮﻤﻟﺎﺳ ﺪﺷهدﺎﻔﺘﺳا و نژ يﺎﻫ mgtC ، spi4R ، agfA ، invE/A و ttrC رد 60 شورﺎﺑﻪﻌﻟﺎﻄﻣدرﻮﻣﻪﻧﻮﻤﻧ PCR ﻪﻧﺎﮔﺪﻨﭼ ﺪﻳدﺮﮔﻲﺳرﺮﺑ . ﺞﻳﺎﺘﻧ : ﺞﻳﺎﺘﻧ ﻖﻴﻘﺤﺗ دادنﺎﺸﻧ ﻪﻛ ﻪﻧﻮﻤﻧمﺎﻤﺗ يارادﺎﻫ 2 نژ mgtC و ttrC وهدﻮﺑ ﻪﻧﻮﻤﻧزاماﺪﻜﭽﻴﻫ ﺎﻫ نﺎﺸﻧﻢﻴﭙﻔﺳﻪﺑﺖﺒﺴﻧﻲﺘﻣوﺎﻘﻣ ﺪﻧداﺪﻧ . عﻮﻤﺠﻣزا 60 ﻼﻧﻮﻤﻟﺎﺳﻪﻧﻮﻤﻧ ، ﭻﻴﻫ ماﺪﻛ ﻢﻴﭙﻔﺳﻪﺑ و موﺎﻘﻣنﻮﺴﻛﺎﻳﺮﺘﻔﺳ ،ﺪﻧدﻮﺒ 8 / 38 نآﺪﺻرد ﻲﺴﻛﻮﻣآﻪﺑﺎﻫ ،ﻦﻴﻠﻴﺳ 53 ﺪﺻرد ﻪﺑ وﻦﻴﺴﻳﺎﻣوﺮﺘﻳرا 3 / 38 ﺪﺻرد لوزﺎﺴﻛﻮﺘﻣﺎﻔﻟﻮﺳﻪﺑ ﺪﻧدادنﺎﺸﻧﺖﻣوﺎﻘﻣ . ﻪﺠﻴﺘﻧ يﺮﻴﮔ : ﻲﻣعﻮﻤﺠﻣرد ﺖﻔﮔناﻮﺗ ﻪﺑﻢﻴﭙﻔﺳ ﻲﺑﺎﺨﺘﻧايورادﻦﻳﺮﺘﻬﺑناﻮﻨﻋ ﻪﺑﻼﺘﺑانﺎﻣردياﺮﺑ ﺲﻴﺘﻨﻔﻨﻳاﻼﻧﻮﻤﻟﺎﺳ ﻲﻣ ﺷﺎﺑ . وﻲﻳﺎﺳﺎﻨﺷ نژﺪﻴﻳﺎﺗ يﺮﺘﻛﺎﺑردﺎﻫ ﻲﻣﻪﻘﻄﻨﻣيﺎﻫ ﺖﻣوﺎﻘﻣ،ﻊﻴﺳوﻲﻜﻳژﻮﻟﻮﻴﻣﺪﻴﭘاﻲﺳرﺮﺑردﺪﻧاﻮﺗ ﻲﺘﻧآيﺎﻫ ويﺮﻴﮕﺸﻴﭘ،تﺪﺣناﺰﻴﻣ،ﻦﺴﻛاوﺪﻴﻟﻮﺗ،ﻲﻜﻴﺗﻮﻴﺑ ﻪﺘﺷادﺶﻘﻧنﺎﻣرد نژﻦﻳاﻲﺳرﺮﺑو ﻪﻧﻮﻤﻧردﺎﻫ ﻪﺑﺎﻫ درادﺖﻴﻤﻫارﺎﻴﺴﺑتﺪﺣﺺﺧﺎﺷﻲﻧاواﺮﻓﻞﻴﻟد . ژاو نﺎﮔ يﺪﻴﻠﻛ : ﻼﻧﻮﻤﻟﺎﺳ ﻳا ﺲﻴﺘﻨﻔﻨ نژ، يﺎﻫ يرﺎﻤﻴﺑ از ، ﻲﺘﻧآﺖﻣوﺎﻘﻣ ،ﻲﻜﻴﺗﻮﻴﺑ PCR ﻪﻧﺎﮔﺪﻨﭼ هﺎﻣ ود ﻲﻤﻠﻋ ﻪﻣﺎﻧ هرﺎﻤﺷ ،ﻢﻜﻳ و ﺖﺴﻴﺑ هرود ،ﺾﻴﻓ ﻲﺸﻫوﮋﭘ 5 يد و رذآ ، 1396 تﺎﺤﻔﺻ ، 449 -442  

(3)

