• No results found

ECHINOCOCCOSIS/HYDATIDOSIS

N/A
N/A
Protected

Academic year: 2021

Share "ECHINOCOCCOSIS/HYDATIDOSIS"

Copied!
15
0
0

Loading.... (view fulltext now)

Full text

(1)

E C H I N O C O C C O S I S / H Y D A T I D O S I S

SUMMARY

Diagnosis of echinococcosis in dogs or other susceptible carnivores relies on the demonstration of adult cestodes of the Echinococcus genus or their eggs in their faeces or small intestine. Recently, coproantigen and copro-DNA assays have proven useful for safe, fast and accurate diagnosis. In intermediate hosts, diagnosis depends on detection of the larval cyst form that can infect almost any organ, particularly the liver and lungs.

Identification of the agent: At present, five species of the genus Echinococcus are regarded as

taxonomically valid. These are E. granulosus, E. multilocularis, E. oligarthrus, E. vogeli and E. shiquicus. Echinococcus oligarthrus and E. vogeli occur less frequently than the first two species. Until recently E. shiquicus had been discovered only in a specific region of the People’s Republic of

China. These five species are morphologically distinct in both adult and larval stages. A number of intraspecific variants have been described for E. granulosus, which exhibit morphological and

biological characteristics, and these can reliably be differentiated by DNA analysis. Some of the E. granulosa genotypes have been recommended for elevation to species status.

Larval forms of Echinococcus can usually be visually detected in organs. Special care has to be

taken for a specific diagnosis of E. granulosus in instances where Taenia hydatigena in sheep is

also a problem. Histological examination may confirm the diagnosis after formalin-fixed material is processed by conventional staining methods. The presence of a periodic-acid-Schiff positive, acellular laminated layer with or without an internal cellular, nucleated germinal membrane can be regarded as a specific characteristic of metacestodes of Echinococcus. The identification of larval E. multilocularis in rodents and other hosts is possible by macroscopic or microscopic examination

and by DNA detection using the polymerase chain reaction (PCR).

The small intestine is required at necropsy for the detection of adult Echinococcus spp. in wild or in

domestic carnivores. The technique of carrying out surveys with the use of arecoline has been generally adopted for determining the prevalence of E. granulosus in dogs. Handling infected

material presents a risk to the operator of contracting a potentially fatal disease. Significant progress is being made in the development of immunological tests for the diagnosis of intestinal

Echinococcus infections by use of coproantigen detection. The technique has been used

successfully in surveys of E. granulosus in dogs and is currently used in surveys for E. multilocularis in populations of dogs, foxes, and cats. Coproantigen detection is possible in faecal

samples collected from dead or living animals or from the environment.

PCR/DNA methods for the detection of E. multilocularis and more recently E. granulosus in

definitive hosts have now been established in specialised laboratories as diagnostic techniques. Serological tests: Antibodies directed against oncosphere, cyst fluid and protoscolex antigens can be detected in the serum of infected dogs and sheep, but this approach is presently of limited practical use as it does not distinguish between current and previous infections. Cross-reactivity between Echinococcus and Taenia species also may occur.

Requirements for vaccines and diagnostic biologicals: Progress has been made in the development of an effective vaccine against infection with the larval stage of E. granulosus in sheep

(2)

A. INTRODUCTION

Species under genus Echinococcus are small tapeworms of carnivores with larval (metacestode) stages known as hydatids proliferating asexually in various mammals including humans. There were four morphologically distinct species in this genus until recently when Echinococcus shiquicus was added to the previously known species:

E. granulosus, E. multilocularis, E. oligarthus, and E. vogeli. Discovered in the Shiqu County, the Qinghai-tibet

plateau region of western Sichuan, the People’s Republic of China (57, 58), E. shiquicus is morphologically distinct both in adult and larval stages from other species.

A number of interspecific and intraspecific variants have been described for E. granulosus. Some genotypes of

E. granulosus exhibit characteristic features that would justify the recognition as separate species according to some authors. Recently other species and genotypes of Echinoccocus have been proposed (51). Further studies are needed to define the full range of genetic diversity (32, 37, 43, 50). Echinococcus granulosus has a global distribution; E. multilocularis occurs in wide areas of the Northern Hemisphere, E. shiquicus is found in the People’s Republic of China and E. oligarthrus and E. vogeli are confined to Central and South America. All five species are infective to humans causing various forms of echinococcosis. Human cystic echinococcosis, caused by E. granulosus and alveolar echinococcosis, caused by E. multilocularis, are important public health threats in many parts of the world (56).

Table 1. Useful characteristics for identification of Echinococcus species. Source: Xiao et al. (58)

E. granulosus E. multilocularis E. oligarthus E. vogeli E. shiquicus

Distribution Cosmopolitan Holoarctic region Neotropical region Neotropical region Tibet plateau

Definitive Host Dogs Foxes Wild felids Bush dog Tibetan fox

Intermediate Host Ungulates Microtine rodents Neotropical rodents Neotropical rodents Plateau pika Adult: Body length (mm) No. segments Length of large hooks (µm) Length of small hooks (µm) No. testes 2.0–11.0 2–7 25.0–49.0 17.0–31.0 25–80 1.2–4.5 2–6 24.9–34.0 20.4–31.0 16–35 2.2–2.9 3 43.0–60.0 28.0–45.0 15–46 3.9–5.5 3 49.0–57.0 30.0–47.0 50–67 1.3–1.7 2–3 20.0–23.0 16.0–17.0 12–20 Position of genital pore a. Mature segment b. Gravid segment Near to middle Posterior to middle Anterior to middle Anterior to middle Anterior to middle Near to middle Posterior to middle Posterior to middle

