Review: Breeding for Resistance to Sheath blight in rice

(1)

International Journal of Farming and Allied Sciences

Available online at www.ijfas.com

Review: Breeding for Resistance to Sheath blight in rice

Ali Sattari

¹

*, Baratali Fakheri

²

, M. Noroozi

³

and Kh. Moazami gudarzi

⁴

1. Phd. student of Dept. of Agronomy and Plant Breeding, Faculty of Agriculture, Zabol University 2. Associate Prof. in Plant Breeding, Dept. of Agronomy and Plant Breeding, Faculty of Agriculture, Zabol

University

3. Iranian Rice Research Institute, Deputy of Mazandaran, Amol, Iran

4. M.Sc. Dept. of Agronomy and Plant Breeding, Faculty of Agriculture, Karaj Azad University

Corresponding author: Ali Sattari

ABSTRACT: Sheath blight (ShB) disease, caused by Rhizoctonia solani, is an economically important rice disease worldwide, especially in intensive production systems. Several studies have been conducted to identify sources for ShB resistance in different species of rice, including local accessions and landraces.

It has been difficult to generate SB resistant rice varieties by relying on traditional breeding because resistance to rice SB is a typical quantitative trait. Pathogenesis related (PR) genes of rice are among the most important defense genes in the interaction of rice with pathogens. Rice diseases such as blast, bacterial blight and sheath blight are major obstacles for achieving optimal yields. To complement conventional breeding method, molecular or transgenic method represents an increasingly important approach for genetic improvement of disease resistance and reduction of pesticide usage. During the past two decades, a wide variety of genes and mechanisms involved in rice defense response have been identified and elucidated. However, most of the cloned genes confer high level of race specific resistance in a gene for gene manner, and the resistance is effective against one or a few related races or strains of the pathogens. The resistance is effective for only few years because the pathogen race or strain keeps changing for survival in nature. Therefore, there is an urgent need to broaden the rice gene pool from diverse resources, of which the wild rice is an ideal option.

Keywords: Rice (Oryza spp.), conventional breeding, Rhizoctonia solani, Sheath blight INTRODUCTION

Sheath blight (SB) is one of the most destructive rice diseases worldwide, and can lead to severe losses in rice productivity and grain quality by infecting and destroying rice sheath and leaves (Lee and Rush, 1983; Marchetti and Bollich, 1991). The causal agent of rice Sheat blight(SB) is Rhizoctonia solani Kühn, which is a necrotic fungus and has a broad host range (Srinivasachary, 2011). In addition to rice, R. solani can infect many more plant species, including major crops wheat, barley, and maize, and the model plant Medicago (Zhen, 2013). So far, no major resistance genes to rice SB have been identified (Jia, 2009; Zuo, 2010; Srinivasachary, 2011; Liu, 2013). marker- assisted selection (MAS) has been considered a feasible approach to developing SB resistant variety as many SB resistance (SBR) QTLs have been identified (Jia ., 2009; Zuo ., 2010; Eizenga ., 2013; Liu ., 2013). However, most of the identified QTLs lack further evidence for their reliability against SB, which largely limits their utilization in breeding practice (Pinson, 2005; Zuo, 2010; Liu, 2013). In plant response against necrotrophic pathogens, other pathways, mainly, jasmonic acid (JA) and ethylene pathways, are engaged (Bouarab, 2009). the defense mechanism to the necrotrophic fungus R. solani, is a combination of diverse defense responses (Zhao, 2008). Nonexpresser of pathogenesis related genes 1 (NPR-1) also known as NIM1 (non-inducible immunity) and SAI1 (salicylic acid

(2)

971 insensitive), is essential for transduction of the SA signal and acts downstream of SA in this pathway to activate PR genes (Shah and Klessing.1999). Sun . (2001) revealed that the number of alleles in cultivated rice had been reduced by 50-60% compared to wild rice. Thus, it is necessary to broaden the gene pool in rice breeding from diverse sources, especially from wild rice. Also, various factors are influenced by canopy structure, such as microclimatic conditions (including sunlight, humidity and temperature), nitrogen status, contact frequency, light transmittance and shoot number,which may all contribute to the variation in disease expression and thus make evaluation of host resistance difficult (Savary, 1995; Castilla, 1996; Zhong, 2006; Tang, 2007; Srinivasachary, 2011). Little direct information is available regarding the effects of canopy structure on sheath blight epidemic development under field conditions. Manipulation of the canopy structure offers promising possibilities for keeping pathogens under control (Tivoli, 2013). Allelic Analysis Rice Sheath Blight resistance is believed to be controlled by multiple genes or quantitative trait loci (QTLs) (Pinson SRM , 2005). Since (Li , 1995) first identified ShB QTLs using restricted fragment length polymorphism (RFLP) markers under field conditions, over 30 resistant ShB QTLs have been reported using various mapping populations, such as F2s (Che KP, 2003; Zou JH, 2000), double haploid (DH) lines (Kunihiro Y, 2002), recombinant inbred lines (RILs) [Pinson SRM , 2005; Channamallikarjuna V, 2009; Liu G, Jia Y , 2009), near- isogenic introgression lines (NIL) (Loan LC, 2004) and backcross populations (Sato H, 2004; Zuo S, Zhang L, 2008).

(2013) To date, around 50 SB resistance quantitative trait loci (SBR QTLs) have been detected on all 12 rice chromosomes in cultivated varieties, deep-water varieties and wild species (Jia, 2009; Zuo, 2010; Wang, 2012; Xu, 2011; Fu, 2011). Some of them were identified in multiple mapping populations and/or environments and not associated with either heading date (HD) or morphological traits, and they are believed to be real SBR QTLs (Han, 2003; Jia, 2009; Zuo, 2010; Pinson, 2005; Wang, 2012).

SYMPTOMATOLOGY

Ou (1972) studied in detail the symptoms of sheath blight under field conditions. Initial symptoms of sheath blight appear in the form of circular, oblong or ellipsoid, greenish-grey water-soaked spots about 1cm long that occur on leaf sheath near the water level. These lesions enlarge and become oblong and irregular in outline, the center of which become grey white with brown margins. Lesions may coalesce to encompass the entire leaf sheath and stem (Rush and Lee, 1992). Singh . (2003) reported about the growth of mycelium on the affected parts of the plant under humid conditions and this aids in the spread of the disease to a considerable distance in the field through irrigation water. Lodging may occur in diseased plants, particularly in taller varieties (Rangaswamy and Mahadevan, 2005).

Mode of Survival of Pathogen

The survival and inoculums potential of the R. solani is directly related with severity and incidence of disease.