ﻲﻗاﺮﻋﻲﺳﺪﻗا داﮋﻧ و ﻲﻨﻴﻣا   هﺎﻣود ﺾﻴﻓﻪﻣﺎﻧ | يدورذآ | 1396 | هرود 21 | هرﺎﻤﺷ 5 444   PCR ﻪﻧﻮﻤﻧ رد ﺎﻫﻼﻧﻮﻤﻟﺎﺳ ﻊﻳﺮﺳ ﺺﻴﺨﺸﺗ ﺖﻬﺟ ﻲﻋﻮﻨﺘﻣ يﺎﻫ ﺖﺳا هﺪﺷهدﺎﻔﺘﺳاﻲﻳاﺬﻏداﻮﻣوﻲﻨﻴﻟﺎﺑ . PCR ﻪﻧﺎﮔﺪﻨﭼ ﺮﺑهوﻼﻋ ﻪﻧﻮﻤﻧﻪﺑزﺎﻴﻧ،عﻮﻓﺪﻣﻪﻧﻮﻤﻧردﻼﻧﻮﻤﻟﺎﺳﺺﻴﺨﺸﺗردﻻﺎﺑﺖﻴﺳﺎﺴﺣ وﻪﺘﺷادﺮﺘﻤﻛ 24 ﺦﺳﺎﭘﻞﺑﺎﻗﻪﻧﻮﻤﻧﺖﻓﺎﻳردزاﺲﭘﺖﻋﺎﺳ ﻲﻣﻲﻫد -ﺎﺑ ﺪﺷ ] 4،2 .[ نژ ردفﺪﻫيﺎﻫ PCR ﺪﻨﺘﺴﻫعﻮﻨﺘﻣرﺎﻴﺴﺑﺎﻫﻼﻧﻮﻤﻟﺎﺳ هﺪﺷﻲﺑﺎﻳزرا يدﺎﻳز تﺎﻌﻟﺎﻄﻣ رد و ﺪﻧا . نﺎﻴﻣ ﻦﻳا رد ﻲﻣ نژ ناﻮﺗ invA ﺮﮔزﺎﻏآو نآيﺎﻫ ، ST139 و ST141 هدوﺰﻓاﻪﻌﻄﻗﺎﺑ يزﺎﺳ هﺪﺷ bp 284 دﺮﺑ مﺎﻧ ار . ﻦﻴﻨﭽﻤﻫ ، نژ oriC نژ و agfA ﻪﻛ تﺎﻌﻄﻗ 394 و bp 163 ﻪﺑار ا ﺐﻴﺗﺮﺗ هدوﺰﻓ يزﺎﺳ ﻲﻣ ﺪﻨ . ﻦﻴﻤﻫ -نژ رﻮﻃ OmpC ﻦﻴﺌﺗوﺮﭘ ﻪﻛ OmpC ﻚﻴﻤﺳﻼﭘﻮﺘﻴﺳءﺎﺸﻏ ردار ﻲﻣ ﺪﻛ زﺎﻏآود وﺪﻨﻛ ﺮﮔ S 18 و S 19 ﻪﻌﻄﻗﺎﺑ bp 159 ، و نژ fimA ﻲﻣﻪﻳﺮﺒﻤﻴﻓﻪﺑطﻮﺑﺮﻣنژﻪﻛ ﻪﻌﻄﻗو ﺪﺷﺎﺑ bp 85 هدوﺰﻓاار ﻲﻣ ﺪﻳﺎﻤﻧ . ﻦﻴﻨﭽﻤﻫ نژ، يﺎﻫ invE ، fimZ ، fimY و fimW درﻮﻣﺰﻴﻧ ﺶﻳﺎﻣزآ ﺘﻓﺮﮔ راﺮﻗ ا ﺪﻧ ] 2 ، 5 .[ ﻦﻳا موﺰﻟ ﻲﻳﺎﺳﺎﻨﺷ ﻖﻴﻘﺤﺗ نژ يﺎﻫ mgtC ، spi4R ، agfA ، invE/A و ttrC ﻼﻧﻮﻤﻟﺎﺳ ﻳا ﺲﻴﺘﻨﻔ زا ﻪﻧﻮﻤﻧ شورﺎﺑعﻮﻓﺪﻣﻲﻨﻴﻟﺎﺑيﺎﻫ PCR ﻪﻧﺎﮔﺪﻨﭼ ﻦﻳﺪﺑﺎﺗهدﻮﺑ ﻪﻧﻮﮔ ﻲﺘﻧآ ﻪﺑ ﺖﺒﺴﻧ يﺮﺘﻛﺎﺑ ﻦﻳا ﺖﻣوﺎﻘﻣ ناﺰﻴﻣ ﻚﻴﺗﻮﻴﺑ درﻮﻣ يﺎﻫ ﺮﻈﻧ ددﺮﮔﻲﺳرﺮﺑ . نژﻪﻠﻤﺟزا ﻻوﺮﻳويﺎﻫ ﻲﻣﺲﻧ ﻪﺑناﻮﺗ invA ، ttrC ، mgtC ، spi4R ، agfA دﺮﻛهرﺎﺷا ﻼﻧﻮﻤﻟﺎﺳ ﺲﻨﺟ رد . نژﻦﻳا ﺎﻫ ﻦﻴﺌﺗوﺮﭘ ﻲﻣﺪﻛارﻲﻳﺎﻫ نﺎﻤﻠﭙﻤﻛ،ﻲﻨﻤﻳاﻢﺘﺴﻴﺳﺎﺑﻪﻠﺑﺎﻘﻣردﻪﻛﺪﻨﻨﻛ ﺪﻧراد ﺶﻘﻧﻲﻟﻮﻠﺳ ﻞﺧادگﺮﻣ و . ﻪﻛ يﺮﮕﻳدﻢﻬﻣ ﻲﻜﻴﺘﻧژﺮﺼﻨﻋ ﻪﺘﻴﺴﻴﻧژﻮﺗﺎﭘ ﺮﻳاﺰﺟ ،دراد يﺮﺘﻛﺎﺑ ﻦﻳا ﺰﻧژﻮﺗﺎﭘ رد ﻲﺳﺎﺳا ﺶﻘﻧ ﺎﺳ ﻪﺑﺎﻫﻼﻧﻮﻤﻟ مﺎﻧ SPIs ﻲﻣ طﺎﺨﻣ ﻪﺑﻪﻴﻟوا ﻢﺟﺎﻬﺗﻪﻄﺳاو ﻪﻛ ﺪﺷﺎﺑ ﺖﺳا هدور . نژ spi4R ﺢﺷﺮﺗ و ﺎﻫژﺎﻓوﺮﻛﺎﻣ نورد يﺎﻘﺑ ياﺮﺑ دراد ﻲﺳﺎﺳا ﺶﻘﻧ ﻦﻴﺴﻛﻮﺗ . نژ زا ﻲﻫوﺮﮔ ناﻮﻨﻋ ﺖﺤﺗ ﺎﻫ invA لﻮﻠﺳﻪﺑﻼﻧﻮﻤﻟﺎﺳدوروردﻪﻛﺪﻧراددﻮﺟو ﻲﭘايﺎﻫ ﺎﻔﻳاﺶﻘﻧلﺎﻴﻠﺗ ﻲﻣ ﺪﻨﻨﻛ . ﻧا ﺮﻈﻧ زا ﻢﻫ ﺮﻳاﺰﺟ ﻦﻳا ﻲﻧژ يﻮﺘﺤﻣ ﺮﻈﻧ زا ﻢﻫ و هزاﺪ ﺪﻨﺘﺴﻫﻢﻬﻣرﺎﻴﺴﺑ ] 2 .