Near to upper edge Anterior to middle

Gravid uterus Branching laterally

Sac-like Sac-like Tubular Sac-like

Metacestode Unilocular cysts

in viscera Multilocular cysts in viscera Polycystic cysts in muscles Polycystic cysts in viscera Unilocular cysts in viscera

o Echinococcus granulosus

The parasite is transmitted between the domestic dog and a number of domestic ungulate species. The dog/sheep cycle is most important. Sylvatic definitive and intermediate hosts also occur, e.g. wolf/cervid. The adult varies between 2 and 11 mm in length and usually possesses from two to seven segments, averaging from

(3)

three to four segments. The penultimate segment is mature, and the genital pore normally opens posterior to the middle in both mature and gravid segments. The last (gravid) segment is usually more than half the length of the entire worm. There are rostellar hooks of various sizes on the protoscolex in two rows. The size of the hooks varies between 25 to 49 µm in the first row, and between 17 and 31 µm in the second row. The gravid uterus has well-developed sacculations.

The larval stage is a fluid-filled bladder or hydatid cyst that is unilocular, although communicating chambers also occur. Growth is expansive, and endogenous daughter cysts may be produced. Individual bladders may reach up to 30 cm in diameter and occur most frequently in liver and lungs, but may develop in other internal organs. The infection with this stage is referred to as cystic echinococcosis.

The strain specificities of E. granulosus in domestic cycles include, dog/sheep in the Mediterranean region, South America (Argentina, Brazil, Chile, Peru and Uruguay), Africa (Ethiopia, Kenya and Sudan), the Middle East and Levant regions, Russia, Central Asia (Kazakhstan, Kyrgyzstan and Uzbekistan), Mongolia, the People’s Republic of China, Oceania and the United Kingdom; dog/horse in Belgium, Ireland and the United Kingdom; dog/cattle in Belgium, Germany, South Africa and Switzerland; dog/swine in Poland; and dog or wolf/reindeer in sub-Arctic regions of Norway, Finland and Alaska. The status of dog/camel strains requires further elucidation. This strain has recently been identified in human cases in Argentina, Nepal, the People’s Republic of China and Iran (3, 19, 44, 59). To date, all genotypes of E. granulosus except the dog/horse (G4) and the Finnish cervid (G10) strains have been found to infect humans.

o Echinococcus multilocularis

The parasite is transmitted primarily between wild definitive hosts (e.g. Vulpes vulpes, V. ferrilata, V. corsac,

Alopex lagopus, Canis latrans) and small arvicolid rodents (voles and lemmings). The adult varies between

1.2 and 4.5 mm in length and usually possesses from two to six segments, with an average of four to five. The penultimate segment is characteristically mature, and the genital pore is anterior to the midline in both mature and gravid segments. The gravid uterus is sac-like. On the rostellum, the larger hooks of the first row vary in size between 24.9 and 34.0 µm and the smaller hooks of the inner row between 20.4 and 31.0 µm.

The metacestode is a multivesicular structure consisting of conglomerates of small vesicles, usually not exceeding a few millimetres in diameter. Unlike E. granulosus, the larval mass often contains a semisolid rather than a fluid matrix. It proliferates by exogenous budding, which results in infiltration of tissues. Infection with this stage is commonly referred to as alveolar echinococcosis. There is no clear evidence for distinct strains or genotypes of

E. multilocularis, though regional variations at the continental scale have been described (56).

This zoonotic parasite is found in the Northern Hemisphere, and its life cycle is mainly maintained in wildlife (25). The sylvatic cycle involves foxes and many species of wild rodents. Coyotes, raccoon dogs, wolves, wild cats, domestic dogs and cats (20, 27), however, may serve as definitive hosts while pigs, horses, primates and humans can be infected as intermediate hosts (25).

o Echinococcus oligarthrus

The parasite typically uses neptropical wild felids as definitive hosts (e.g. Felis concolor, F. jaguarundi) and large rodents (e.g. Dasyprocta sp., Cuniculus paca) as intermediate hosts. The adult varies between 2.2 and 2.9 mm in length, and normally possesses three segments, the penultimate of which is mature. The genital pore is anterior to the middle in mature segments and approximately at the middle in gravid segments. The gravid uterus is sac-like. The metacestode is polycystic and fluid-filled with a tendency to become septate and multichambered. The rostellar hooks of the protoscolex vary in length between 25.9 and 37.9 µm. The hooks are described in more detail in the next section and compared with those of E. vogeli. The single cyst may reach a diameter of approximately 5 cm. Predilection sites are internal organs and muscles. To date, there have only been a few reports of human disease. The parasite appears not to mature in dogs.

o Echinococcus vogeli

The parasite typically uses the South American bush dog (Speothus venaticus) as a wild definitive host, but the domestic dog is susceptible, as are large rodents (e.g. Cuniculus paca) as intermediate hosts. The adult varies between 3.9 and 5.5 mm in length, and usually has three segments, the penultimate of which is mature. The genital pore is situated posterior to the middle in both the mature and gravid segments. The gravid uterus has no lateral sacculations and is characterised by being relatively long and tubular in form, compared with the other segments, which are sac-like.

The metacestode is similar to that of E. oligarthrus. It has been reported that the two species can be distinguished by comparing differences in the dimensions and proportions of the rostellar hooks on the protoscolex. The hooks of E. oligarthrus vary in length between 25.9 and 37.9 µm (average 33.4 µm) and between 22.6 and 29.5 µm (average 25.45 µm) for large and small hooks, respectively. Those of E. vogeli vary between 19.1 and 43.9 µm

(4)

(average 41.64 µm) and between 30.4 and 36.5 µm (average 33.6 µm) for the large and small hooks, respectively. Also the hook-guard for E. oligarthrus divides the hook 50:50, compared with 30:70 for E. vogeli.