Sclerotia are the most important source of inoculums (Allison, 1951). Li Shi Dong (2004) reported that 60.9% sclerotia could survive after 265 days of being buried in natural sandy loam under field conditions in Beijing, while colonized rice straw debris (0.5-10 cm long) could not yield the fungus on medium plates after 88 days of being buried under same conditions. Singh and Singh (2008) reported that the infected leaf pieces incubated at 10 and 28°C also showed a steady reduction in fungus survival with an incubation period from an initial 100% to 53.3% and 63.3% respectively after a period of 5 months. At all observations time, except 150 days after incubation, 10 and 28°C recorded significantly more survival than at 0 and 40°C.

Disease-resistance classification

When a plant detects pathogens, signal transduction pathways act together to form a complex network leading to defense responses (Panstruga, 2009). Disease resistance genes are divided into two classes: receptor genes, which comprise R genes and host pattern recognition receptor (HPRR) genes, and defense responsive or defense- related genes. When pathogens attack, the latter genes respond by altering their expression levels or modifying their encoded proteins post-translationally (Eulgem, 2005). Disease resistance in rice is usually categorized into two main groups: qualitative resistance and quantitative resistance. Qualitative resistance is also called complete resistance, and is conferred by a single R gene whose encoded protein can interact directly or indirectly with a corresponding pathogen effector (Kou and Wang 2012). Thus, this type of resistance is pathogen race-specific. Although breeding and cultivation of resistant cultivars using R genes has been successfully applied for management of rice resistance against bacterial blight and blast diseases, the strong selection pressure against R genes and rapid pathogen evolution have meant that this resistance can be quickly overcome (Kou and Wang 2012).

(3)

972 Host Range

Kozaka (1961) from Japan recorded 188 species of plants from 32 families that can be infected by this fungus.Two virulent isolates of Thanatephorus cucumeris could infect and survive on several weed hosts which are commonly found in rice fields namely Echinocloa crusgalli, E. colonum, Fimbristylis littoralis, Cyperus rotandus.

Kozaka (1965), Tsai (1974) observed that rice fungus infected 20 species which are from 11 families and observed that the sclerotia from diseased tissue of weed hosts produced typical symptoms of sheath blight on paddy plants.

Singh and Saksena (1980) found that aerial strain causing banded blight disease in bajra infected 22 plants species of both crop and wild plants belonging to 6 different families. Kannaiyan and Prasad (1980) have listed 30 monocot weed species as host of Thanatephorus cucumeries (Rhizoctnia solani).Goswami . (2010) reported that isolate SYL- 13 possessed narrow host range and low avirulent while DIN-8 and GAZ-18 had wide host range and considered as virulent isolate of Rhizoctonia solani. The isolate GAZ-9 had highly virulent and wide host range of 35 different crops.

Improvement of rice resistance to sheath blight by pyramiding

It has been difficult to generate SB resistant rice varieties by relying on traditional breeding because resistance to rice SB is a typical quantitative trait ( Z.X. Chen ., 2014). In fact, there are no SBR QTLs that have been incorporated into commercial rice varieties via MAS, even though this technology has been widely utilized in breeding against other rice diseases (Luo and Yin, 2013; Akhtar ., 2010). Pinson . (2005) predicted that qSB-9^TQ and qSB-3^TQ could possibly reduce loss to SB by 15% when introduced into Lemont. Yin . (2008) and Wang . (2012) both found that pyramiding different SBR QTLs could achieve higher levels of resistance to SB. Unfortunately, japonica rice varieties are generally less resistant to SB infection than indica rice (Zuo ., 2008; Jia ., 2012). Most SBR QTLs identified to date are derived from indica rice and relatively few from japonica rice (Zuo ., 2010; Jia, 2012).

DNA extraction and molecular marker analysis

Genomic DNA extraction was done following the method developed by Murray and Thompson (1980). Molecular markers were analyzed according to the protocol reported by Zuo . (2011). The markers located on the two sides and those within the interval for qSB-7^TQ and qSB-9^TQ are listed in in Table 1, which show polymorphism between TQ and all japonica varieties.

Table 1. which show polymorphism between TQ and all japonica varieties tested in this study

SBR QTL Marker name Distance between markers (kb) Forward primer sequence ( 5 - 3₎ Reverse primer sequence ( 5 - 3₎

Qsb-7 RM11 1787 TCTCCTCTTCCCCCGATC ATAGCGGGCGAGGCTTAG

RM346 CGAGAGAGCCCATAACTACG ACAAGACGACGAGGAGGGAC

QSB-9 Y74.7 1699 ACCCTGTACTTGTTCTCCTT CTTTGACCGTTCGTGTTATT

Y83-2 1699 TCAATAACCCTCCTCTTCATCCT CCTGAGTTCCCTCTTAAACCAAA

Y900.2 927 CGGGATTAAATAAATACGAGACAT TTTCTTAGGTCCCATTCTTC

Y93.5 988 CTGTTCTTCTCCTGCGTTCT ATGTCCTCGTGCTTCTGC

aTH Pheysical distance between markers is based on the refrence sequence of japonica variety nipponbar.

b Marker names started by RM and Y indicate the simple sequence repeat markers downlowded from GRAMENE public marker database(www.gramene.org/markers) and insertion/deletion markerse developed in the present study.respectively.

transferring SBR QTLs of interest into japonica varieties

Most SBR QTLs identified to date are derived from indica rice and relatively few from japonica rice (Zuo, 2010;

Jia, 2012). The qSB-7^TQ and qSB-9^TQ QTLs come from indica rice Teqing (TQ) and are localized on chromosomes 7 and 9, respectively (Pan ., 2005; Pinson ., 2005). By using chromosomal introgression lines (ILs), Wang . (2012) have recently further confirmed that qSB-9^TQ carries resistance to SB, reducing the SB disease rating by 1.0 (using qSB-9^TQ rating scale), which coincides with the conclusion drawn by Yin . (2008). Zuo . (2008) investigated 9 varieties of japonica rice from different growing ecotypes in China and found that they all lacked qSB-9^TQ. Thus, it is feasible to introduce qSB-9^TQ into such japonica varieties to improve their resistance to SB. Z.X. Chen 2014 applied the indica variety TQ as the donor of qSB-7^TQ and qSB- 9^TQ to cross and backcross with japonica varieties, and the japonica varieties were used as recurrent parents (Fig. 1).