[ ﻲﻳﺎﺳﺎﻨﺷﻖﻴﻘﺤﺗﻦﻳامﺎﺠﻧازافﺪﻫ نژ يﺎﻫ mgtC ، spi4R ، agfA ، invE/A و ttrC ﻼﻧﻮﻤﻟﺎﺳ ﻳا ﺲﻴﺘﻨﻔ زا ﻪﻧﻮﻤﻧ شورﺎﺑعﻮﻓﺪﻣﻲﻨﻴﻟﺎﺑيﺎﻫ PCR ﻪﻧﺎﮔﺪﻨﭼ ﻲﻣ ﺪﺷﺎﺑ . شوروداﻮﻣ ﺎﻫ ﺶﻫوﮋﭘ ﻦﻳا رد ﻲﻌﻄﻘﻣ -ﻲﻔﻴﺻﻮﺗ داﺪﻌﺗ 60 زا ﻪﻧﻮﻤﻧ ﻪﻧﻮﻤﻧ يﺎﻫ ﻲﻧﺎﺴﻧا زا نﺎﺘﺳرﺎﻤﻴﺑ مﺎﻣا ﻲﻨﻴﻤﺧ ) هر ( فوﺮﻇ رد ناﺮﻬﺗ ﻊﻤﺟصﻮﺼﺨﻣﻞﻳﺮﺘﺳا ﺪﻳدﺮﮔيراﺬﮔﺪﻛويروآ ه ﻪﻴﻠﻛﺖﻳﺎﻋرﺎﺑو ﻤﻧﻞﻘﻧ وﻞﻤﺣتﺎﻜﻧ ﻪﻧ ﻲﻧﻮﻔﻋيﺎﻫ ، بوﺮﻜﻴﻣهوﺮﮔهﺎﮕﺸﻳﺎﻣزآ ﻪﺑ ﺪﺷﻞﻘﺘﻨﻣدﺎﮔرﺎﺳﺎﭘﻲﺳﺎﻨﺷ . ﻼﻧﻮﻤﻟﺎﺳﻲﻳﺎﻴﻤﻴﺷﻮﻴﺑﺪﻴﻳﺄﺗويزﺎﺳاﺪﺟ ﻪﻟوﺰﻳا ﻪﻤﻫ شور ﻂﺳﻮﺗ ﺎﻫ يﺎﻫ و ﻲﻳﺎﻴﻤﻴﺷﻮﻴﺑ لواﺪﺘﻣ ﺪﻧﺪﺷ ﻲﻳﺎﺳﺎﻨﺷ ﻲﭘﻮﻜﺳوﺮﻜﻴﻣ ) هرﺎﻤﺷ لوﺪﺟ 1 ( ؛ ﻦﻳﺪﺑ ﺐﻴﺗﺮﺗ ﻪﻛ ﻪﻧﻮﻤﻧاﺪﺘﺑا ﻂﻴﺤﻣيورﺎﻫ ﻼﻧﻮﻤﻟﺎﺳﻲﺑﺎﺨﺘﻧاﺖﺸﻛ يﺎﻫ -رﺎﮔآﻼﮕﻴﺷ زاﺲﭘوﻪﺘﻓﺎﻳلﺎﻘﺘﻧا 24 ﻪﻧﺎﺨﻣﺮﮔﺖﻋﺎﺳ رديراﺬﮔ ˚C 37 يورزا ﻦﻳﺮﺑ ﺖﺷﻮﮕﺑآ ﻲﻧﺎﺗﺮﺑ ﺎﻳرﻮﻟ زﻮﻟژ يور ترﺎﻫ (LB) ﻪﺑ ترﻮﺻ ﺖﻬﺟ ﻲﻄﺧ ﻠﻛ ندروآ ﺖﺳد ﺪﺷ هداد ﺖﺸﻛ دﺮﻔﻨﻣ ﻲﻧ رد و ﺖﻳﺎﻬﻧ ﺷهدﺎﻔﺘﺳاﻲﻟﻮﻜﻟﻮﻣيﺎﻫرﺎﻛﺖﻬﺟ ﻧﺪ . لوﺪﺟ هرﺎﻤﺷ 1 -ﻼﻧﻮﻤﻟﺎﺳﻲﻳﺎﻴﻤﻴﺷﻮﻴﺑتﺎﻴﺻﻮﺼﺧ ﺖﺴﺗ عﻮﻧ ﺖﺴﺗ ﻪﺠﻴﺘﻧ ﺖﺴﺗ عﻮﻧ ﺖﺴﺗ ﻪﺠﻴﺘﻧ لوﺪﻧا _ ﻦﻳﺰﻴﻟ + تاﺮﺘﻴﺳ + لﻮﺘﻴﻧﺎﻣ + ﻦﻴﺘﻴﻧروا + زوﺮﻛﻮﺳ _ vp _ ﺰﻛﻮﻠﮔ + TSI k/gas زﻮﺘﻛﻻ H2S + هروا زآ ONPG MR + يﺮﺘﻛﺎﺑيزﺎﺳاﺪﺟﻞﺣاﺮﻣ ﻪﻧﻮﻤﻧزاﺎﻫ ﻲﻨﻴﻟﺎﺑوﻲﻄﻴﺤﻣيﺎﻫ ﻪﻧﻮﻤﻧزا ودﻮﻫ ﺮﻳزردهﺎﮕﺸﻳﺎﻣزآﻪﺑهﺪﺷهدادلﺎﻘﺘﻧايﺎﻫ رد ةﺪﻨﻨﻛﻲﻨﻏﻂﻴﺤﻣرد،ندﻮﺑﻞﻳﺮﺘﺳالﻮﺻاﺖﻳﺎﻋرﺎﺑﻪﻠﻌﺷرﺎﻨﻛ ﺲﻳدﺎﻴﻠﻴﺳاوترﻮﭘﺎﭘار ) Rappaport Vassiliadis ( مﺎﺠﻧا ﺖﺸﻛ ﻪﺑ و ﺪﺷ تﺪ 24 يﺎﻣد ردﺖﻋﺎﺳ ˚C 37 ﺪﻳدﺮﮔ ﻪﺑﻮﻜﻧا . زا ﺲﭘ درﻮﻣنﺎﻣزﺖﺷﺬﮔ ﻂﻴﺤﻣردپﻮﻟزاهدﺎﻔﺘﺳاﺎﺑﺮﻈﻧ ﻲﺑﺎﺨﺘﻧايﺎﻫ -ﻼﻧﻮﻤﻟﺎﺳ ،ﻲﻗاﺮﺘﻓا -موﺮﻛ ،رﺎﮔآ ﻼﮕﻴﺷ خﺎﺒﻣار ،ﻼﻧﻮﻤﻟﺎﺳ رﺎﮔآ XLD ﻪﺑ ﺪﺷمﺎﺠﻧاﺖﺸﻛﻲﻄﺧترﻮﺻ . ﺖﺷﺬﮔزاﺪﻌﺑ 24 ﺖﻋﺎﺳ ﻪﻨﮔﺮﭘزا ﻂﻴﺤﻣﻪﺑﮓﻧرهﺎﻴﺳيﺎﻫ ﻲﻳﺎﻴﻤﻴﺷﻮﻴﺑيﺎﻫ ﺮﻴﻈﻧ TSI ،هروا ، ﺖﺷﻮﮕﺑآ،تاﺮﺘﻴﺳنﻮﻤﻴﺳ MR-VP ﻂﻴﺤﻣو SIM ترﻮﺻلﺎﻘﺘﻧا ﺖﻓﺮﮔ . شورﺎﺑﻪﻣادارد،ﻼﻧﻮﻤﻟﺎﺳيﺮﺘﻛﺎﺑﻲﻳﺎﻴﻤﻴﺷﻮﻴﺑﺪﻴﺋﺄﺗزاﺪﻌﺑ ﮔآدراﺪﻧﺎﺘﺳا ﻲﺘﻧآزاهدﺎﻔﺘﺳاونﻮﻴﺳﺎﻨﻴﺗﻮ مﺮﺳ ﻲﺻﺎﺼﺘﺧايﺎﻫ O و H رﻮﺘﺳد ﺎﺑ ﻪﻃﻮﺑﺮﻣ ﻞﻤﻌﻟا ، ﻦﻴﻴﻌﺗ يﺮﺘﻛﺎﺑ راووﺮﺳ هﺪﺷ ﻪﺑ ﺰﻴﻧ و -ﻠﻴﺳو PCR ﻪﻧﺎﮔﺪﻨﭼ ﺲﻴﺘﻨﻔﻨﻳاﻼﻧﻮﻤﻟﺎﺳ ﺪﺷﺪﻴﺋﺄﺗ ] 4 ، 6 .[ ﻦﻴﻴﻌﺗ ﺖﻴﺳﺎﺴﺣ ﻲﺘﻧآ ﻲﻜﻴﺗﻮﻴﺑ ﻪﺑ شور ﻚﺴﻳد نژﻮﻴﻔﻳد ﺶﻳﺎﻣزآ ﻚﺴﻳد نژﻮﻴﻔﻳد ﻪﻛ شور ﻲﺑﺮﻛ ﺰﻴﻧﺮﺋﺎﺑ هﺪﻴﻣﺎﻧ ﻲﻣ -،دﻮﺷ لﺎﺳزا 1966 هﺎﮕﺸﻳﺎﻣزآرد ﻪﺑ ﺎﻫ ﻲﻌﻴﺳورﻮﻃ درﻮﻣ هدﺎﻔﺘﺳا ﻲﻣ راﺮﻗ دﺮﻴﮔ . ﺐﻠﻏا هﺎﮕﺸﻳﺎﻣزآ ﺎﻫ ياﺮﺑ ﻦﻴﻴﻌﺗ ﺖﻴﺳﺎﺴﺣ ﻲﺘﻧآ -ﻲﻜﻴﺗﻮﻴﺑ ﻦﻳازا شور سﺎﺳاﺮﺑو يﺎﻫدراﺪﻧﺎﺘﺳا NCCLS هدﺎﻔﺘﺳا ﻲﻣ ﺪﻨﻨﻛ . ﻞﻣاﻮﻋ ﻲﻠﺻا ﻦﻳا ﺶﻳﺎﻣزآ زا ﺪﻨﺗرﺎﺒﻋ ﻚﺴﻳد يﺎﻫ يوﺎﺣ ﻲﺘﻧآ ﻂﻴﺤﻣ،ﻚﻴﺗﻮﻴﺑ ﺖﺸﻛ ﺐﺳﺎﻨﻣ نﻮﻴﺴﻧﺎﭙﺳﻮﺳو ﻲﻳﺎﻳﺮﺘﻛﺎﺑ ﻪﻛ ﺮﻫ