Echinococcus vogeli is a zoonotic agent with approximately 100 human cases reported in South America. The infection caused by the larval stage of this species is commonly referred to as polycystic echinococcosis.

o Echinococcus shiquicus

The parasite was found in the Tibetan fox (Vulpes ferrilata) its definitive host and the plateau pika (Ochotona

curzoniae), the intermediate host. In most species of Echinococcus, the gravid segment is connected to a mature

segment; however, a strobila consisting of only two segments (a gravid segment directly attaching to a premature segment) is unique to this species (56). The adult stage is morphologically similar to E. multilocularis but differs by its smaller hooks, fewer segments, upper position of genital pore in the premature segment and fewer eggs in the gravid segment. It is easily distinguishable from E. granulosus by its shorter length, branchless gravid uterus and anterior position of genital pore in the gravid segment. The adult measures 1.3 to 1.7 mm.

The metacestode is found in the liver and is essentially a unilocular minicyst containing fully developed brood capsules; however, oligovesicular forms have also been observed. It is differentiated from E. granulosus having no daughter cysts appearing within the fertile cyst (56).

A detailed description of echinococcosis in humans and animals can be found in the WHO/OIE Manual on echinococcosis (56).

B. DIAGNOSTIC TECHNIQUES

1. Identification of the agent

In the intermediate host, diagnosis depends on the detection of the larval cyst form, which can occur in almost any organ, but particularly in the liver and lungs. The diagnosis of echinococcosis in dogs or other carnivores requires the demonstration of the adult cestodes of Echinococcus spp. in their faeces or the small intestine or the detection of specific coproantigens or coproDNA.

Investigators carrying out these procedures are exposed to the risk of infection and severe disease, which must be minimised by appropriate procedures. Infective material can be decontaminated by freezing at –80°C (core temperature) for 48 hours, or –70°C for 4 days or by heating to 70°C for 12 hours (41, 45). Face masks, disposable gloves and an apron must be worn. Chemical disinfection is not reliable, although sodium hypochlorite may destroy a proportion of eggs (8). Contaminated material must be destroyed by heat; hot water, at temperature of 85°C or above, is very effective. The decontamination of laboratories can be achieved at reduced humidity (40%) combined with increased room temperature (30°C) for at least 48 hours.

a) Diagnosis of Echinococcus eggs in environmental samples

o Faecal samples (22, 49)

This is a concentration method in which a saturated solution is used to separate Echinococcus eggs from faeces. A faecal sample of 0.5–2 g is mixed with water or 0.3% Tween 20 in 1% formalin (42) in a 10–15-ml test tube and centrifuged (1000 g for 10 minutes) once or twice until the supernatant is clear. Sediment is mixed with either zinc sulphate 33% (1.18 sp. Gr.) or sucrose solution (1.27 sp. Gr.) and centrifuged at 1000 g for 5–10 minutes. The test tube is filled to the top and a glass is placed on the tube. The cover-glass is examined microscopically 2–16 hours later.

o Soil samples (35)

A 20-g soil sample is placed in a 50-ml conical tube to which is added 40 ml of 0.05% Tween 80. The mixture is stirred vigorously and sieved through a 100-µm mesh. The suspension is centrifuged at 1000 g for 5 minutes and the supernatant is discarded. The remaining procedure follows the concentration method used for faecal sample examination.

b) Diagnosis of larval echinococcosis

o Necropsy

Whereas surveillance for E. granulosus in domestic animals may take place in licensed slaughter houses, that for Echinococcus sp. in wildlife must be done by field surveys. Specimens should be preserved by removal of tissue and fixation in 4% formal saline or kept cool at +4°C and deep-frozen at –20°C for subsequent examination. When undertaking surveillance work with E. granulosus in intermediate hosts, it is vitally important that data are stratified and reported according to the age of animals slaughtered. Prevalence

(5)

rates are strongly age dependent (53) and reports from abattoirs that may slaughter only young animals will substantially under-represent the true situation. This is because older animals may be heavily infected even when animals have very few larvae.

Larvae can be observed in many organs, but in large animals, such as sheep and cattle, palpation or incision should be done. Pigs, cattle, sheep and goats may be infected with larval Taenia hydatigena, and it is sometimes difficult to differentiate between these two parasites when they occur in the liver. In wild animals, such as ruminants and rodents, several other larval cestodes should be considered for differential diagnosis. Formalin-fixed material can be stained by conventional histological techniques. The presence of a periodic-acid-Schiff (PAS) positive acellular laminated layer, underlying a connective tissue layer, and with or without an internal cellular, nucleated germinal membrane can be regarded as a specific characteristic of the metacestodes of Echinococcus spp. The presence of protoscoleces within brood-capsules or in hydatid sand is also diagnostic for the genus. Genotyping of E. granulosus or E. multilocularis is usually done on DNA derived from protoscoleces or larval tissue material that is frozen, refrigerated or preserved in 90% ethanol.

c) Diagnosis of adult parasites in carnivores

o Necropsy

Necropsy is invariably employed in studies of echinococcosis in wildlife and is useful if domestic dogs are humanely culled. It should be emphasised that it is necessary to isolate and identify the adult Echinococcus, because under normal conditions of faecal examination, the eggs of Echinococcus cannot be differentiated from those of Taenia spp. The eggs of E. granulosus and E. multilocularis can now be identified and differentiated from other taeniid eggs by polymerase chain reaction (PCR).