(4)

973

Figure 1. Diagram of the strategy for developing materials in sheath blight test.the multiply symbol indicates backcrossing and the circled multiply symbol indicates self-pollinating.SB test/2GBs means the sheath blight(SB) test was performed in 2 genetic

background (GBs);SB test/1GB and SB test/3GBs depict similar meanings.Two pyramided lines carrying both QTLs and the control variety were used in yield tests under different SB disease conditions

Expression of the pathogenesis related proteins, in reaction to Rhizoctonia solani

Lipoxygenase (LOX) is the first enzyme in the production of jasmonic acid (JA), and catalyzes the formation of JA from linolenic acid. A drastic increase in the LOX activity has been observed in rice leaves after infection with M.

grisea (Ohta, 1991). Previous studies have proved the role of LOX in enhanced resistance of rice plants inoculated with necrotrophic pathogens (Rance ., 1998). Pathogenesis related (PR) genes of rice are among the most important defense genes in the interaction of rice with pathogens. Mohammad Sayari . (2014) study the role of NH-1, several PR genes, phenylalanine ammonia-lyase (PAL), and lipoxygenase in the defense responses of Iranian cultivars of rice against Rhizoctonia solani. Results showed that the expression rate of all genes in the resistant cultivar was higher than that of the susceptible genotype, post inoculation. The results of this study suggest that the investigated genes are involved in the resistance responses of rice against the sheath blight agent. For the first time, the induction of PR-5, PR-9, PR-10, PR-12, PR-13, and NH-1 was observed in this study in the resistant and susceptible Iranian cultivars of rice following attacks by R. solani.

sheath blight resistance genes and QTLs in wild rice

Sheath blight disease, caused by a soilborne necrotrophic fungus Rhizoctonia solani Kühn, is one of the most important diseases in cultivated rice. This disease was first reported in Japan in 1910 and subsequently discovered worldwide (Rush, 1992). At present, rice sheath blight widely occurs in most rice-growing areas, including temperate, tropical and subtropical regions in diverse rice production systems (Lee, 1983). Sheath blight disease causes approximately 50% yield reduction in test plots of susceptible cultivars (Savary ., 1996). To identify resistant germplasm to sheath blight disease, Prasad . (2008) reported seven Oryza spp. accessions as moderately resistant, three were O. nivara accessions (IRGC104705, IRGC100898, and IRGC104443), O. barthii (IRGC100223), O.

meridionalis (IRGC105306), O. nivara/O. sativa (IRGC100943), and O. officinalis (IRGC105979). Greater effort should be paid to search sheath blight resistant germplasm from wild rice and to transfer the resistant genes into the cultivated rice in the future. Fantao Zhang and Jiankun Xie (2014) reveals that wild rice not only has many elite genes which have lost in cultivated rice, but also maintains a greater genetic diversity than cultivated rice. We should use the wild rice to broaden genetic diversity of cultivated rice, by which new cultivars could withstand biotic and abiotic stresses.

The evolution and pathogenic mechanisms of the rice sheath blight pathogen

The soilborne Basidiomycete fungus Rhizoctonia solani (teleomorph: Thanatephorus cucumeris) is a complex with more than 100 species that attack all known crops, pastures and horticultural species. R. solani is divided into 14 anastomosis groups (AG1 to AG13 and AGBI) ( Ogoshi , 1987). Among R. solani AG1 containing three main intraspecific groups (ISG), the subgroup AG1 IA is one of the most important plant pathogens, which causes diseases such as sheath blight, banded leaf, aerial blight and brown patch (Ogoshi , 1987; Akhtar , 2009) in many plants, including more than 27 families of monocots and dicots. As the agent of rice sheath blight, R. solani AG1 IA was thought to be mainly an asexual fungus on rice (Oryza sativa L.), although sexual structures from its teleomorph (T.

cucumeris) have been occasionally observed in fields. In nature, R. solani AG1 IA exists primarily as vegetative mycelium and sclerotia. Each year, the blight causes up to a 50% decrease in the rice yield under favourable conditions around the world (Groth, 2008; Bernardes, 2009). R. solani AG1 IA is also considered to be the most destructive pathogen for other economically important crops, including corn (Zea mays) (Akhtar, 2009; Gonzalez-

(5)

974 Vera ., 2010) and soybean (Glycine max) ( Ciampi, 2008). For the molecular identification of the fungal strain, the 609- or 611-bp internal transcribed spacer (ITS) regions wereamplified from the genomic DNA of six R. solani strains using the primer pair ITS4 (

5

-TCC TCC GCT TAT TGA TAT GC-

3

) and ITS5 (

5

-GGA AGT AAA AGT CGT AAC AAG G-

3

) (White, 1990).

Phenotyping of Partial Physiological Resistance to Sheath Blight

The pathogen has a very wide host range and major gene(s) which give complete resistance in rice against this disease have not been identified (Pinson, 2005; Srinivasacharya, 2011), but variation in quantitatively inherited resistance to R. solani in the field in the cultivated rice is known (Zou, 2000). To date, only partial resistance to rice sheath blight has been identified in the cultivars of O. sativa (Pinson, 2005; Srinivasacharya, 2011). In addition, some other Oryza species have been reported as source of resistance to this disease (Amante ., 1990; Brar and Khush 2003; Lore, 2011). Resistance to sheath blight is associated with quantitative, complex, traits (Pinson, 2005;

Srinivasachary, 2011). Resistance of rice to sheath blight may be hypothesized to include two main groups of mechanisms: physiological resistance and disease escape. Disease escape is strongly determined by plant architecture. Morphological traits resulting in a rice canopy being less conducive an environment for sheath blight intensification and spread may thus lead to disease escape (Robinson, 1976). Physiological resistance, in turn, corresponds to physiological processes of the plant, constitutive or induced that are associated with a decrease in efficiency of one or several of the infection stages of the pathogen. The measurement of components of resistance, expressed as relative resistance terms, allows identifying factors that will induce the strongest epidemic reduction.

These components of resistance, in turn, can become targets to include in breeding programmes, through experimental (Savary and Zadoks 1989) or modelling approaches (Leonard and Mundt, 1984; Van Oijen, 1992). The components of resistance related to lesion size have been measured for another disease like Rhizoctonia blight of tall fescue caused by R. solani, (Green, 1999).

Transgenic rice lines of sheath blight resistance

Plant pathogenesis-related (PR) proteins are defence proteins which prevent or limit pathogen invasion and spread reviewed in Ferreira .( 2007). Genetic engineering strategies aimed at constitutive high level expression of combinations of two PR-proteins with differing modes of action provided high levels of fungal resistance in many plants (reviewed in Ferreira, 2007). Transgenic rice plants co-expressing rice chitinase and modified maize ribosome- inactivating protein b-32 genes (Kim ., 2003) and transgenic tobacco plants expressing a combination of barley ribosome-inactivating protein, barley chitinase, and barley β-1,3-glucanase genes (Jach, 1995) were resistant to Rhizoctonia solani. Combined expression of chitinase and β-1,3- glucanase genes proved to be very effective in transgenic tobacco against Cercospora nicotianae (Zhu, 1994), in transgenic tomato against Fusarium oxysporum (Jongedijk, 1995), and in transgenic potato (Chye, 2004) and transgenic rice (Sridevi ., 2008) against R. solani.

Pepper basic PR-1 protein and ascorbate peroxidase-like 1 genes, when simultaneously expressed in tomato, enhanced the resistance against.