(4)

ﻚﻳ زا دراﻮﻣ قﻮﻓ ﻲﺘﺴﻳﺎﺑ ﻖﺑﺎﻄﻣ يﺎﻫرﺎﻴﻌﻣ ﺎﺑ NCCLS ﻢﻫاﺮﻓ ﺪﻧﻮﺷ ] 6 [. تﺎﺸﻳﺎﻣزآ ﻪﺘﻓﺮﮔ ترﻮﺻ ﺎﺑ شور ﻚﺴﻳد نژﻮﻴﻔﻳد ياﺮﺑ ﻪﻟوﺰﻳا يﺎﻫ ﺲﻴﺘﻨﻔﻨﻳاﻼﻧﻮﻤﻟﺎﺳ زا هدﺎﻔﺘﺳاﺎﺑ 5 ﻚﺴﻳد ﻲﺘﻧآ ﻲﻜﻴﺗﻮﻴﺑ ﻪﻴﻬﺗ هﺪﺷ زا ﺖﻛﺮﺷ ﺐﻃ ﻦﺗدﺎﭘ ﻪﻛ ﻞﻣﺎﺷ : ،ﻢﻴﭙﻴﻔﺳ،ﻦﻴﺴﻳﺎﻣوﺮﺘﻳرا ،نﻮﺴﻛﺎﻳﺮﺘﻔﺳ لوزﺎﺴﻛﻮﺘﻣﺎﻔﻟﻮﺳ ﻲﺴﻛﻮﻣآو ﺪﻳدﺮﮔمﺎﺠﻧا،دﻮﺑﻦﻴﻠﻴﺳ . جاﺮﺨﺘﺳا DNA يﺮﺘﻛﺎﺑزا ﺎﻫ جاﺮﺨﺘﺳا ياﺮﺑ DNA ﻦﻳا رد ﻫوﮋﭘ ﺰﻴﻟ شور زا NaOH ﻢﻴﻧ ﺪﻳدﺮﮔ هدﺎﻔﺘﺳا لﺎﻣﺮﻧ ؛ ﻦﻳﺪﺑ ترﻮﺻ هﺮﻴﺧذ زا اﺪﺘﺑا ﻪﻛ ﺎﻳرﻮﻟ ﺖﺸﻛ ﻂﻴﺤﻣ رد دﺎﻤﺠﻧاﺖﻟﺎﺣ زا جوﺮﺧ زاﺲﭘ ﻲﻳﺎﻳﺮﺘﻛﺎﺑ -ﻲﻧﺎﺗﺮﺑ ﻪﺑثاﺮﺑ تﺪﻣ 24 -18 ﺪﺷهدادﺖﺸﻛﺖﻋﺎﺳ . ﺲﭙﺳ ، زا ﻂﻴﺤﻣ ﺖﺸﻛ هﺪﺷ بﺎﺨﺘﻧا ﻲﻧﻮﻠﻛﻚﻳ بﻮﻴﺗوﺮﻜﻴﻣ ﻪﺑ و يﺎﻫ 700 وﺮﻜﻴﻣ -يوﺎﺣيﺮﺘﻴﻟ 25 ﺘﻴﻟوﺮﻜﻴﻣ NaOH ﻢﻴﻧ ﻪﺑاﺮﻴﺷﺎﺗﺪﻳدﺮﮔﻪﻓﺎﺿالﺎﻣﺮﻧ ددﺮﮔﻪﻴﻬﺗ . ﺖﺷﺬﮔزاﺲﭘ 30 -20 ،ﻪﻘﻴﻗد 25 ﺲﻳﺮﺗلﻮﻠﺤﻣﺮﺘﻴﻟوﺮﻜﻴﻣ 1 ﻂﺳﻮﺗيﺮﺘﻛﺎﺑﻢﻀﻫﻞﻤﻋﺎﺗ ﺪﻳدﺮﮔﻪﻓﺎﺿا قﻮﻓ لﻮﻠﺤﻣﻪﺑ رﻻﻮﻣ NaOH ﺎﺑ لﻮﻠﺤﻣ و ددﺮﮔ ﻒﻗﻮﺘﻣ pH ﻲﻳﺎﻬﻧ 5 / 7 دﻮﺷ ﻪﻴﻬﺗ . ندوﺰﻓاﺎﺑﻪﻠﺻﺎﻓﻼﺑ 450 ﻢﺠﺣ،ﻞﻳﺮﺘﺳاﺮﻄﻘﻣبآﺮﺘﻴﻟوﺮﻜﻴﻣ ﻪﺑلﻮﻠﺤﻣ 500 هرﺎﺼﻋزاﻲﻳﺎﻬﻧﺖﻗروهﺪﻴﺳر ﺮﺘﻴﻟوﺮﻜﻴﻣ DNA مﺎﺠﻧاﺖﻬﺟ ﺶﻳﺎﻣزآ PCR ﺪﻳدﺮﮔهدﺎﻣآ . ﺎﻫﺮﮔزﺎﻏآ ) ﺎﻫﺮﻤﻳاﺮﭘ ( ﻲﺳﺎﺳايﺪﻴﺗﻮﺌﻠﻛﻮﻧﻮﮕﻴﻟاﺮﻤﻳاﺮﭘ نﺎﻣﺪﻧارﺮﺑﺮﺛﻮﻣﻞﻣﺎﻋﻦﻳﺮﺗ ﻲﺻﺎﺼﺘﺧا و ﺶﻨﻛاو نﺪﺷ PCR ﻲﻣ ﺪﺷﺎﺑ . ﺮﻤﻳاﺮﭘ ﻖﻴﻗد ﻲﺣاﺮﻃ ياﺮﺑ درﻮﻣ تﻻﻮﺼﺤﻣ ندروآ ﺖﺳد ﻘﻣ رد ﺮﻈﻧ و بﻮﻠﻄﻣ ﺮﻳدﺎ ﻲﻟاﻮﺗﺮﻴﺜﻜﺗزايﺮﻴﮔﻮﻠﺟ ﺖﺳايروﺮﺿﻲﺻﺎﺼﺘﺧاﺮﻴﻏيﺎﻫ . ﻻﻮﻤﻌﻣ M 1 -1 / 0 زﺎﻴﻧدرﻮﻣﺶﻨﻛاوﺮﻫردﺮﻤﻳاﺮﭘ ﺖﺳا ) هرﺎﻤﺷلوﺪﺟ 2 .( لوﺪﺟ هرﺎﻤﺷ 2 -ﻪﻳﻮﺳوﺎﻫﺮﻤﻳاﺮﭘ ﻪﺑدراﺪﻧﺎﺘﺳايﺎﻫ ردﻪﺘﻓررﺎﻛ PCR نژ يﺎﻫ ﻪﻌﻟﺎﻄﻣدرﻮﻣ ] 7 [ ﺲﻧﺎﻜﺳ ﺮﻤﻳاﺮﭘ ) زا ' 5 ﻪﺑ ' 3 ( ﺮﻤﻳاﺮﭘ F:TGCCTACAAGCATGAAATGG / R:AAACTGGACCACGGTACAA InvE/A (500 bp) F:GTGGGCGGTACAATATTTCTTTT / R:TCACGAATAATAATCAGTAGCGC ttrC (920 bp) F:TGACTATCAATGCTCCAGTGAAT / R:ATTTACTGGCCGCTATGCTGTTG mgtC (655 bp) F:GAATAGAAGACAAAGCGATCATC / R:GCTTTGTCCACGCCTTTCATC spi4R (1269 bp) F:TCCGGCCCGGACTCAACG / R:CAGCGCGGCGTTATACCG agfA (261 bp) تﻻﻮﺼﺤﻣﺰﻴﻟﺎﻧآوزرﻮﻓوﺮﺘﻜﻟا PCR نﻮﻜﻴﻠﭙﻣآ ﺎﻫ هدروآﺮﻓﺎﻳ ﺶﻨﻛاوزاﻞﺻﺎﺣيﺎﻫ PCR ﻞﻣﺎﺷ، نﻮﻴﻠﻴﻣ زاﻪﻌﻄﻗﺎﻫ DNA فﺪﻫدرﻮﻣ ﺖﺳا ﻪﺑﻪﻛ ﺪﺟاوﻲﻌﻴﺒﻃ رﻮﻃ ﻲﻣﺮﻤﻳاﺮﭘودﻦﻴﺑﻪﻴﺣﺎﻧردﻲﺼﺨﺸﻣ لﻮﻃ ﺪﺷﺎﺑ . شورزاﻲﻜﻳ يﺎﻫ تﻻﻮﺼﺤﻣﻲﻳﺎﺳﺎﻨﺷ PCR رﺎﮔآلژيورزرﻮﻓوﺮﺘﻜﻟا و ﺖﺳاز ] 6 .[ ﺘﻧ ﺞﻳﺎ ﻪﻧﻮﻤﻧندادﺖﺸﻛ زاﺪﻌﺑ ﻊﻤﺟ يﺎﻫ ﺖﻳﺎﻬﻧرد،هﺪﺷ يروآ ﻪﻧﻮﻤﻧ يﺎﻫ نﻮﻣزآسﺎﺳاﺮﺑﻼﻧﻮﻤﻟﺎﺳيﺮﺘﻛﺎﺑﻪﺑهدﻮﻟآ ﻲﻳﺎﻴﻤﻴﺷﻮﻴﺑيﺎﻫ ﺪﻳدﺮﮔيزﺎﺳاﺪﺟ . ﺖﺸﻛزاﺲﭘ ﻪﺑﻪﻴﻟوايﺎﻫ ﺖﻗدندﺮﺑﻻﺎﺑرﻮﻈﻨﻣ ﺖﺴﺗزا هدﺎﻔﺘﺳاﻲﻳﺎﻴﻤﻴﺷﻮﻴﺑيﺎﻫ ﺪﺷ ﺖﺴﺗﻪﻛ يﺎﻫ درﻮﻣﻲﻳﺎﻴﻤﻴﺷﻮﻴﺑ ﺎﻣ هدﺎﻔﺘﺳا ﻞﻣﺎﺷ تاﺮﺘﻴﺳ ﺖﺴﺗ ، TSI ﺖﺴﺗ، MR/VP ، SIM و ، هروا دﻮﺑ ﺪﻧ ) هرﺎﻤﺷ لوﺪﺟ 1 .( ﺐﻠﻏا هﺎﮕﺸﻳﺎﻣزآ ﺎﻫ ياﺮﺑ ﻦﻴﻴﻌﺗ ﺖﻴﺳﺎﺴﺣ ﻲﺘﻧآ ﻲﻜﻴﺗﻮﻴﺑ زا شور ﻚﺴﻳد نژﻮﻴﻔﻳد سﺎﺳاﺮﺑ دراﺪﻧﺎﺘﺳا NCCLS هدﺎﻔﺘﺳا ﻲﻣ ﺪﻨﻨﻛ . دﺎﺠﻳاﻪﻟﻮﻘﻣﺖﻴﻤﻫاﻪﺑﻪﺟﻮﺗﺎﺑ،ﻦﻴﻨﭽﻤﻫ ﻪﻳاﺪﺟ ﻪﻌﻟﺎﻄﻣ ﻦﻳا رد ،ﻲﻳوراد ﺖﻣوﺎﻘﻣ راد ﺖﻣوﺎﻘﻣ ﺮﻈﻧ زا ﺎﻫ ﻲﻳو ﻪﺑنآﺞﻳﺎﺘﻧﻪﻛﻪﺘﻓﺮﮔراﺮﻗﻲﺳرﺮﺑدرﻮﻣ ﺖﺳاﺮﻳزحﺮﺷ : عﻮﻤﺠﻣزا 60 ﭻﻴﻫ ،ﻼﻧﻮﻤﻟﺎﺳ ﻪﻧﻮﻤﻧ ،ﺪﻧدﻮﺒﻧ موﺎﻘﻣ نﻮﺴﻛﺎﻳﺮﺘﻔﺳ و ﻢﻴﭙﻔﺳ ﻪﺑ ماﺪﻛ 8 / 38 ﻲﺴﻛﻮﻣآ ﻪﺑ ﺎﻬﻧآ ﺪﺻرد ،ﻦﻴﻠﻴﺳ 53 و ﻦﻴﺴﻳﺎﻣوﺮﺘﻳرا ﻪﺑ ﺪﺻرد 3 / 38 ﺎﻔﻟﻮﺳﻪﺑﺪﺻرد ﺪﻧدادنﺎﺸﻧﺖﻣوﺎﻘﻣلوزﺎﺴﻛﻮﺘﻣ ) هرﺎﻤﺷلوﺪﺟ 3 .( اهزوﺮﻣا ﻲﺘﻧآﺖﻣوﺎﻘﻣﻪﺑﺶﻳاﺰﻓ ﻚﻴﺗﻮﻴﺑ يﺮﺘﻛﺎﺑردﺎﻫ ﻞﻀﻌﻣﻚﻳﺎﻫ ﻲﺑ فﺮﺼﻣﺮﺛا رد ﻪﻛ ﺖﺳا ﻲﻧﺎﻬﺟ قﺎﻔﺗا ﺎﻫوراد نوﺰﻓازورو ﻪﻳور ﺖﺴﻴﻧﻲﻨﺜﺘﺴﻣ هﺪﻋﺎﻗ ﻦﻳا زا ﻢﻫ ﺎﻣ رﻮﺸﻛ ﻪﻧﺎﻔﺳﺎﺘﻣ و هدﺎﺘﻓا . ﻪﺠﻴﺘﻧ ﺶﻳﺎﻣزآ PCR ﻲﻳﺎﺳﺎﻨﺷ ﺖﻬﺟ ﻪﻧﺎﮔﺪﻨﭼ نژ يﺎﻫ mgtC ، spi4R ، agfA ، invE/A و ttrC دادنﺎﺸﻧ ﻪﻛ ﺎﻤﺗ ﻪﻧﻮﻤﻧ م نژياراد ﺎﻫ يﺎﻫ mgtC و ttrC و هدﻮﺑ نژ spi4R ﭻﻴﻫ رد ﻪﻟوﺰﻳا زاماﺪﻛ ﺖﻓﺎﻳ ﺎﻫ ﺪﺸﻧ ) ﻞﻜﺷ يﺎﻫ هرﺎﻤﺷ 1 و 2 .( هرﺎﻤﺷلوﺪﺟ 3 -نژﻮﻴﻔﻳدﻚﺴﻳدﺞﻳﺎﺘﻧ ﻪﻧﻮﻤﻧداﺪﻌﺗﺐﺴﺣﺮﺑ ) R: resistance ، S: sensitive و I: intermediate ( ﻲﺘﻧآ ﻚﻴﺗﻮﻴﺑ ﺎﻫ Mm ) S ( سﺎﺴﺣ ﻪﻤﻴﻧ ) I ( Mm ) R ( ﻦﻴﺴﻳﺎﻣوﺮﺘﻳرا 28 0 32 لوزﺎﺴﻛﻮﺘﻣﺎﻔﻟﻮﺳ 50 0 10 ﻲﺴﻛﻮﻣآ ﻦﻴﻠﻴﺳ 37 0 23 ﻢﻴﭙﻔﺳ 60 0 0 نﻮﺴﻛﺎﻳﺮﺘﻔﺳ 52 8 0

(5)