The small intestine is removed as soon as possible after death, and tied at both ends. If the material is not frozen or formalin fixed (4–10%), it should be examined quickly, as the parasite can be digested within 24 hours. Formalin does not kill eggs. The fresh intestine is divided into several sections and immersed in 0.9% saline at 37°C for examination. Worms adhering to the intestinal wall may be observed and counted by means of a hand lens (for E. granulosus and E. vogeli). For accurate counts, the unfixed intestine is best divided into four or six sections, opened up and immersed in 0.9% saline at 37°C for 30 minutes to release the parasites. The contents are washed into another container for detailed examination, and the intestinal wall is scraped with a spatula. All material is boiled and washed by sieving to eliminate most of the particulate material and to make it noninfectious. The washed intestinal contents and scrapings are placed on a black tray, and the worms are counted with the aid of a hand lens or stereoscopic microscope.

Echinococcus granulosus is usually found in the first third of the small intestine of dogs and E. multilocularis

in the mid/posterior sections.

Necropsy is considered to be the most reliable form of diagnosis for E. multilocularis in definitive hosts. It is an inexpensive method for determining the prevalence in a population and the best way to determine worm burden (15). Carcasses or intestines of definitive hosts for examination should be deep frozen at between –70°C and –80°C for 3–7 days before necropsy to kill any eggs. Eggs of E. multilocularis are resistant to freezing to –50°C.

Methods for quantitative determination of E. multilocularis in definitive host’s intestine. o Sedimentation and counting technique (SCT; 16, 21)

This technique can be regarded as the ‘gold standard’ for assessing the sensitivity and specificity of other techniques.

i) The small intestine is incised longitudinally and cut into 20 cm long segments or into 5 pieces of approximately the same length. These pieces are transferred to a glass bottle containing 1 litre physiological saline (0.9% NaCl) solution.

ii) The glass bottle is shaken vigorously for a few seconds and the pieces of intestine are removed. The superficial mucosal layer is stripped by exerting pressure between thumb and forefinger to dislodge attached helminths.

iii) The glass bottle is left for 15 minutes for sedimentation to occur; the supernatant is then decanted. The glass bottle is refilled with physiological saline solution. This procedure is repeated 2–6 times until the supernatant is cleared of coloured particles.

iv) The sediment fraction is examined in small portions of about 5–10 ml in rectangular plastic or Petri dishes with a counting grid (9 × 9 cm) in transmission light under a stereomicroscope at a magnification of ×120.

(6)

v) If up to 100 worms are found, the entire sediment fraction is checked; if higher numbers are present, the total worm burden is calculated from the count of one subsample.

o Intestinal scraping technique (IST; 12, 17)

i) Deep mucosal scrapings are taken at nearly equal distances from the small intestine using microscope slides (75 × 25 × 1 mm). Five mucosal scrapings from proximal, middle and posterior thirds of the small intestine (total 15) are recommended. Adherent materials are transferred to a square plastic Petri dish. ii) Scrapings are squashed between slides and examined under a stereoscopic light microscope (×120).

Three slides are placed in one plastic dish and examined. Echinococcus multilocularis is usually found in the second half of the small intestine.

o ‘Shaking in a vessel’ technique (SVT; 15)

i) A plastic vessel (1 litre), which has a plastic screw-on lid with a central hole 6–7 cm in diameter is used. The hole is covered with a high-grade steel mesh (mesh size 500 µm) fixed into the remaining plastic ring with a hot soldering iron. Silicone is applied to seal the edges of the steel mesh.

ii) The longitudinally opened small intestine is transferred to the vessel with all its contents; the vessel is closed with the lid and filed with water.

iii) The vessel is inverted and shaken; the water is decanted. Vessel is refilled with water, and the process is repeated until the decanted water is clear.

iv) The half-filled vessel is opened and the intestines are removed. The intestines are stripped between the thumb and forefinger to dislodge parasites stuck to the mucosa into the vessel.

v) The vessel is closed again, refilled and shaken one last time draining as much water from it as possible.

vi) The remaining sediment is filled into a 1 litre plastic jug and stored at 4°C. For prolonged storage, a 0.9% NaCl solution is added to the sediment to prevent the parasites from shrinking.

vii) For analysis, the materials are placed into small glass Petri dishes and scanned along engraved lines using the stereomicroscope as above.

o Preserving specimens

Intact worms are fragile and for morphological studies are best handled in normal saline with a Pasteur pipette. They are washed free of other material and left for approximately 30 minutes for all movement to cease. After removal of the fluid, cold 5–10% formalin (5°C) or FAA fixative (95% ethanol [80 ml], 37– 40% formaldehyde [10 ml], and glacial acetic acid [5 ml]) is added and the worms are left for a further 12 hours. For staining, the worms are washed in water for 15 minutes and transferred to Mayer’s paracarmine (carminic acid [1.0 g], aluminium chloride [0.5 g], calcium chloride [4.0 g], and 70% ethanol [100 ml]) for 12–24 hours. Excess stain is removed by immersion in 0.5–1.0% hydrochloric acid solution for a few seconds. Dehydration is accomplished by serial passage in ascending concentrations of alcohol (41, 50, 70, 85, 95, and 100%) for at least 15 minutes in each, with two changes in 100%. The alcohol is removed by xylol (10 minutes) and cleared with methyl salicylate or creosote. Prior to mounting in any suitable medium such as balsam, picolyte, etc., the specimens should be returned to the xylol for a few minutes. Persons involved in such examinations should receive serological screening for anti-Echinococcus serum-antibodies at least once a year (56).