Phytophthora capsici (Sarowar ., 2006). Combined expression of the rice TLP gene (tlp-D34) and the rice chitinase gene (chi11) resulted in increased resistance against R. solani in transgenic rice (Kalpana, 2006;Maruthasalam ., 2007). Shah . (2013) reported infection with Rhizoctonia solani, the disease index reduced from 100 % in control plants to 65 % in a T3 homozygous transgenic line T4 expressing the tlp-D34 gene alone. In a T2 homozygous transgenic line CT22 co-expressing tlp-D34 and chi11 genes, the disease index reduced to 39 %.

Identification of rice sheath blight quantitative trait loci by backcross populations

Sheath blight resistant sources have been identified in O. minuta J.S. Presl. ex C.B. Presl. (IRGC101089) and O. rufipogon Griff. (IRGC100907) accessions (Amante, 1990). Lakshmanan (1991) reported the use of O. officinalis Wall ex Watt in the transfer of sheath blight resistance genes into cultivated rice through backcross breeding. Sheath blight quantitative trait loci (QTL) have been identified in several recombinant inbred line or F2 populations involving two O. sativa cultivars having one parent as moderately resistant and the other as susceptible (summarized in Jia, 2009; Channamallikarjuna, 2010; Fu, 2011; Xu, 2011; Nelson, 2012). A major sheath blight QTL was identified on the bottom of chromosome 9 in several of these populations. Subsequently, this was validated using the single nucleotide polymorphism (SNP) variants identified for chromosome 9 from the whole genome sequence of 13 rice cultivars, including four resistant cultivars subjected to a principal component analysis with a biplot display (Silva ., 2012). Most studies identifying sheath blight QTLs attributed resistance to the effect of multiple genes, and the resistance as a polygenic quantitative trait. Venu . (2007) identified at least 23 rice host genes involved in different biochemical pathways using DNA microarray and serial analysis of gene expression. The advanced backcross

(6)

975 method of QTL analysis (AB-QTL) was proposed as an effective molecular breeding technique for incorporating valuable genes from exotic sources into an adapted background (Tanksley and Nelson 1996). The value of the AB- QTL method for isolating yield and yield-enhancing alleles from O. rufipogon (IRGC105491) was demonstrated in rice with five different adapted cultivars being used as the recurrent parents in developing the populations (McCouch ., 2007). Subsequently this method was used to develop populations with other O. rufipogon accessions (Jing ., 2010;

Tan ., 2008; Wickneswari ., 2012) and an O. glumaepatula accession (Brondani, 2002).

Mapping quantitative trait loci for sheath blight resistance in rice using double haploid population

Different cultivars exhibit different levels of resistance (Groth, 1992; Khush, 1977), and there are associations between resistance and several morphological characters, such as plant height and heading date (Han, 2003; Li, 1995). It is generally reported that ShB resistance is a typical quantitative trait controlled by several minor genes (Sha and Zhu 1989). However, some researchers proposed that ShB resistance was controlled by a few major genes in some varieties. (Pan, 1999; Che, 2003). Qun XU (2010) to identify QTL controlling rice ShB using a double haploid (DH) population from the cross of _Baiyeqiu_, a ShB resistant indica landrace from China, and _Maybelle_, a ShB susceptible japonica variety from the United States, grown for 2 years, they detected a total of four QTL located on four different chromosomes (qShB1, qShB2, qShB3 and qShB5). The qShB1 QTL explained 8.9% of the phenotypic variation in 2007 and 13.2% in 2008.

Induction of systemic resistance in rice against sheath blight disease by Pseudomonas fluorescens

The pathogen is both soil and water borne. Moreover, it produces a phytotoxin (RS toxin) that could reproduce most of the symptoms of the disease (Vidhyasekaran, 1997a). Induced defense mechanisms in plants against various pathogens by biotic and abiotic inducers has been reported for many crops (Baker, 1997). The classical inducers include pathogens (Dalisay and Kuc 1995), chemicals (Lawton, 1994), plant growth promoting rhizobacteria (PGPR) (Leeman, 1995; Liu, 1995a,b) and plant products (Singh, 1990). Early and increased expression of these genes can result in induced systemic resistance (ISR) in plants against several pathogens (Ward, 1991). For the induction of ISR, strains of Pseudomonas fluorescens appear to be promising. Investigations on mechanisms of biological control by fluorescent pseudomonads have revealed that different strains protect the plants from various plant pathogens in several crops by inducing systemic resistance. ISR against different pathogens by PGPR strains have been achieved in tobacco (Maurhofer, 1994), cucumber (Liu, 1995a,b), tomato (Raupach, 1996), radish (Leeman, 1995) and sugarcane (Samiyappan, 1999). R. Nandakumar . (2000) applied Two Pseudomonas fluorescens strains viz., PF1 and FP7 which inhibited the mycelial growth of sheath blight fungus Rhizoctonia solani and increased the seedling vigour of rice plants in vitro were selected for assessing induced systemic resistance (ISR) against R. solani in rice.

The Pseudomonas application as a bacterial suspension or a talc-based formulation through seed, root, soil and foliar application either alone or in combination (seed + root + soil + foliar) effectively reduced sheath blight disease incidence, promoted plant growth and ultimately increased yields under glasshouse or field conditions

Mutant resources

The International Rice Functional Genomics Consortium together with many other laboratories have generated a large number of rice mutants, either by insertional mutagenesis using T-DNA and Ac/Ds elements or by chemical or physical mutagenic agents (Krysan, 1999). This population may represent the largest mutant crop plant collection in the world, and many of these have been catalogued. About 500,000 insertional mutants have been generated by the international rice research community. Around 60,000 mutants from IR64 have been generated using fast- neutrons and gamma-rays (Wu, 2005). High-throughput technologies and suitable phenotyping methods will likely enable researchers to explore these resources in the search for new sources of ShB resistance.

Conclusion

Nowadays, QTL studies for mining favorable genes from wild rice species are receiving more and more attentions in global rice community. our objectives are to breed rice varieties with enhanced stress and disease resistance, improved yield potential, and superior grain quality using genomic and molecular information, and, in the near future, to shatter the rice yield plateau. Recent developments in the biotechnological fields of gene cloning, protein expression, transcriptomics, and genomics have broadened opportunities for rice scientists to use a multipronged approach to defend against the ever-increasing threat of devastating rice diseases.

(7)

976 REFERENCES

Akhtar J, Jha VK, Kumar A and Lal HC. 2009. Occurrence of banded leaf and sheath blight of maize in Jharkhand with reference to diversity in Rhizoctonia solani. Asian J. Agricul. Sci. 1, 32–35.

Akhtar S, Bhat MA, Wani SA, Bhat KA, Chalkoo S, Mir MR and Wani SA. 2010. Marker assisted selection in rice. J. Phytol. 2, 66–81.

Allison JL. 1951. Rhizoctonia blight of forage legumes and grasses. Pl. Dis. Reptr. 35: 372-373.