ﻲﻗاﺮﻋﻲﺳﺪﻗا داﮋﻧ و ﻲﻨﻴﻣا   هﺎﻣود ﺾﻴﻓﻪﻣﺎﻧ | يدورذآ | 1396 | هرود 21 | هرﺎﻤﺷ 5 446   هرﺎﻤﺷﻞﻜﺷ 1 -ﺞﻳﺎﺘﻧ PCR ﻪﻧﺎﮔﺪﻨﭼ ﺖﺳارﻪﺑﭗﭼزالژيور : ﺮﻛرﺎﻣ ) 100 bp ( ﻪﻧﻮﻤﻧ،ﻲﻔﻨﻣلﺮﺘﻨﻛ،ﺖﺒﺜﻣلﺮﺘﻨﻛ، يﺎﻫ 36 -25 نژيوﺎﺣ ttrC و mgtC و invA ﻪﻧﻮﻤﻧ 27 ياراد نژ agfA ﻲﻣ ﺪﻨﺷﺎﺑ . هرﺎﻤﺷﻞﻜﺷ 2 -ﺞﻳﺎﺘﻧ PCR ﻪﻧﺎﮔﺪﻨﭼ ﺖﺳارﻪﺑﭗﭼزالژيور : ﺮﻛرﺎﻣ ) 100 bp ( ﻪﻧﻮﻤﻧ،ﻲﻔﻨﻣلﺮﺘﻨﻛ،ﺖﺒﺜﻣلﺮﺘﻨﻛ، يﺎﻫ 60 -49 نژيوﺎﺣ ttrC و mgtC و invA ﻪﻧﻮﻤﻧو يﺎﻫ 52 و 53 و 60 نژياراد agfA ﻲﻣ ﺪﻨﺷﺎﺑ . ﺚﺤﺑ ﻢﻬﻣزاﻲﻜﻳزﻮﻠﻧﻮﻤﻟﺎﺳ يرﺎﻤﻴﺑ ﻦﻳﺮﺗ ﻲﻧﻮﻔﻋيﺎﻫ ﻪﻛﺖﺳا ادﻲﻧﺎﻬﺟشﺮﺘﺴﮔ ﻪﺘﺷ و ﻪﻧﻮﮔونﺎﺴﻧارد ﻪﺑتﺎﻧاﻮﻴﺣﻒﻠﺘﺨﻣيﺎﻫ -يرﺎﻤﻴﺑترﻮﺻ ﻲﻣﺮﻫﺎﻇﻲﺗوﺎﻔﺘﻣ يﺎﻫ ددﺮﮔ . ﻦﻳاﻊﻳﺎﺷ راووﺮﺳود نﺎﺴﻧا و تﺎﻧاﻮﻴﺣ رد يﺮﺘﻛﺎﺑ ﺲﻳﺪﻴﺘﻳﺮﺘﻧا ﻼﻧﻮﻤﻟﺎﺳ و ﻲﻔﻴﺗ مﻮﻳرﻮﻣ ﻲﻣ ﺪﺷﺎﺑ ] 6 .[ Morshed لﺎﺳ رد نارﺎﻜﻤﻫ و 2011 ﻦﻳﺮﺗﻻﺎﺑ ﻪﻳاﺪﺟﺖﻣوﺎﻘﻣ ﺖﺒﺴﻧارﺎﻫ ﻲﭙﻣآﻪﺑ ﻲﺴﻛﻮﻣآ،ﻦﻴﻠﻴﺳ ﻮﻔﻟﻮﺳووﻼﻛ -دﺮﻛشراﺰﮔ ﻞﻜﻴﻨﻔﻣاﺮﻠﻛو ﻦﻴﻠﻜﻳﺎﺳاﺮﺘﺗ ،لوزﺎﺴﻛﻮﺘﻣ ها ﺪﻧ . ﻦﻳﺮﺘﺸﻴﺑ ﻦﻳاﺞﻳﺎﺘﻧﺎﺑﻪﻛ هﺪﺷشراﺰﮔلوزﺎﺴﻛﻮﺘﻣﻮﻔﻟﻮﺳ ﻪﺑﺖﺒﺴﻧ ﺖﻣوﺎﻘﻣ دراﺪﻧ ﺖﻘﺑﺎﻄﻣ ﻖﻴﻘﺤﺗ . ﻲﻣ فﻼﺘﺧا ﻦﻳا ﻞﻳﻻد ردتوﺎﻔﺗ ﻪﺑ ﺪﻧاﻮﺗ ﻪﻳﻮﺳ عﻮﻧ ﺎﻫ ، ﻪﻧﻮﻤﻧنﺎﻣز ﺳﻼﭘ عﻮﻴﺷ ناﺰﻴﻣ ويﺮﻴﮔ يوﺎﺣ يﺎﻫﺪﻴﻤ نژ ﻲﺘﻧآﺖﻣوﺎﻘﻣيﺎﻫ ﺪﺷﺎﺑﻂﺒﺗﺮﻣﻲﻜﻴﺗﻮﻴﺑ ] 8 .[ Ross و ﺎﺑنارﺎﻜﻤﻫ شورمﺎﺠﻧا PCR ﻪﻟوﺰﻳايور يﺎﻫ ﻲﻔﻴﺗﻼﻧﻮﻤﻟﺎﺳ مﻮﻳرﻮﻣ هﺪﺷاﺪﺟ لﺎﺳ ﻲﻃ يﺎﻫ 2000 ﺎﺗ 2001 و 2005 ﺎﺗ 2006 ﻪﭽﺑ زا كﻮﺧ يﺎﻫ ﻪﻟوﺰﻳاﻪﻤﻫﻪﻛﺪﻧدادنﺎﺸﻧلﺎﻬﺳاياراد نژيارادﺎﻫ invA هدﻮﺑ و ﻂﻘﻓ 14 ﺻرد ﻪﻟوﺰﻳازاﺪ نژيارادﺎﻫ ttrC ﻲﻣ ﺪﻨﺷﺎﺑ ] 9 [. تﺎﺸﻳﺎﻣزآ PCR ﻪﻧﻮﻤﻧ رد ﺎﻫﻼﻧﻮﻤﻟﺎﺳ ﻊﻳﺮﺳ ﺺﻴﺨﺸﺗ ﺖﻬﺟ ﻲﻋﻮﻨﺘﻣ يﺎﻫ ﺖﺳاهﺪﺷهدﺎﻔﺘﺳاﻲﻳاﺬﻏداﻮﻣوﻲﻨﻴﻟﺎﺑ . شورﻦﻳاﺐﻠﻏارد ﻞﺒﻗﺎﻫ مﺎﺠﻧازا PCR ﻠﺣﺮﻣﻚﻳ ﻲﻨﻏ ﻪﺑيزﺎﺳ ﺖﻴﺳﺎﺴﺣ ندﺮﺑﻻﺎﺑرﻮﻈﻨﻣ ﺖﺳا هﺪﻳدﺮﮔ دﺎﻬﻨﺸﻴﭘ ﺶﻳﺎﻣزآ . ﭗﻳﺎﺗوﺮﺳ ﻼﻧﻮﻤﻟﺎﺳ يﺎ زا ﻪﻠﻤﺟ وﺮﺳ ﭗﻳﺎﺗ ﺲﻴﺘﻨﻔﻨﻳا ﺞﻳارءﺰﺟ ﻦﻳﺮﺗ ﭗﻳﺎﺗوﺮﺳ ﺎﻫ رد ﺮﺜﻛا طﺎﻘﻧ نﺎﻬﺟ زا ﻪﻠﻤﺟ ﺖﺳاناﺮﻳا . ﻦﻳا ﭗﻳﺎﺗوﺮﺳ ﻲﻃ نﺎﻣز رﺎﭼد تاﺮﻴﻴﻐﺗ ﻲﻜﻴﺘﻧژ هﺪﺷ و ﺮﻈﻧزا ﻲﻳﺎﻴﻓاﺮﻐﺟ رد ﻖﻃﺎﻨﻣ ﻒﻠﺘﺨﻣ ياراد ﻲﮔﮋﻳو ﻮﻧژيﺎﻫ -ﻲﭙﻴﺗ توﺎﻔﺘﻣ ﻲﻣ ﺪﺷﺎﺑ . ﻦﻳاﺮﺑﺎﻨﺑ ، ﭗﻳﺎﺗوﺮﺳ ﻦﻳا ﻖﻴﻗد ﮓﻨﻴﭙﻳﺎﺗﻮﻧژ ، ﻮﻴﻣﺪﻴﭘادرﻮﻣرديدﺎﻳزتﺎﻋﻼﻃا ﺖﻧﻮﻔﻋ ﻊﺑﺎﻨﻣﻲﻳﺎﺳﺎﻨﺷويژﻮﻟ نآ رد رﺎﻴﺘﺧا راﺮﻗ ﻲﻣ ﺪﻫد ] 9 .[ ﻦﻴﻘﻘﺤﻣ ﻧﺎﺘﺳرﺎﺠﻣ رد لﺎﺳ 2008 داﺪﻌﺗ 14 ﻪﻳﻮﺳ ﻼﻧﻮﻤﻟﺎﺳ ﺲﻴﺘﻨﻔﻨﻳا زا ﻪﻧﻮﻤﻧ يﺎﻫ عﻮﻓﺪﻣ نﺎﺴﻧا و 182 ﻪﻳﻮﺳ زا ﻪﻧﻮﻤﻧ يﺎﻫ ﻪﺟﻮﺟعﻮﻓﺪﻣ ﺎﻫ اﺪﺟ ﺪﻧدﺮﻛ و رد ﻦﻳا ﻪﻌﻟﺎﻄﻣ ﺰﻴﻧ ﭗﻳﺎﺗوﺮﺳ ﻦﻳا زا ﻲﻧاواﺮﻓ يﺮﺘﺸﻴﺑ رادرﻮﺧﺮﺑ دﻮﺑ . ناﺰﻴﻣ ﻦﻳﺮﺘﺸﻴﺑ ﺰﻴﻧ ﻲﻳوراد ﺖﻣوﺎﻘﻣ ﻲﺘﻧآ ﻪﺑ طﻮﺑﺮﻣ ﻚﻴﺗﻮﻴﺑ ،ﻦﻴﺴﻳﺎﻣﻮﺘﭘﺮﺘﺳا يﺎﻫ ارﻮﻓ وز ﻮﻠﻓ،ﻦﻴﺘﻜﭙﻳاﻮﻜﻨﻴﻟ ،ﻦﻴﻠﻜﻳﺎﺳاﺮﺘﺗ ،ﺪﻴﺳا ﻚﻴﺴﻜﻳﺪﻴﻟﺎﻧ،نوﺪﻴﻟ -ﻦﻴﺋﻮﻜﻣ يﺮﺗ لوزﺎﺴﻛﻮﺘﻣﺎﻔﻟﻮﺳ و دﻮﺑ ﻢﻳﺮﭘﻮﺘﻣ ] 10 .[ ﻲﻳاﺮﻫز و نارﺎﻜﻤﻫ ) 1382 ( ﺎﺑ زا هدﺎﻔﺘﺳا PCR هدﺎ ﻲﺳرﺮﺑ ﻪﺑ نژ رﻮﻀﺣ spi4D ﭗﻴﺗوﺮﺳرد ﺘﺧادﺮﭘﻼﻧﻮﻤﻟﺎﺳتوﺎﻔﺘﻣيﺎﻫ ناﻮﻨﻋو ﻧدﺮﻛ

(6)