Recently, some methods have been developed with the aim of simplifying and improving epidemiological investigations in final host populations and of allowing diagnosis in living animals. These methods include the detection of coproantigens and PCR DNA detection (see below).

d) Arecoline surveys and surveillance

Arecoline has been used to perform surveys of tapeworm infections in dog populations. Its use as a control agent has now been superseded by praziquantel. Arecoline is a parasympathomimetic agent. Its action results in sweating, and stimulation of salivary, lachrymal, gastric, pancreatic, and intestinal glands. It increases intestinal tonus and the mobility of smooth muscle, and this effect is responsible for purgation. The liver is the principal site of detoxification. Arecoline also has a direct action on the worm itself, by causing paralysis, but not death, and thereby making it relax its hold on the intestinal wall. Thus, it must be administered by the oral route. The accompanying purgation carries the worms out with the faeces. It is particularly suitable for baseline surveys of E. granulosus, however, 15–25% of dogs may not purge. Arecoline may also be used to purge dogs infected with E. multilocularis. In animals, arecoline purgation has been useful; again, the recovered tapeworms are identified morphologically. Products containing arecoline are no longer available as an anthelmintic, but can be obtained from chemical supply companies. As it has side-effects, old, infirm and pregnant animals should be excluded from treatment. A dose of 4 mg/kg should

(7)

result in purgation in under 30 minutes. Walking and abdominal massage of recalcitrant cases or enema for constipated dogs may avoid the use of a second dose (2 mg/kg), which should be given only sparingly. Dogs that are purged successfully may produce at least two motions; the first will be formed faeces and can be ignored (or collected for laboratory tests as described later), but the mucus that follows may be productive. This can be divided into several samples and each examined separately, but this method is not recommended as the worms will be difficult to detect. Preferably, the mucus sample (about 4 ml) is diluted with 100 ml of tap water, covered with a thin layer of 1 ml of kerosene (paraffin) and boiled for 5 minutes. The kerosene prevents foaming and reduces the smell.

Investigators carrying out these procedures are exposed to risk of infection and severe disease. Personnel should wear whole body coveralls, boots, disposable gloves and a face mask. Coveralls should be boil washed after use, and boots disinfected in 10% sodium hypochlorite solution. The purge should be boiled as soon as possible after collection. Dogs may continue to pass eggs, proglottides and worms after the first purge, therefore, they should remain tethered for 2 hours after purgation and given access to drinking water. After arecoline testing, the area of ground used to tether dogs should be sprayed with kerosene and flamed.

e) Coproantigen tests

An alternative to arecoline testing, based on a faecal antigen-detection antibody sandwich enzyme-linked immunosorbent assay (ELISA), has been developed and has shown particular promise as coproantigens can be detected shortly after infection (10–14 days) and the level declines rapidly following expulsion of the worms. The sensitivity and specificity of the test have been estimated at 70% and 98%, respectively (2, 5, 8, 12, 13).

Both qualitative and quantitative results can be obtained from arecoline testing, which is most useful for base-line epidemiological studies on the comparative rates of infection with Taeniidae in dogs. Further studies may show that the coproantigen test may be more cost-effective than arecoline testing during routine surveillance of E. granulosus in the dog population (6).

ELISAs for specific coproantigen have now been developed that have sufficient specificity and sensitivity to replace arecoline testing for detecting Echinococcus in dogs and other definitive hosts (8). When testing for genus-specific Echinococcus coproantigens (against necropsy as a gold standard), specificity is around 98% and overall sensitivity approximately 70%; however, when mean worm burdens are >50–100, sensitivity approaches 100% (2, 8, 9, 13). Dogs, dingoes, foxes and wolves have been screened successfully for coproantigen ELISAs and, importantly, E. multilocularis worm infestations are also detectable in red foxes and domestic dogs (13, 46). When the capture ELISA uses either anti-ES or anti-somatic proglottid antibodies to E. granulosus, the sensitivity for E. multilocularis infection may be reduced, though genus specificity remains intact. Polyclonal- or monoclonal-antibody-based ELISAs for coproantigens exhibit high sensitivity and specificity to E. granulosus (~80%), even though they were developed for E. multilocularis (11, 44). However, for low worm burdens (<50), the sensitivity of the E. multilocularis coproantigen ELISA is below that of the mucosal smear method at necropsy (11).

The exact nature of Echinococcus antigens released in faeces for coproantigen detection has not been fully characterised. However, their stability in 5% formal saline after boiling and susceptibility to periodate treatment suggest involvement of large (>150 KDa) of carbohydrate antigen(s) with mannose, α-D-glucose, β-galactose and N-acetyl-β-glucosamine residues (8, 18).

Coproantigens can be detected prior to release of eggs by Echinococcus worms, and therefore are not related to egg antigen(s) (13, 44). This has the advantage of detection of prepatent infections. Furthermore, coproantigen levels return to the preinfection baseline within 5 days of anthelminthic treatment of infected dogs (13). More importantly, it reduces the biohazardous risk of exposure of personnel to potentially infective eggs during purgation or necropsy (26).

For detection of E. multilocularis infection of foxes, necropsy is time-consuming. Coproantigen testing by ELISA offers a specific practical alternative. Fox faecal samples should be taken at post-mortem from the rectum rather than from the small intestine. Echinococcus coproantigens are also stable in fox or dog faeces left at 20°C for 1 week and in frozen dog faeces. Coproantigen testing has also been successfully used to evaluate he efficacy of deworming wild foxes infected with E. multilocularis using praziquantel-laced bait, which proved to be a successful combination of eliminating the source of infection (24).

o Coproantigen test procedure (Echinococcus granulosus) (2, 9)

i) The faecal sample (collected per rectum or from the ground) is mixed with an equal volume of phosphate buffered saline (PBS), pH 7.2, containing 0.3% Tween 20 (PBST), in a capped 5 ml

(8)

disposable tube. This is shaken vigorously and centrifuged at 2000 g for 20 minutes at room temperature. Faecal supernatants can be tested immediately or stored at –20°C or lower. Supernatants that appear very dark or viscous are still acceptable for use.