Amante AD, dela Pena R, Sitch LA, Leung H and Mew TW. 1990.Sheath blight (ShB) resistance in wild rices. Int Rice Res

Amante AD, Pena DL, Stich R, Leung LAH and Mew TW. 1990. Sheath blight (ShB) resistance in wild rices. Int Rice Res Notes 15:5.

Baker B, Zambryski P, Staskaawicz B and Dineshkumar SP. 1997. Signaling in plant microbe interactions. Science 276, 726±733.

Bernardes J. 2009. Genetic structure of populations of the rice-infecting pathogen Rhizoctonia solani AG-1 IA from China. Phytopathology 99, 1090–1099.

Bouarab K, Brisson N and Daayf F. 2009. Molecular Plant-Microbe Interactions. CAB International, Cambridge, 337 pp.

Brar DS and Khush GS. 2003. Utilization of wild species of genus Oryza in rice improvement. In: Nanda JS, Sharma DS (eds) Monograph on Genus Oryza. UK, Science Publishers Inc Plymouth, pp 283–309.

Brondani C, Rangel PHN, Brondani RPV and Ferreira ME. 2002. QTL mapping and introgression of yield-related traits from Oryza glumaepatula to cultivated rice (Oryza sativa) using microsatellite markers. Theor Appl Genet 104:1192–1203

Castilla NP, Leano RM, Elazegui FA, Teng PS and Savary S. 1996. Effects of plant contact, inoculation pattern, leaf wetness regime, and nitrogen supply on inoculum efficiency in rice sheath blight. Journal of Phytopathology 144, 189–92.

Channamallikarjuna V, Sonah H, Prasad M, Rao GJN and Chand S. 2009. Identification of major quantitative trait loci qSBR11-1 for sheath blight resistance in rice. Mol Breeding 25: 155–166.

Channamallikarjuna V, Sonah H, Prasad M, Rao JN, Chand S, Upreti HC, Singh NK and Sharma TR. 2010. Identification of major quantitative trait loci qSBR11-1 for sheath blight resistance in rice. Mol Breed 25:155–166

Chen ZX, Zhanga Y, Fenga F, Fenga MH, Jianga WY, Mac Y C, Pand H, Huab HL,. Li GS, Pana XB and Zuoa SM. 2014. Improvement of japonica rice resistance to sheath blight by pyramiding qSB-9^TQ and qSB-7^TQ. Field Crops Research 161,118–127.

Che KP, Zhan QC, Xing QH, Wang ZP and Jin DM. 2003. Tagging and mapping of rice sheath blight resistant gene. Theor Appl Genet 106: 293–

297.

Chye ML, Zhao KJ, Ramalingam S and Fung KL. 2005. An agglutinating chitinase with two chitin-binding domains confers fungal protection in transgenic potato. - Planta 220: 717-730,.

Ciampi MB. 2008. Genetic structure of populations of Rhizoctonia solani anastomosis group-1 IA from soybean in Brazil. Phytopathology 98, 932–

941.

Dalisay RF and Kuc JA. 1995. Persistence of reduced penetration by Colletotrichum lagenarium into cucumber leaves with induced systemic resistance and its relation to enhanced peroxidase and chitinase activities.Physiological and Molecular Plant Pathology 47, 329-338.

Eulgem T. 2005. Regulation of the Arabidopsis defense transcriptome. Trends Plant Sci 10:71–78

Fantao Z and Jiankun X. 2014. Genes and QTLs Resistant to Biotic and Abiotic Stresses from Wild Rice and Their Applications in Cultivar Improvements, Chapter 2.

Ferreira RB, Monteiro S, Freitas F, Santos CN, Chen C, Batista LM, Duarte J, Borges A and Teixeira AR. 2007. The role of plant defence proteins in fungal pathogenesis. - Mol. Plant Pathol. 8: 677-700.

Fu D, Chen L, Yu G, Liu Y, Lou Q, Mei H, Xiong L, Li M, Xu X and Luo L. 2011. QTL mapping of sheath blight resistance in a deep-water rice cultivar. Euphytica 180:209–218.

Fu D, Chen L, Yu GH, Liu Y, Lou QJ, Mei HW, Xiong L, Li M-S, XuXY and Luo LJ. 2011. QTL mapping of sheath blight resistance in adeep-water rice cultivar. Euphytica 180(2):209–218 germplasm lines of rice. Crop Sci. 32, 507.

Gonzalez VAD. 2010. Divergence between sympatric rice- and maizeinfecting populations of Rhizoctonia solani AG-1 IA from Latin America.

Phytopathology 100, 172–182.

Goswami BK, Bhuiyan KA and Mian IH. 2010. Morphological and Pathogenic variations in the isolates of Rhizoctonia solani in Bangladesh.

Bangladesh J. Agril. Res. 35:375-380.

Green IIDE, Burpee LL and Stevenson KL. 1999. Components of resistance to Rhizoctonia solani associated with two tall fescue cultivars. Plant Dis 83:834–838.

Groth DE. 2008. Effects of cultivar resistance and single fungicide application on rice sheath blight, yield, and quality. Crop Prot. 27, 1125–1130.

Groth DW and Nowick EM. 1992. Selection for resistance to rice sheath blight through number of infection cushions and lesion type. Plant Dis 76, 721—723.

Han YP, Xing YY, Gu SL, Chen ZX, Pan XB and Chen XL. 2003. Effect of morphological traits on sheath blight resistance in rice. Acta Botanica Sinica 45:825–831

Jach G, Gornhardt B, Mundy J, Logemann J, Pinsdorf E, Leah R, Schell J and Maas C. 1995. Enhanced quantitative resistance against fungal disease by combinatorial expression of different barley antifungal proteins in transgenic tobacco. - Plant J. 8: 97-109.

Jia YL, Liu GJ, Costanzo S, Lee SH and Dai YT. 2009. Current progress on genetic interactions of rice with rice blast and sheath blight fungi.

Front Agric China 3(3):231–239

Jing Z, Qu Y, Chen Y, Pan D, Fan Z, Chen J and Li C. 2010. QTL analysis of yield-related traits using an advanced backcross population derived from common wild rice (Oryza rufipogon L.). Mol Plant Breed 1(1):1–10

Jongedijk E, Tigelaar H, Van Roekel JSC, Bres-Vloemans SA, Dekker I, Van den Elzen PJM, Cornelissen BJC and Melchers LS. 1995. Synergistic activity of chitinases and β-1,3-glucanases enhances fungal resistance in transgenic tomato plants. - Euphytica 85: 173-180.

Kalpana K, Maruthasalam S, Rajesh T, Poovannan K, Kumar KK, Kokiladevi E, Raja JAJ, Sudhakar D, Velazhahan R, Samiyappan R and Balasubramanian P. 2006. Engineering sheath blight resistance in elite indica rice cultivars using genes encoding defense proteins. - Plant Sci. 170: 203-215.