ﻲﻣ نژ ﻦﻳا زا ﻪﻛ ﻪﻳﻮﺳ ﻲﻳﺎﺳﺎﻨﺷ رد ناﻮﺗ ﻼﻧﻮﻤﻟﺎﺳ ﻒﻠﺘﺨﻣ يﺎﻫ هدﺎﻔﺘﺳا ﺮﻛ د ] 11 .[ ﺎﻣا ﺎﻣﻖﻴﻘﺤﺗﻪﺠﻴﺘﻧ ﻪﺑﻪﺟﻮﺗﺎﺑ رﻮﻛﺬﻣنژ ﻲﻤﻧ -ﻦﻳا ﺺﻴﺨﺸﺗ ﺖﻬﺟ ﺐﺳﺎﻨﻣ ﻲﮔﮋﻳو و ﺖﻴﺳﺎﺴﺣ ياراد ﺪﻧاﻮﺗ ﺪﺷﺎﺑ يﺮﺘﻛﺎﺑ . ﻦﻴﻘﻘﺤ هدوﺰﻓا ﺎﺑ يزﺎﺳ PCR نژ InvA رد 60 ،ﻼﻧﻮﻤﻟﺎﺳﻪﻳاﺪﺟ ﻪﻌﻄﻗرﻮﻀﺣ bp 284 ﻦﻳا ﻪﻳاﺪﺟمﺎﻤﺗردارنژ ﺎﻫ زا ﺮﺘﻤﻛ ﻪﻛارشور ﻦﻳا زاهدﺎﻔﺘﺳا و ﺪﻧدادراﺮﻗ ﺪﻴﻳﺄﺗدرﻮﻣ 12 درادزﺎﻴﻧ نﺎﻣزﺖﻋﺎﺳ ، ﻪﻴﺻﻮﺗﻼﻧﻮﻤﻟﺎﺳﺲﻨﺟﺺﻴﺨﺸﺗﺖﻬﺟرد ﺪﻧدﻮﻤﻧ . ،ﻦﻴﻨﭽﻤﻫ تﺎﻌﻟﺎﻄﻣ ﺮﮕﻳد رد هدوﺰﻓا ﺎﺑ يزﺎﺳ PCR نژ OmpC رد 200 ناﺮﻳاﻒﻠﺘﺨﻣطﺎﻘﻧزاهﺪﺷﺬﺧاوﺎﮔعﻮﻓﺪﻣﻪﻧﻮﻤﻧ ﺰﻴﻧو 25 ﻨﻴﻠﻛﻪﻳاﺪﺟ ،ﻼﻧﻮﻤﻟﺎﺳﻲﻜ رد 7 ﻪﻧﻮﻤﻧزادرﻮﻣ عﻮﻓﺪﻣيﺎﻫ ﻪﻤﻫ و 25 ﻪﻳاﺪﺟ يﺎﻫ ﻪﻌﻄﻗ رﻮﻀﺣ،ﻼﻧﻮﻤﻟﺎﺳﻲﻨﻴﻟﺎﺑ bp 159 ﻦﻳا ﺪﻴﺋﺄﺗ نژ ﺪﺷ ه نژ ﻦﻴﻴﻌﺗو OmpC شور ﺎﺑ PCR ﻪﺑ ﻲﻨﻏلﺎﺒﻧد -ﻣ يزﺎﺳ ﻪﻧﻮﻤﻧردﻼﻧﻮﻤﻟﺎﺳ يﻮﺠﺘﺴﺟﺖﻬﺟ ﻲﺒﺳﺎﻨﻣ شورعﻮﻓﺪ -داد نﺎﺸﻧ عﻮﻓﺪﻣ يﺎﻫ ﺖﺳا هﺪﺷ ه ] 2 ، 3 ، 11 [. رد ﺮﺼﻣ ﻲﻃ لﺎﺳ 2009 زا عﻮﻤﺠﻣ 141 ﻪﻟوﺰﻳا ﻼﻧﻮﻤﻟﺎﺳ هﺪﺷاﺪﺟ زا ﻪﻧﻮﻤﻧ يﺎﻫ داﻮﻣ ﻲﻳاﺬﻏ 81 ﻪﻟوﺰﻳا طﻮﺑﺮﻣ ﻪﺑ ﻼﻧﻮﻤﻟﺎﺳ ﺲﻴﺘﻨﻔﻨﻳا دﻮﺑ ﻪﻛ ﺖﺒﺴﻧ ﻪﺑ ﺮﻳﺎﺳ ﭗﻴﺗوﺮﺳ يﺎﻫ ﻼﻧﻮﻤﻟﺎﺳ ﻦﻳﺮﺘﺸﻴﺑ دراﻮﻣ اﺪﺟ هﺪﺷ زا ﻪﻧﻮﻤﻧ يﺎﻫ داﻮﻣ ﻲﻳاﺬﻏ دﻮﺑ . ،ﻦﻴﻨﭽﻤﻫ رد لﺎﺳ 2003 رد ،ﻦﻴﺘﻧاژرآ ﻼﻧﻮﻤﻟﺎﺳ ﺎﻜﻳﺮﺘﻧا راووﺮﺳ ﺲﻴﺘﻨﻔﻨﻳا ﻦﻴﻣود ﻞﻣﺎﻋ ﻊﻳﺎﺷ نﺎﻴﻣرد ﭗﻴﺗوﺮﺳ يﺎﻫ ﻼﻧﻮﻤﻟﺎﺳ رد نﺎﻴﻣ نﺎﻛدﻮﻛ هﺪﺷيﺮﺘﺴﺑ رد نﺎﺘﺳرﺎﻤﻴﺑ دﻮﺑ ﺖﺳاه ] 12 [. ﻚﻳرد ﭗﻴﺗوﺮﺳ يﻮﺠﺘﺴﺟ ﻪﺑﻪﻛ ﻪﻌﻟﺎﻄﻣ ﺲﻴﺘﻨﻔﻨﻳا ﻼﻧﻮﻤﻟﺎﺳ ﺎﺑ دﺎﻔﺘﺳا زاه PCR ﻪﻳاﺪﺟﻦﻴﺑ رد هوﺮﮔيﺎﻫ C يﻮﮕﻟاﻦﻴﻴﻌﺗو رﻮﻴﻃ ﻼﻧﻮﻤﻟﺎﺳ ﻪﻳاﺪﺟ ﻲﻳوراد ﺖﻣوﺎﻘﻣ ﺘﺧادﺮﭘ ﺎﻫ ،ﺖﺳا ﻪﻳاﺪﺟ ﻪﻤﻫ ﻪﺑ ﺖﺒﺴﻧ ﺎﻫ ﻲﺘﻧآ ﻚﻴﺗﻮﻴﺑ ﺎﺴﻛﻮﻠﻓﻮﻧاد و ﻞﻜﻴﻨﻓرﻮﻠﻓ يﺎﻫ و هدﻮﺑ سﺎﺴﺣ ﻦﻴﺳ ﻲﺘﻧآﻪﺑﻲﻳورادﺖﻣوﺎﻘﻣﻦﻳﺮﺘﻤﻛ ﻚﻴﺗﻮﻴﺑ ﺎﺘﻔﺳ،ﻦﻴﺳﺎﺴﻛﻮﻠﻓوﻮﻟيﺎﻫ -ﻓرﻮﻧ و نﻮﺴﻛﺎﻳﺮﺘﻔﺳ ،ﻢﻳﺪﻳز ﻲﻣطﻮﺑﺮﻣﻦﻴﺳﺎﺴﻛﻮﻠ ﺪﺷ ه ﺞﻳﺎﺘﻧﺎﺑﻪﻛ ﻪﺑ ردهﺪﻣآﺖﺳد ﻢﻫﺎﻣﻪﻌﻟﺎﻄﻣ درادﻲﻧاﻮﺧ ] 13 [. ناﺪﻨﻤﺸﻧاد ﻪﺑ رﻮﻈﻨﻣ ياﺮﺑ ﻊﻳﺮﺳ و ﻲﺻﺎﺼﺘﺧا شور ﻚﻳ ﻪﺋارا ﺎﺳﺎﻨﺷ ﻼﻧﻮﻤﻟﺎﺳ ﺲﻳﺪﻴﺘﻳﺮﺘﻧا ﭗﻴﺗوﺮﺳ ﺮﻳﺎﺳ و شور زا تﺪﺣ ﺪﻴﻤﺳﻼﭘ ﺪﺟاو يﺎﻫ PCR ﻪﻧﺎﮔﺪﻨﭼ نژﻪﺑطﻮﺑﺮﻣيﺎﻫﺮﮔزﺎﻏآزاهدﺎﻔﺘﺳاﺎﺑ يﺎﻫ spi4R و invA ﻪﺑﻪﻛ ﺐﻴﺗﺮﺗ تﺎﻌﻄﻗ 244 و bp 571 هدوﺰﻓاار يزﺎﺳ ﻲﻣ -ﺪﻨﻳﺎﻤﻧ ، دﺮﻛهدﺎﻔﺘﺳا ها ﺪﻧ . ﭗﻴﺗوﺮﺳشورﻦﻳارد ﺪﻴﻤﺳﻼﭘﺪﺟاويﺎﻫ ﺮﻴﻈﻧ تﺪﺣ ﻲﻔﻴﺗ ﻼﻧﻮﻤﻟﺎﺳ ،مﻮﻳرﻮﻣ ،ﺲﻳﺪﻴﺘﻳﺮﺘﻧاﻼﻧﻮﻤﻟﺎﺳ ﻼﻧﻮﻤﻟﺎﺳ اﺮﻠﻛ ،ﺲﻴﺋﻮﺳ ﻦﻴﻠﺑاد ﻼﻧﻮﻤﻟﺎﺳ و ﻲﺋاﺪﻨﺳ ﻼﻧﻮﻤﻟﺎﺳ و ﻪﻌﻄﻗ ود ﻼﻧﻮﻤﻟﺎﺳ ﻗﺎﻓ يﺎﻫ ﺪﻴﻤﺳﻼﭘ نژ ﻪﺑ طﻮﺑﺮﻣ ﻪﻌﻄﻗ ﻚﻳ ﺎﻬﻨﺗ تﺪﺣ invA ار ﺪﻧدﺮﻛﺺﺨﺸﻣ ] 14 [. ناﻮﻨﻋ ﺖﺳاهﺪﺷ ﺖﻧﻮﻔﻋردﻪﻛ يﺎﻫ ﻚﻴﻤﺘﺴﻴﺳ ﻼﻧﻮﻤﻟﺎﺳ ﻲﻔﻴﺗ مﻮﻳرﻮﻣ نژ تﺪﺣﺪﻴﻤﺳﻼﭘ ﺎﻳتﺪﺣ يﺎﻫ يﺮﺘﻛﺎﺑ ﺶﻳاﺰﻓا و ﺮﻴﺜﻜﺗ ﺚﻋﺎﺑ و لﺎﻴﻠﺗوﺪﻧاﻮﻠﻜﻴﺗر ﻢﺘﺴﻴﺳ رد ﺎﻫ ﺎﻫژﺎﻓوﺮﻛﺎﻣ و هﺪﺷ نژ فﺬﺣ يﺎﻫ ttrC ﺣناﺰﻴﻣ ﺶﻫﺎﻛﺚﻋﺎﺑ تﺪ ﻲﻣ ددﺮﮔ ] 15 [ . ،ﻦﻴﻨﭽﻤﻫ ﻪﺑ ﻪﻠﻴﺳو دﺎﺠﻳا ﺶﻬﺟ نژرد ﺲﻧﺎﻜﺳ يﺎﻫ ttrC ردتﺪﺣدﺎﺠﻳاﺖﻔﺻ ﻲﻔﻴﺗﻼﻧﻮﻤﻟﺎﺳ مﻮﻳرﻮﻣ ﺪﻴﺳرتﺎﺒﺛاﻪﺑ ه ﺖﺳا . ﺖﻤﺴﻗ BttrC ﻪﻛ دراد ارﻲﻳﺎﻧاﻮﺗ ﻦﻳا تﺪﺣ ﺪﻴﻤﺳﻼﭘ زا ﻚﻳ ﺪﻨﻧﺎﻤﻫ ttrC ﺖﺳد و ﻞﻣﺎﻛ ﺖﻧﻮﻔﻋ دﺎﺠﻳا ﺚﻋﺎﺑ هدرﻮﺨﻧ ﻪﺑﻚﻴﻤﺘﺴﻴﺳ ﻪﻄﺳاو ﻼﻧﻮﻤﻟﺎﺳ ﻲﻔﻴﺗ رﻮﻣ مﻮﻳ شﻮﻣرد يﺎﻫ BALB/C ددﺮﮔﻲﺘﺳﻮﭘﺮﻳزﻞﻜﺷﻪﺑﺖﻧﻮﻔﻋدﺎﺠﻳازاﺪﻌﺑ ] 16 ، 17 .