ii) A 96-well ELISA microtitre plate (Immulon #4, Thermo Electron Corporation) is coated with optimal concentration (typically 5 µg per ml) of a protein A purified IgG fraction of rabbit anti-E. granulosus proglottid extract (2) in 0.05 M bicarbonate/carbonate buffer, pH 9.6 (100 µl per well). The plate is covered and incubated overnight at 4°C.

iii) The wells are rinsed three times in PBST with 1 minute between washes; 100 µl of the same buffer is added to each well, and the plate is incubated for 1 hour at room temperature.

iv) The PBST is discarded and 50 µl of neat fetal calf serum is added to all wells. This is followed by the addition of 50 µl per well of faecal sample supernatants is added (in duplicate wells). The plate is incubated at room temperature for 1 hour with clingfilm seal covering the plate.

v) The wells are rinsed as in step iii, but the contents are discarded into a 10% bleach (hypochlorite) solution.

vi) An optimal dilution concentration of around 1 µg/ml of an IgG rabbit anti-E.-granulosus proglottid extract peroxidase conjugate (2) in PBST is prepared and 100 µl per well is added to all wells. The plate is incubated for 1 hour at room temperature (22–24°C).

vii) The wells are rinsed as in step iii.

viii) Next, 100 µl per well of tetramethyl benzidene substrate (TMB, KPL Labs) is added and the plate is left in the dark for 20 minutes at room temperature (22–24°C).

ix) Absorbance of wells is read at 630 nm. The enzyme-substrate reaction is stopped by adding 100 µl of 1 M phosphoric acid (H3PO4) to each well. The colour turns from blue to yellow if positive.

x) Laboratories should establish their own end-point criteria using standard positive and negative samples. Standards can also be obtained from the OIE Reference Laboratories (see Table given in Part 3 of this Terrestrial Manual). Usually, the positive to negative threshold is taken as 3 standard deviations above the mean absorbance value of control negatives, or against a reference standard control positive using absorbance units equivalence.

o Coproantigen test procedure (Echinococcus multilocularis) (39, 42)

Sandwich ELISA using a monoclonal antibody EmA9 raised against adult E. multilocularis somatic antigen (28).

i) 0.5 g of each faecal sample is placed in a centrifuge tube and a 1% formalin solution containing 0.3% Tween 20 is added to a total volume of 15 ml.

ii) After adequate mixing, the faecal solution is centrifuged at 1200 g for 10 minutes at room temperature. A supernatant fraction is used for the coproantigen detection assay.

iii) Flat-bottomed microtitre plates (Immulon 600, Greiner, Germany) are coated with 50 µl/well of 1 µg/ml rabbit IgG directed against adult E. multilocularis excretory/secretory (ES) products in 0.05 M NaHCO3/Na2CO3 buffer (pH 9.6) and are left overnight at 4°C.

iv) The plates are washed three times with 250 µl/well PBS (pH 7.4) containing 0.05% Tween 20 (PBST), and blocked using 100 µl/well 1% bovine serum albumin (BSA) in PBS for 1 hour at room temperature (22–24 C).

v) The plates are washed three times (with the wash disinfected with 10% bleach) and 50 µl of faecal supernatant is added to each well and the plates are incubated for 2 hours.

vi) The plates are again washed four times and 0.5 µg/ml of the biotinylated monoclonal antibody in 0.5% BSA/0.5% casein in PBST is added to each well and the plates are incubated for 1 hour.

vii) The plates are washed four times and streptavidine-biotinylated horseradish peroxidase complex (Amersham Life Science), diluted 1/1000 in 0.5% BSA/0.5% cCasein in PBST is added to each well and the plates are incubated for 1 hour.

viii) The plates are washed five times and 100 µl/well of substrate solution (20 mg of phenylenediamine (Wako) in 50 ml of 0.1 M citric phosphate buffer with 10 µl of H2O2) is added.

ix) The plates are shaken immediately and placed in a 37°C incubator for 30 minutes. The reaction is stopped by adding 50 µl/well of 4 N H2SO4. The optical densities (OD) of the plates are read at 490 nm. x) The cut-off value is calculated as the mean OD value plus 3 standard deviations of samples from

(9)

This procedure was also used in a sandwich ELISA for E. granulosus coproantigen detection (45). In 2008, a latex agglutination test and immunochromatography in-house kit using EmA9 became available for coproantigen detection (23, 41).

f) DNA recognition methods

Definitive hosts: Copro-DNA has proven to be of value for the diagnosis of Echinococcosis in animal definitive hosts. DNA isolation from the faeces, however, is laborious.

PCR is a technically demanding and expensive technique. It is currently used mainly for confirmatory testing of coproantigen-positive samples or for identification of taenid eggs recovered from faeces. Table 2 presents the different PCR primers used for identification of copro-DNA from faeces in definitive hosts of genus

Echinococcus.

Differential diagnosis of E. granulosus and E. multilocularis infections in definitive hosts may be achieved by specific detection of PCR-amplified DNA from E. multilocularis eggs present in faeces (4, 32). In practice, it is recommended to screen definitive hosts (e.g. foxes) using the coproantigen test and confirm with the PCR DNA test. In Europe, transmission of E. multilocularis generally occurs in regions where E. granulosus is not endemic or appears very infrequently. In other regions, including parts of the Near East (Turkey and Iran), Central Asia, Russia and the People’s Republic of China, these two species may occur together (10). Further evaluation of E. multilocularis infection is required to investigate intermittent shedding and duration of shedding of parasite DNA. Recently PCR has been developed for the detection of copro-DNA for

E. granulosus and for genotypic differentiation. (36, 55)

As PCR is generally used as a confirmatory test, it is suggested to concentrate the taeniid eggs by sequential sieving and an in-between concentration method step. DNA isolation from these eggs can be achieved using a simplified protocol of the alkaline lysis method combined with a commercial kit with no need for organosolvent extractions (30).