Kannaiyan S and Prasad NN. 1980. Dicot weed hosts of Rhizoctonia solani Kuhn. Agri. Res. J. Kerala. 18:125-127.

Khush GS. 1977. Disease and insect resistance in rice. Adv. Agron. 29, 263—341

Kim JK, Jang IC, Wu R, Zuo WN, Boston RS, Lee YH, Ahn IP and Nahm BH. 2003. Co-expression of a modified maize ribosome-inactivating protein and a rice basic chitinase gene in transgenic rice plants confers enhanced resistance to sheath blight. - Transgenic Res. 12: 475- 484.

Kou Y and Wang S. 2012. Toward an understanding of the molecular basis of quantitative disease resistance in rice. J Biotechnol 159:283–290

(8)

977

Kozaka T. 1961. Ecological studies on sheath blight of rice of rice caused Pellicularia sasakii (Shirai) and its chemical control. Chugoko agric.

Res. 20:1-133

Kozaka T. 1965. Ecology of Pellicularia sheath blight of rice plants and its chemical control. Ann. Phytopath. Soc. Japan. 31:179-185.

Krysan P, Young L and Sussman M. 1999. T-DNA as an insertional muatagen in Arabidopsis. Plant Cell 11:8

Kunihiro Y, Qian Q, Sato H, Teng S and Zeng D. 2002. QTL analysis of sheath blight resistance in rice (Oryza sativa L.). Chin J Genet 29: 50–

55.

Lakshmanan P .1991. Resistance to sheath blight (ShB) and brown spot (BS) in lines derived from Oryza officinalis. Int Rice Res Newsl 16:8 Lawton KA, Beck J, Potter S, Ward E and Ryals J. 1994. Regulation ofcucumber class III chitinase gene expression. Molecular Plant Microbe

Interaction 7, 48-57.

Lee FN and Rush MC. 1983. Rice sheath blight: a major rice disease. Plant Dis 67:829−832

Leeman M, Van Pelt JA, Den Ouden FM, Heinsbroek M, Bakker PAHM and Schippers B. 1995. Induction of systemic resistance against Fusarium wilt of radish by lipopolysaccharides of Pseudomonas fluorescens. Phytopathology 85, 1021±1027.

Leonard KJ and Mundt CC. 1984. Methods for estimating epidemiological effects of quantitative resistance. Theor Appl Genet 67: 219–230.

Li Shi D. 2004. Population dynamics and survival of Rhizoctonia solani AG-1 in the field soil under ricewheat rotation. Agricultural sciences of China. 3:448-455.

Li Z, Pinson SRM, Marchetti MA, Stansel JW and Park WD. 1995. Characterization of quantitative trait loci (QTLs) in cultivated rice contributing to field resistance to sheath blight (Rhizoctonia solani). Theor Appl Genet 91: 374—381.

Liu G, Jia Y, Correa-Victoria FJ, Prado GA and Yeater KM. 2009. Mapping uantitative trait loci responsible for resistance to sheath blight in rice.

Phytopathology 99: 1078–1084.

Liu G, Jia Y, McClung A, Oard JH, Lee FN and Correll JC. 2013. Confirming QTLs and finding additional loci responsible for resistance to rice sheath blight disease. Plant Dis. 97, 113–117.

Liu L, Kloepper JW and Tuzun S. 1995a. Induction of systemic resistance in cucumber against bacterial angular leaf spot by plant growth- promoting rhizobacteria. Phytopathology 85, 843- 847.

Loan LC, Du PV and Li Z. 2004. Molecular dissection of quantitative resistance of sheath blight in rice (Oryza sativa L.). Omonrice 12: 1–12.

Lore JS, Hunjan MS, Goel RK, Singh K, Bharaj TS. 2011. Sources of resistance to sheath blight disease of rice caused by Rhizoctonia solani Kuhn. Indian Phytopath 64:85–86.

Luo YC and Yin ZC. 2013. Marker-assisted breeding of Thai fragrance rice for semidwarf phenotype, submergence tolerance and disease resistance to rice blast and bacterial blight. Mol. Breed. 32, 709–721.

Marchetti MA and Bollich CN. 1991. Quantification of the relationship between sheath blight severity and yield loss in rice. Plant Dis. 75, 773–775.

Maruthasalam S, Kalpana K, Kumar KK, Loganathan M, Poovannan K, Raja JAJ, Kokiladevi E, Samiyappan R, Sudhakar D and Balasubramanian P. 2007. Pyramiding transgenic resistance in elite indica rice cultivars against the sheath blight and bacterial blight. - Plant Cell Rep. 26:

791- 804.

Maurhofer M, Hase C, Meuwly P, Metraux JP and Defago G. 1994. Induction of systemic resistance of tobacco to tobacco necrosis virus by the root-colonizing Pseudomonas fluorescens strain CHAO: Influence of the gacA gene and of pyoverdine production. Phytopathology 84, 139-149.

McCouch SR, Sweeney M, Li J, Jiang H, Thomson M, Septiningsih E, Edwards J, Moncada P, Xiao J, Garris A, Tai T, Martinez C, Tohme J, Sugiono M, McClung A, Yuan LP and Ahn SN. 2007. Through the genetic bottleneck: O. rufipogon as a source of trait-enhancing alleles for O. sativa. Euphytica 154:317–339.

Murray MG and Thompson WF. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8, 4321–4325.

Nandakumar R. 2001. Induction of systemic resistance in rice against sheath blight disease by Pseudomonas fluorescens. Soil Biology &

Biochemistry 33, 603-612

Nelson JC, Oard JH, Groth D, Utomo HS, Jia Y, Liu G, Moldenhauer KAK, Correa-Victoria FJ, Fjellstrom RG, Scheffler B and Prado GA. 2012.

Sheath-blight resistance QTLs in Japonica rice germplasm. Euphytica 184:23–34 Newsl 15:5

Ogoshi A. 1987. Ecology and pathogenicity of anastomosis and intraspecific groups of Rhizoctonia solani Ku¨hn. Phytopathology 25, 125–143.

Ohta H, Shida K, Peng YL, Furusawa I, Shishiyama J, Aibara S and Morita Y. 1991. A lipoxygenase pathway is activated in rice after infection with the rice blast fungus Magnaporthe grisea. Plant Physiol. 97 (1): 94–98.

Ou SH.1972. Rice diseases. First edition. The common wealth Mycological Institute, Kew Survey, England. 368pp.

Pan XBMC, Rush XY, Sha QJ, Xie SD, Linscombe SR and Stetina JH. 1999. Major gene, nonallelic sheath blight resistance from the rice cultivars Jasmine 85 and Teqing. Crop Sci. 39, 338—346

Pan XB, Zhang, YF, Zuo SM and Chen ZX. 2005. Discussion on QTLs identification and application of important quantitative traits in crops. J.

Yangzhou Univ. (Agric. Life Sci. Ed.) 2, 50–55.