[ ﻪﻌﻟﺎﻄﻣرد -ﻪﻛ يا Chiu نارﺎﻜﻤﻫ و ) 2002 ( ﻪﻳﻮﺳ يور هﺪﺷ اﺪﺟ يﺎﻫ ﻲﻔﻴﺗ ﻼﻧﻮﻤﻟﺎﺳ مﻮﻳرﻮﻣ و ﺲﻳﺪﻴﺘﻳﺮﺘﻧا ﺪﻧداد مﺎﺠﻧا ، ﻪﻛ ﺪﻧداد نﺎﺸﻧ PCR ﺪﻨﭼ ﻪﻧﺎﮔ ﻪﻟوﺰﻳا ﺖﺧﺎﻨﺷ رد ﺖﻣوﺎﻘﻣ ياراديﻼﻧﻮﻤﻟﺎﺳ يﺎﻫ ﻪﻧﺎﮔﺪﻨﭼ صﻮﺼﺧ ﻲﻔﻴﺗ ﻼﻧﻮﻤﻟﺎﺳ مﻮﻳرﻮﻣ عﻮﻧ ACSSUT و ﻪﻟوﺰﻳا ﻦﻴﺑ رد زﺎﻣﺎﺘﻛﻻﺎﺘﺑ نژ ﻊﻳزﻮﺗ ﻲﻳﺎﺳﺎﻨﺷ رد ﻦﻴﻨﭽﻤﻫ يﺎﻫ ﺖﺳا ﺪﻨﻣدﻮﺳ رﺎﻴﺴﺑﻼﻧﻮﻤﻟﺎﺳ . ﺮﻤﻳاﺮﭘ ﺖﻔﺟﻪﺳ زاشور ﻦﻳا رد نژﻪﺑطﻮﺑﺮﻣ ﻲﺘﻧآﺖﻣوﺎﻘﻣيﺎﻫ ﻲﻜﻴﺗﻮﻴﺑ cmlA/tetR ، blaPSE-1 و blaTEM نژ ﻪﺑ طﻮﺑﺮﻣﺮﻤﻳاﺮﭘ ﺖﻔﺟﻚﻳ و sipB/C ﻪﻛ نژ ﺖﺳاﻼﻧﻮﻤﻟﺎﺳﺲﻨﺟهﮋﻳو ، ﺪﻳدﺮﮔهدﺎﻔﺘﺳا ] 18 [. نﺎﻴﺑ ﺖﺳاهﺪﺷ ﻪﻛ رﻮﺘﻛﺎﻓﻂﻴﺤﻣوﻚﻴﺘﻧژ،ﻦﺳ يﺮﺘﻛﺎﺑتﺪﺣناﺰﻴﻣردﻲﻠﺻايﺎﻫ هدﻮﺑ و ﻪﺑتﺪﺣيﺎﻫرﻮﺘﻛﺎﻓﺎﻳوتﺪﺣيﺎﻫﺪﻴﻤﺳﻼﭘ ﻲﺘﻟﺎﺧدﻢﻴﻘﺘﺴﻣرﻮﻃ ﺪﻧراﺪﻧ يﺮﺘﻛﺎﺑ و نﺎﺑﺰﻴﻣ ﻦﻴﺑ ﺶﻨﻛاو رد ، نژ ﻦﻳا ﺐﻠﻏا ﺎﻣا ﺎﻫ ﻦﻴﺌﺗوﺮﭘ ﻲﻣ ﺪﻛارﻲﻳﺎﻫ يﺮﺘﻛﺎﺑ و نﺎﺑﺰﻴﻣﻦﻴﺑ ﺶﻨﻛاوردﻪﻛ ﺪﻨﻳﺎﻤ ﻤﻧﺖﻟﺎﺧد د ه ﻦﻴﺌﺗوﺮﭘﻦﻳا و ءﺎﻘﺑردﻲﻤﻬﻣ ﺶﻘﻧراﺬﮔﺮﻴﺛﺄﺗ يﺎﻫ و ﺪﻧراد ﻼﻧﻮﻤﻟﺎﺳﺮﻴﺜﻜﺗ ] 19 .[ Chashni ﺎﺑنارﺎﻜﻤﻫو مﺎﺠﻧا PCR ﻪﻧﺎﮔﺪﻨﭼ يور 1125 ﻪﺟﻮﺟ زاهﺪﺷ اﺪﺟﻪﻧﻮﻤﻧ نﺎﺸﻧ ﻲﮕﻧﺎﺧ يﺎﻫ ﻪﻛ ﺪﻧداد 5 / 55 ﻪﻧﻮﻤﻧ زا ﺪﺻرد ﺎﻫ ﻳﺮﺘﻧا ﻼﻧﻮﻤﻟﺎﺳ ﺲﻳﺪﻴﺘ و 2 / 22 ﺪﺻرد ﻼﻧﻮﻤﻟﺎﺳ ﻲﻔﻴﺗ مﻮﻳرﻮﻣ ﺘﺴﻫ ﺪﻨ . ﭗﻴﺗوﺮﺳ مﺎﻤﺗ يﺎﻫ ﻼﻧﻮﻤﻟﺎﺳ ﻲﻔﻴﺗ مﻮﻳرﻮﻣ نژ رﺎﻬﭼ ياﺮﺑ rfbj ) ﻦﮔدﺎﭘ O ( ، fliC ) ﻦﮔدﺎﭘ H1 ( ، fljB ) ﻦﮔدﺎﭘ H2 ( و invA ) ﻢﺟﺎﻬﺗ ( ﺪﻧدﻮﺑﺖﺒﺜﻣ . ﻦﻴﻨﭽﻤﻫ ، مﺎﻤﺗ ﭗﻴﺗوﺮﺳ يﺎﻫ ﺲﻳﺪﻴﺘﻳﺮﺘﻧا ﻼﻧﻮﻤﻟﺎﺳ نژ ياﺮﺑ يﺎﻫ spi و SefA ) ﻦﻴﺴﻛﻮﺗوﺮﺘﻧا ( ﺪﻧدﻮﺑ ﺖﺒﺜ . نﺎﺸﻳا و ﺖﻗد ﻪﻛ ﺪﻨﺘﻓﺮﮔ ﻪﺠﻴﺘﻧ شور ﺖﻴﺳﺎﺴﺣ رﻮﻛﺬ ﻦﻴﻴﻌﺗ ياﺮﺑ ﺪﻨﻤﺷزرا راﺰﺑاﻚﻳ ﻪﺑ ار نآ ﻪﻧﻮﮔ ﺖﺳاهدﺮﻛﻞﻳﺪﺒﺗﻼﻧﻮﻤﻟﺎﺳيﺎﻫ ] 20 .[ نارﺎﻜﻤﻫوﻲﻨﻴﻣا ﺰﻴﻧ زا شور PCR ﺑﻪﻧﺎﮔﺪﻨﭼ ﻢﻫﻲﻳﺎﺳﺎﻨﺷوﻦﻴﻴﻌﺗياﺮ نژنﺎﻣز يﺎﻫ inv A و ttrC و شورزا PCR نژﻦﻴﻴﻌﺗ ياﺮﺑ هدﺎﺳ يﺎﻫ mgtC و agfA رد ﺲﻳﺪﻴﺘﻳﺮﺘﻧاﻼﻧﻮﻤﻟﺎﺳ ﺪﻧدﺮﻛهدﺎﻔﺘﺳا . ﻪﻧﻮﻤﻧﺰﻴﻟﺎﻧآ نﺎﺸﻧﺎﻫ نژ ﻪﻛ داد يﺎﻫ ttrC و mgtC رد 90 زا ﺪﺻرد ﻼﻧﻮﻤﻟﺎﺳ سﺪﻴﺘﻳﺮﺘﻧا يﺎﻫ و ﻲﻧﺎﺴﻧاﻊﺑﺎﻨﻣزاهﺪﺷاﺪﺟ 100 ﻪﻧﻮﮔ ﺪﺻرد يﺎﻫ دراد دﻮﺟو يوﺎﮔ ﻊﺑﺎﻨﻣ زا هﺪﺷ اﺪﺟ ] 21 .[ ﻖﻴﻘﺤﺗ ﻪﺠﻴﺘﻧ ﻪﺴﻳﺎﻘﻣ ﺮﺿﺎﺣ ﻖﻴﻘﺤﺗ ﺎﺑ ﻲﻨﻴﻣا د ر نژ عﻮﻴﺷ ناﺰﻴﻣ ﺎﺑ طﺎﺒﺗرا يﺎﻫ ttrC mgtC و inv A نژ ﻦﻳا يﻻﺎﺑ عﻮﻴﺷ زا نﺎﺸﻧ ﻪﻧﻮﮔ رد ﺎﻫ يﺎﻫ ﺲﻴﺘﻨﻔﻨﻳاﻼﻧﻮﻤﻟﺎﺳ و ﺲﻳﺪﻴﺘﻳﺮﺘﻧا ﻲﻣ ﺪﺷﺎﺑ . زاﻞﺻﺎﺣﺞﻳﺎﺘﻧفﻼﺧﺮﺑ