Table 2. PCR primers used for copro-DNA detection (modified from Mathis & Deplazes [34])

Primer designation: primer sequences (5’–3’) Ref. Target, comments

E. multilocularis

GTG-AGG-CGA-TGT-GTG-GTG-ATG-GAG-AGA-AGG CAA-GTG-GTC-AGG-GGC-AGT-AG

4 U1 sRNA gene: may yield non-specific products when used with metacestode material containing host DNA (unpublished observation) Mitochondrial 12S RNA gene; used in two-tube

nested PCR Outer primers: (P60 forward) TTA-AGA-TAT-ATG-TGG-TAC-AGG-ATT-AGA-TAC-CC (P375 reverse) AAC-CGA-GGG-TGA-CGG-GCG-GTG-TGT-ACC Inner primers: (Pnest forward) ACA-ATA-CCA-TAT-TAC-AAC-AAT-ATT-CCT-ATC (Pnest reverse) ATA-TTT-TGT-AAG-GTT-GTT-CTA

14 Mitochondrial 12S RNA gene; modified from ref. 14 for use in one-tube nested PCR

Table 2 cont. PCR primers used for copro-DNA detection (modified from Mathis & Deplazes [34])

Primer designation: primer sequences (5’–3’) Ref. Target, comments

Outer primers: (Em-1)

54 Mitochondrial 12S RNA gene; modified from ref. 14 for use in single PCR

(10)

TAA-GAT-ATA-TGT-GGT-ACA-GGA-TTA-GAT-ACC-C (Em-2) GGT-GAC-GGG-CGG-TGT-TGT-A Inner primers: (Em-3) ATA-TTA-CAA-CAA-TAT-TCC-TAT-C (Em-4) ATA-TTT-TGT-AAG-GTT-GTT-CTA (EM-H15) CCA-TAT-TAC-AAC-AAT-ATT-CCT-ATC (EM-H17) GTG-AGT-GAT-TCT-TGT-TAG-GGG-AAG

48 NADH dehydrogenase subunit 1 (ND1) of mtDNA; cleavage with enzyme Cfo1 distinguish

E. multilocularis from E. granulosus

E. multilocularis and E. granulosus ND1

(NDfor2-)

AGT-TTC-GTA-AGG-GTC-CTA-ATA (NDrev2-)

CCC-ACT-AAC-TAA-CTC-CCT-TTC

38 Repeated sequences from E. granulosus. ‘sheep strain’; yields banding pattern upon

electrophoresis

Mitochondrial 12SRNA gene; specific for

E. granulosus ‘sheep strain’ Amplify a fragment of the coxI genespecific fo

E. granulosus E. granulosus (Eg1121a) GAA-TGC-AAG-CAG-CAG-ATG (Eg1122a) GAG-ATG-AGT-GAG-AAG-GAG-TG 1 (Eg1f) CATTAATGTATTTTGTAAAGTTG (Eg1r) CAC-ATC-ATC-TTA-CAA-TAA-CAC-C 47 (EgO/DNA-IM1) forward TCA-TAT-TTG-TTT-GAG-KAT-YAG-TKC reverse GTA-AAT-AAM-ACT-ATA-AAA-GAA-AYM-AC 40

Table 2 cont. PCR primers used for copro-DNA detection (modified from Mathis & Deplazes [34])

Primer designation: primer sequences (5’–3’) Ref. Target, comments

E. multilocularis, E. granulosus and Taeniid spp. (JB11)

52 Cestodes

(11)

AGA-TTC-GTA-AGG-GGC-CTA-ATA (JB12) AC-CAC-TAA-CTA-ATT-CAC-TTT-C (60.for.-mod) ATG-TGG-TAC-AGG-ATT-AGA-TAC-CC (375.rev.-mod) GGT-GAC-GGG-CGG-TGT-GTA-CC Cestodes (Eg1f) CAT-TAA-TGT-ATT-TTG-TAA-AGT-TG (Eg1r) CAC-ATC-ATC-TTA-CAA-TAA-CAC-C

52 Echinococcus granulosus (sheep strain)

(EM-H15) CCA-TAT-TAC-AAC-AAT-ATT-CCT-ATC (EM-H17) GTG-AGT-GAT-TCT-TGT-TAG-GGG-AAG 52 E. multilocularis (Cest1) TGC-TGA-TTT-GTT-AAA-GTT-AGT-GAT-C (Cest2) CAT-AAA-TCA-ATG-GAA-ACA-ACA-ACA-AG 52 E. multilocularis (Cest4) GTT-TTT-GTG-TGT-TAC-ATT-AAT-AAG-GGT-G 52 E. granulosus (Cest5) GCG-GTG-TGT-ACM-TGA-GCT-AAA-C 52 Taenia spp. (Cest3) YGA-YTC-TTT-TTA-GGG-GAA-GGT-GTG (Cest5) GCG-GTG-TGT-ACM-TGA-GCT-AAA-C (Cest5seq) GAT-TCT-TTT-TAG-GGG-AAG-G

52 Taenia spp. (Sequencing primer for the

267 bp amplicon of the multiplex PCR)

Intermediate hosts: DNA hybridisation methods are not currently used for the detection of E. granulosus in livestock intermediate hosts. Molecular methods are, however, important in identification of isolates or strains of E. granulosus for epidemiological purposes (37).

For the identification of small, degenerated or calcified lesions of E. multilocularis in intermediate or aberrant hosts, PCR is of great value (33).