Panstruga R, Parker JE and Schulze-Lefert P. 2009. Snap Shot: plant immune response pathways. Cell 136:978.

Pinson SRM, Capdevielle FM and Oard JH. 2005. Confirming QTLs and finding additional loci conditioning sheath blight resistance in rice using recombinant inbred lines. Crop Sci. 45, 503–510.

Prasad B, Eizenga GC .2008. Rice sheath blight disease resistance identified in Oryzas pp. accessions. Plant Dis 92:1503−1509.

Qun XU1, Ping X. 2011. Mapping quantitative trait loci for sheath blight resistance in rice using double haploid population. Plant Breeding 130, 404—406.

Rance I, Fournier J and Esquerre-Tugaye MT. 1998. The incompatible interaction between Phytophthora parasitica var. nicotianae race 0 and tobacco is suppressed in transgenic plants expressing antisense lipoxygenase sequences. Proc. Natl Acad. Sci. USA. 95 (11): 6554–

6559.

Rangaswami G and Mahadevan A. 2005. Diseases of Crop Plants in India. Fouth edition, Prentice Hall of India Private Limited, New Delhi. pp536.

Raupach GS, Liu L, Murphy JF, Tuzun S and Kloepper JW. 1996 Induced resistance in cucumber and tomato against cucumber mosaic cucumo virus using plant growth-promoting rhizobacteria. Plant Disease 80, 891-894.

Robinson RA. 1976. Plant Pathosystems. Springer Verlag, Berlin,Vol.3

Rush MC and Lee FN. 1992. Sheath blight. Pages 22−23 in: Compendium of rice diseases. R. K. Webster and P. S. Gunnell, eds. American Phytopathological Society, St. Paul, MN

Rush MC and Lee FN. 1992. Sheath blight In: compendium of rice diseases (Webster, R.K. and Gunnel, P.S. eds) American Phytopathological Society, St. Paul, M.N. pp 22-23.

(9)

978

Sarowar S, Kim YJ, Kim EN, Kim KD, Choi JY, Hyung NI and Shin JS. 2006. Constitutive expression of two pathogenesis-related genes in tomato plants enhanced resistance to oomycete pathogen Phytophthora capsici. - Plant Cell Tissue Organ Cult. 86: 7-14.

Sato H, Ideta O, Ando I, Kunihiro Y and Hirabayashi H. 2004. Mapping QTLs for sheath blight resistance in the rice line WSS2. Breeding Sci 54:265–271.

Sayari M and Babaeizad V. 2014. Expression of the pathogenesis related proteins, NH-1, PAL, and lipoxygenase in the iranian Tarom and Khazar rice cultivars, in reaction to Rhizoctonia solani – the causal agent of rice sheath blight,Jppr,Vol. 54, No. 1

Savary S, Castilla NP, Elazegui FA, McLaren CG, Ynalvez MA and Teng PS. 1995. Direct and indirect effects of nitrogen supply and disease source structure on rice sheath blight spread. Phytopathology 85, 959–65.

Savary S and Mew TW .1996. Analyzing crop losses due to Rhizoctonia solani: Rice sheath blight, a case study. In: Rhizoctonia Species:

Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. B. Sneh, S. Jabajihare, S. Neate, and G. Dijst, eds. Kluwer Academic Publisher, Dordrecht, The Netherlands:237−245

Savary S and Zadoks JC. 1989.Analysis of components in the hostparasite interaction of groundnut rust. II. Measurement of intermediate resistance using a micro-plot trial. Oleagineux 44:215–224.

Shah JM. R. Singh R and Veluthambi K. 2013.Transgenic rice lines constitutively co-expressing tlp-D34 and chi11 display enhancement of sheath blight resistance, BIOLOGIA PLANTARUM 57 (2): 351-358.

Sharma TR. 2010. Identification of major quantitative trait loci qSBR11-1 for sheath blight resistance in rice. Mol Breed 25:155–166 Sha XY and Zhu LH. 1989. Resistance of some rice varieties to sheath blight (ShB). Int. Rice Res. Newslett. 15, 7—8.

Shah Kachroo P and Klessig FD. 1999. The Arabidopsis ssi1 mutation restores athogenesis-related gene expression in npr1 plants and renders defensin gene expression salicylic acid dependent. Plant Cell 11 (2): 191–206.

Silva J, Scheffler B, Sanabria Y, De Guzman C, Galam D, Farmer A, Woodward J, May G and Oard J. 2012. Identification of candidate genes in rice for resistance to sheath blight disease by whole genome sequencing. Theor Appl Genet 124:63–74

Singh A, Rashmi RS, Savary L and Willocquet US. 2003. Infection process in sheath bligt of rice caused by Rhizoctonia solani. Indian Phytopathology. 56 (4): 434-438.

Singh PK and Singh AK. 2008. Effect of temperature and soil texture on the survival ability of rice sheath blight pathogen (Rhizoctonia solani).

Flora and Fauna (Jhansi). 14:55-56.

Singh SB and Saksena HK. 1980. A new sheath and leaf blight of bajra.Indian Phytopath.33:127-129.

Singh UP, Ram D and Tewari VP. 1990. Induction of resistance in chickpea (Cicer arietinum) by Aegle marmelos leaves against Sclerotinia sclerotiorum. Zeitschtift fur pflamenkrankheiten pflanzenschutz 97, 439-443.

Sridevi G, Parameswari C, Sabapathi N, Raghupathy V and Veluthambi K. 2008. Combined expression of chitinase and β-1,3-glucanase genes in indica rice (Oryza sativa L.) enhances resistance against Rhizoctonia solani. - Plant Sci. 175: 283-290.

Srinivasachar L and Savary S. 2011. Resistance to rice sheath (Rhizoctonia solani K€uhn) [teleomorph: Thanatephorus cucumeris (A.B. Frank) Donk.] disease: current status and perspectives. Euphytica 178, 1-22.

Sun CQ, Wang XK, Li ZC, Yoshimura A and Iwata N. 2001. Comparison on the genetic diversity of common wild rice (Oryza rufipogon Griff.) and cultivated rice (O. sativa L.) using RFLP markers. Theor Appl Genet 102:157–162

Tan L, Zhang P, Liu F, Wang G, Ye S, Zhu Z, Fu Y, Cai H and Sun C. 2008. Quantitative trait loci underlying domestication- and yield-related traits in an Oryza sativa 9 Oryza rufipogon advanced backcross population. Genome 51:692–704

Tang Q, Peng S and Buresh RJ ., 2007. Rice varietal difference in sheath blight development and its association with yield loss at different levels of N fertilization. Field Crops Research 102, 219–27.

Tanksley SD and McCouch SR.1997. Seed banks and molecular maps: unlocking genetic potential from the wild. Science 277:1063–1066 Tivoli B, Andrivon D, Baranger A, Calonnec A, Jeger M. 2013. Foreword: plant and canopy architecture impact on disease epidemiology and pest

development. European Journal of Plant Pathology 135, 453–4. tomato plants. - Euphytica 85: 173-180, 1995.