(7)

ﻲﻗاﺮﻋﻲﺳﺪﻗا داﮋﻧ و ﻲﻨﻴﻣا   هﺎﻣود ﺾﻴﻓﻪﻣﺎﻧ | يدورذآ | 1396 | هرود 21 | هرﺎﻤﺷ 5 448   ﻦﻳا ﻪﻌﻟﺎﻄﻣ ، ﻲﺳرﺮﺑرد ﻲﻔﻴﺗﻼﻧﻮﻤﻟﺎﺳ مﻮﻳرﻮﻣ دﺎﻳزتوﺎﻔﺗزانﺎﺸﻧ نژ ﻲﻧاواﺮﻓﺪﺻرد رد يﺎﻫ inv A و ttrC رد ﻪﺴﻳﺎﻘﻣ ﺎﺑ ﻪﻧﻮﮔ يﺎﻫ ﻲﻔﻴﺗ مﻮﻳرﻮﻣ ﻲﻣﺲﻴﺘﻨﻔﻨﻳاو ﺪﺷﺎﺑ . ﻪﺠﻴﺘﻧ يﺮﻴﮔ نژدﻮﺟوﻪﺑﻪﺟﻮﺗﺎﺑ يﺎﻫ mgtC و ttrC رد ﻪﻤﻫ ﻪﻧﻮﻤﻧ ﺎﻫ يﺮﺘﻛﺎﺑمﺎﻤﺗﺖﻴﺳﺎﺴﺣو ﻲﺘﻧآﻪﺑﺎﻫ ﻲﻣرﻮﻃﻦﻳاﻢﻴﭙﻔﺳﻚﻴﺗﻮﻴﺑ ناﻮﺗ ﺖﻓﺮﮔ ﻪﺠﻴﺘﻧ ﻪﻛ رد ﺖﻳﺎﻬﻧ يوراد ﻪﺑ ﻢﻴﭙﻔﺳ يوراد ﻦﻳﺮﺘﻬﺑ ناﻮﻨﻋ ﻪﺑﻼﺘﺑانﺎﻣردياﺮﺑﻲﺑﺎﺨﺘﻧا ﻟﺎﺳ ﺲﻴﺘﻨﻔﻨﻳاﻼﻧﻮﻤ ﻲﻣ ﺪﺷﺎﺑ . وﻲﻳﺎﺳﺎﻨﺷ نژ ﺪﻴﻳﺎﺗ يﺮﺘﻛﺎﺑ رد ﺎﻫ ﻲﻣ ﻪﻘﻄﻨﻣ يﺎﻫ ﻮﻴﻣﺪﻴﭘا ﻲﺳرﺮﺑ رد ﺪﻧاﻮﺗ -ﺖﻣوﺎﻘﻣ ،ﻊﻴﺳو ﻲﻜﻳژﻮﻟ ﻲﺘﻧآ يﺎﻫ ناﺰﻴﻣ ،ﻦﺴﻛاو ﺪﻴﻟﻮﺗ ،ﻲﻜﻴﺗﻮﻴﺑ ﻪﺘﺷاد ﺶﻘﻧ نﺎﻣرد و يﺮﻴﮕﺸﻴﭘ ،تﺪﺣ ﻲﺳرﺮﺑ و نژ ﻦﻳا رد ﺎﻫ ﻪﻧﻮﻤﻧ ﻪﺑﺎﻫ رﺎﻴﺴﺑتﺪﺣﺺﺧﺎﺷﻞﻴﻟد ﺰﺋﺎﺣ ﺖﻴﻤﻫا ﻲﻣ ﺪﺷﺎﺑ . ﺸﺗ ﻲﻧادرﺪﻗوﺮﻜ ﺶﻫوﮋﭘﻦﻳامﺎﺠﻧاﻒﻠﺘﺨﻣﻞﺣاﺮﻣردﻪﻛﻲﻧاﺰﻳﺰﻋﻪﻴﻠﻛزا ﻪﺑ ار ﻲﻧادرﺪﻗ لﺎﻤﻛ ﺪﻧدﻮﻤﻧ يرﺎﻳ ار ﺎﻣ ﺐﺗاﺮﻣ و هدروآ ﻞﻤﻋ بوﺮﻜﻴﻣ هﺎﮕﺸﻳﺎﻣزآ مﺮﺘﺤﻣ لﻮﺌﺴﻣزا اردﻮﺧ ناواﺮﻓ يراﺰﮕﺳﺎﭙﺳ دﺎﮔرﺎﺳﺎﭘﻲﺗﺎﻘﻴﻘﺤﺗهﺎﮕﺸﻳﺎﻣزآوﻲﺳﺎﻨﺷ مﺪﻘﻣسﺪﻨﻬﻣيﺎﻗآبﺎﻨﺟ ، ﻲﻣمﻼﻋا راد ﻢﻳ . References:

[1] Wannaprasat W, Padungtod P, Chuanchuen R. Class 1 integrons and virulence genes in Salmonella enterica isolates from pork and humans. Int J Antimicrob Agents 2011; 37(5(: 457-61.

[2] Naghyly B, MoghadasPour, Majidpour A, Pahlevanzdeh H. Evaluation of different strains of Salmonella to antibiotics, infectious diseases, tropical Conference, Tehran, December database computer Congresses, Research Department of the Ministry of Health, Treatment Med Education 3rd

ed. 1990; 647-8. [in Persian]

[3] Madadgar Omid, molecular identification of Salmonella isolates to electrophoresis in alternating electric field, Dissertation in Microbiology. Tehran. Faculty of Vet Med University. 1998. [in Persian] [4] Hojati P, Isolation and identification of Salmonella poultry ERic-PCR and serological methods, Dissertation of Poultry Veterinary. Tehran. Science and Research Azad University. 1997. [in Persian]

[5] Hudson CR, Garcia M, Gast RK, Maurer JJ. Determination of close genetic relatedness of the major Salmonella enteritidis phage types by pulsed-field gel electrophoresis and DNA sequence analysis of several Salmonella virulence genes.

Avian Dis 2001; 45(4): 875-86.

[6] Mahon CR, Lehman DC, Manuselis G. Textbook of Diagnostic Microbiology-E-Book: Elsevier Health Sciences; 2014. P. 450-720

[7] Soto SM, Rodríguez I, Rodicio MR, Vila J, Mendoza MC. Detection of virulence determinants in clinical strains of Salmonella enterica serovar Enteritidis and mapping on macrorestriction profiles. J Med Microbiol 2006; 55(4): 365-73. [8] Morshed R, Peighambari SM. Salmonella infections in poultry flocks in the vicinity of Tehran. Iran J Vet Med 2010; 4(4): 273-6. [in

Persian]

[9] Ross IL, Heuzenroeder MW. A comparison of three molecular typing methods for the discrimination of Salmonella enterica serovar

Infantis. FEMS Immunol Med Microbiol 2008;

53(3): 375-84.

[10] Nógrády N, Kardos G, Bistyak A, Turcsányi I, Mészáros J, Galántai Z, et al. Prevalence and characterization of Salmonella infantis isolates originating from different points of the broiler chicken–human food chain in Hungary. Int J Food

Microbiol 2008; 127(1): 162-7.

[11] Zahraei Salehi MT, Study of the antigenic Salmonella typhimurium and use it to detect and track infections caused by this bacterium. Dissertation. Tehran University. 1995. [in Persian] [12] Ahmed A, Ishida Y, Shimamoto T. Molecular characterization of antimicrobial resistance in Salmonella isolated from animals in Japan. J Appl Microbiol 2009; 106(2): 402-9.

[13] Aviv G, Tsyba K, Steck N, Salmon‐Divon M, Cornelius A, Rahav G, et al. A unique megaplasmid contributes to stress tolerance and pathogenicity of an emergent Salmonella enterica serovar Infantis strain. Environ Microbiol 2014; 16(4): 977-94.

[14] Shanmugasamy M, Velayutham T, Rajeswar J. InvA gene specific PCR for detection of Salmonella from broilers. Vet World 2011; 4(12):

562-4.

[15] Matsui H, Kawakami T, Ishikawa S, Danbara H, Gulig PA. Constitutively Expressed phoP Inhibits Mouse‐Virulence of Salmonella typhimurium in an Spv‐Dependent Manner.

Microbiol Immunol 2000; 44(6): 447-54.

[16] Reed GH, Kent JO, Wittwer CT. High-resolution DNA melting analysis for simple and efficient molecular diagnostics. 2007. [17] Robbe-Saule V, Schaeffer F, Kowarz L, Norel F. Relationships between H-NS, σ S, SpvR and growth phase in the control of spvR, the regulatory gene of the Salmonella plasmid virulence operon.

Mol Gen Genet 1997; 256(4): 333-47.

[18] Chiu CH, Wu TL, Su LH, Chu C, Chia JH, Kuo AJ, et al. The emergence in Taiwan of fluoroquinolone resistance in Salmonella enterica

(8)

serotype Choleraesuis. N Engl J Med 2002; 346(6):

413-9.

[19] Asten AJ, Dijk JE. Distribution of “classic” virulence factors among Salmonella spp. Pathog Dis 2005; 44(3): 251-9.

[20] Chashni S, Hassanzadeh M, Fard M, Mirzaie S. Characterization of the Salmonella isolates from backyard chickens in north of Iran, by serotyping,

multiplex PCR and antibiotic resistance analysis.

Arch Razi Inst 2009; 64(2): 77-83.

[21] Amini K, Salehi TZ, Nikbakht G, Ranjbar R, Amini J, Ashrafganjooei SB. Molecular detection of invA and spv virulence genes in Salmonella enteritidis isolated from human and animals in Iran.

Afr J Microbiol Res 2010; 4(21): 2202-10.

Figure

Updating...

References

Related subjects :