Tsai WH. 1974. Assessment of yield losses due to rice sheath blight at different inoculation stages. Journal of Taiwan Agricultural Research. 23:

188-194.

Van Oijen M. 1992. Evaluation of breeding strategies for resistance and tolerance to late blight in potato by means of simulation. Neth J Plant Pathol 98:3–11.

Venu RC, Jia Y, Gowda M, Jia MH, Jantasuriyarat C, Stahlberg E, Li H, Rhineheart A, Boddhireddy P, Singh P, Rutger N, Kudrna D, Wing R, Nelson JC and Wang GL. 2007. Rlsage and microarray analysis of the rice transcriptome after Rhizoctonia solani infection. Mol Genet Genomics 278:421–431

Vidhyasekaran P, Ponmalar T, Samiyappan R, Velazhahan R, Vimala R, Ramanathan A, Paranitharan V and Muthukrishnan S. 1997a. Host speci®c toxin production by Rhizoctonia solani, the rice sheath blight pathogen. Phytopathology 87, 1258±1263.

Wang Y, Pinson SRM, Fjellstrom RG and Tabien RE. 2012. Phenotypic gain from introgression of two QTL, qSB9-2 and qSB12-1, for rice sheath blight resistance. Mol Breed 30:293–303

Wang Y, Pinson SRM, Fjellstrom RG and Tabien RE. 2012. Phenotypic gain from introgression of two QTL, qSB9-2 and qSB12-1, for rice sheath blight resistance. Mol. Breed. 30, 293–303.

Ward, ER, Uknes SJ, Williams, SC, Dincher, SS, Widerhold DL, Alexander DC, Ahl-Goy, P, Mefraux JP and Ryals JA. 1991. Coordinate gene activity in response to agents that induce systemic acquired resistance. Plant Cell 3, 1085±1094.

Wickneswari R, Bhuiyan MAR, Kalluvettankuzhy KS, Lim LS, Thomson MJ, Kairudin Narimah MK and Zain Abdullah MZ. 2012. Identification and validation of quantitative trait loci for agronomic traits in advanced backcross breeding lines derived from Oryza rufipogon 9 Oryza sativa cultivar MR219. Plant Mol Biol Rep 30:929–939

Wu JL, Wu CJ, Lei CL, Baraoidan M, Bordeos A, Madamba MRS, Ramos-Pamplona M, Mauleon R, Portugal A, Ulat VJ, Bruskiewich R, Wang GL, Leach J, Khush G and Leung H .2005. Chemical- and irradiation-induced mutants of indica rice IR64 for forward and reverse genetics.

Plant Mol Biol 59:85–97

Xu Q, Yuan XP, Yu HY, Wang YP, Tang SX and Wei XH. 2011. Mapping quantitative trait loci for sheath blight resistance in rice using double haploid population. Plant Breed 130:404–406

Xu Q, Yuan XP, Yu HY, Wang YP, Tang SX and Wei XH. 2011. Mapping quantitative trait loci for sheath blight resistance in rice using double haploid population. Plant Breed 130:404–406.

Yin YJ, Zuo SM, Wang H, Chen ZX, Ma YY, Zhang YF, Gu SL and Pan XB. 2008. Pyramiding effects of three quantitative trait loci for resistance to rice sheath blight using near-isogenic lines. Chin. J. Rice Sci. 4, 40–346.

(10)

979

Zhao CG, Wang AR, Shi YJ, Wang LQ, Liu WD, Wang ZH and Lu GD. 2008. Identification of defense-related genes in rice responding to challenge by Rhizoctonia solani. Theor. Appl.Genet. 116 (4): 501–516.

Zhen AP, Lin RM, Zhang DH, Qin PG, Xu LZ, Ai P, Ding L, Wang YN, Chen Y, Liu Y, Sun ZG, Feng HT, Liang XX, Fu RT, Tang CG, Li Q, Zhang J, Xie ZL, Deng QM Li, SC, Wang SQ, Zhu J, Wang LX, Liu HN and Li P. 2013. The evolution and pathogenic mechanisms of the rice sheath blight pathogen. Nat. Comm. 4, 1424, http://dx.doi.org/10.1038/ncomms2427

Zhong X, Peng S, Buresh RJ, Huang N and Zheng H. 2006. Some canopy indices influencing sheath blight development in hybrid rice. Chinese Journal of Rice Science 20, 535–42. (In Chinese).

Zhu Q, Maher EA, Masoud S, Dixon RA and Lamb CJ. 1994. Enhanced protection against fungal attack by constitutive co-expression of chitinase and glucanase genes in transgenic tobacco. - Bio/Technology 12: 807-812.

Zou JH, Pan XB, Chen ZX, Xu JY and Lu JF. 2000. Mapping quantitative trait loci controlling sheath blight resistance in two rice cultivars (Oryza sativa L.). Theor Appl Genet 101: 569–573.

Zou JH, Pan XB, Chen ZX, Xu JY, Lu JF, Zhai WX and Zhu LH. 2000. Mapping quantitative trait loci controlling sheath blight resistance in two rice cultivars (Oryza sativa L.). Theor Appl Genet 101:569–573.

Zuo S, Zhang L, Wang H, Yin Y and Zhang Y. 2008. Prospect of the QTLqSB-9Tq utilized in molecular breeding program of japonica rice against sheathblight. J Genet Genomics 35: 499–505.

Zuo SM, Zhang YF, Chen ZX, Chen XJ and Pan XB. 2010. Current progress on genetics and breeding in resistance to rice sheath blight. Scientia Sinica Vitae 40(11):1014–1023

Zuo SM, Yin YJ, Pan CH, Chen ZX, Zhang YF, Gu SL, Zhu LH and Pan XB. 2013. Fine mapping of qSB-11LE, the QTL that confers partial resistance to rice sheath blight. Theor. Appl. Genet. 126, 1257–1272.

Zuo SM, Yin YJ, Zhang L, Zhang YF, Chen ZX, Gu SL, Zhu LH and Pan XB. 2011. Effect and breeding potential of qSB-11LE, a sheath blight resistance quantitative trait loci from a susceptible rice cultivar. Can. J. Plant Sci. 1, 191–198.

Zuo SM, Zhang L, Wang H, Yin YJ, Zhang YF, Chen ZX, Ma YY and Pan XB. 2008. Prospect of the QTL-qSB-9Tq utilized in molecular breeding program of japonica rice against sheath blight. J. Genet. Genomics 35, 499–505.

Zuo SM, Zhang YF, Chen ZX, Chen XJ and Pan XB. 2010. Current progress on genetics and breeding in resistance to rice sheath blight. Scientia Sin. Vitae 40, 1014–1023.