2. Serological tests

a) Intermediate hosts

Immunological tests, useful in humans, are less sensitive and specific in livestock and at present cannot replace necropsy (8, 30).

b) Definitive hosts

An extensive programme has been initiated to develop immunodiagnostic tests to control canine echinococcosis. Following ingestion of a cyst, dogs will be exposed at the intestinal level to various antigens during the establishment of the parasite and its development and oogenesis. Specific antibodies against oncosphere and protoscolex antigens can be readily detected in the serum of infected dogs. This methodology has not reached a practical stage as it does not differentiate between current and previous infections and false positives may occur with infections of Taenia species.

(12)

C. REQUIREMENTS FOR VACCINES AND DIAGNOSTIC BIOLOGICALS

1. Intermediate hosts

Application of an effective vaccine to reduce hydatid infection in livestock would be likely to have a substantial impact on the rate of transmission of the disease to humans (29). As E. granulosus belongs to the Taeniid family, many aspects of its immunological relationship with its intermediate host are similar to that occurring in Taenia species. Moreover, it was considered that the vaccine development approach used in Taenia species such as the native host-protective antigens of T. ovis would also be successful for E. granulosus. Using recombinant DNA technology, an oncosphere antigen vaccine EG95 was shown to be capable of inducing a high level of protection against experimental challenge infection with E. granulosus eggs in sheep (31).

The EG95 vaccine has been licensed by the University of Melbourne and AgResearch New Zealand to a commercial group in the People’s Republic of China (29).

2. Definitive hosts

While considerable research has been undertaken with crude antigens to protect dogs from echinococcosis, only limited evidence has been demonstrated so far. Recent studies using recombinant protoscolex antigens, however, look encouraging (7). Basic research on canine mucosal immunology and Echinococcus infection is required for progress.

REFERENCES

1. ABBASI I.,BRANZBURG A.,CAMPOS-PONCE M.,ABDEL HAFEZ S.K.,RAOUL F.,CRAIG P.S.&HAMBURGER J. (2003). Copro-diagnosis of Echinococcus granulosus infection in dogs by amplification of a newly identified repeated DNA sequence. Am. J. Trop. Med. Hyg., 69, 324–330.

2. ALLAN J.C.,CRAIG P.S.,GARCIA NOVAL J.,MENCOS F.,LIU D.,WANG Y.,WEN H.,ZHOU P.,STRINGER R.,ROGAN

M.T.&ZEYHLE E. (1992). Coproantigen detection for the immunodiagnosis of echinococcosis and taeniasis in

dogs and humans. Parasitology, 104, 347–355.

3. BART J.M.,ABDUKADER M.,ZHANG Y.L., LIN R.Y.,WANG Y.H., NAKAO M.,ITO A.,CRAIG P.S., PIARROUX R.,

VUITTON D.A. & WEN H. (2006). Genotyping of human cystic echinococcosis in Xinjiang, PR China. Parasitology, 133, 571–579.

4. BRETAGNE S.,GUILLOUN J.P.,MORAND M.&HOUIN R. (1993). Detection of Echinococcus multilocularis DNA in

fox faeces using DNA hybridization. Parasitology, 106, 193–199.

5. BUISHI I., NJOROGE E. M., BOUAMRA O. & CRAIG P. (2005). Canine echinococcosis in northwest Libya: assessment of coproantigen ELISA, and a survey of infection with analysis of risk factors. Vet. Parasitol., 130, 223–232.

6. BUISHI I., WALTERS T.,GUILDEA Z.,CRAIG P.&PALMER S.(2005). Re-emergence of canine Echinococcus

granulosus infection, Wales. Emerg. Infect. Dis., 11 (4), 568–571.

7. CHABALGOITY J.A.,MORENO M.,CAROL H.,DOUGAN G.&HORMAECHI E. (2001). Salmonella typhimurium as a

basis for a live oral Echinococcus granulosus vaccine. Vaccine, 19, 460–469.

8. CRAIG P.S. (1997). Immunodiagnosis of Echinococcus granulosus and a comparison of techniques for

diagnosis of canine echinococcosis. In: Compendium on Cystic Echinoccosis in Africa and in Middle Eastern Countries with Special Reference to Morocco, Andersen F.L., Ouhelli H. & Kachani M., eds. Brigham Young University Print Services, Provo, Utah, USA.

9. CRAIG P.S.,GASSER R.B.,PARADA L.,CABRERA P.,PARIETTI S.,BORGUES C.,ACUTTIS A.,AGULLA J.,SNOWDEN

R. & PAOLILLO E. (1995). Diagnosis of canine echinococcosis: comparison of coproantigen and serum

antibody tests with arecoline purgation in Uruguay. Vet. Parasitol., 56, 293–301.

10. CRAIG P.S.,ROGAN M.T.&ALLAN J.C. (1996). Detection, screening and community epidemiology of taeniid

cestode zoonoses: cystic echinococcosis, alveolar echinococcosis and neurocysticercosis. Adv. Parasitol. 38, 169–250.

(13)

11. DEPLAZES P., ALTHER P., TANNER I., THOMPSON R.C.A & ECKERT J. (1999). Echinococcus multilocularis coproantigen detection by enzyme-linked immunosorbent assay in fox, dog and cat populations. J. Parasitol., 85, 115–121.

12. DEPLAZES P.& ECKERT J. (1996). Diagnosis of Echinococcus multilocularis infection in final hosts. Appl. Parasitol., 37, 245–252.

13. DEPLAZES P.,GOTTSTEIN B.,ECKERT J.,JENKINS D.J.,WALD D.&JIMENEZ-PALACIOS S. (1992). Detection of

Echinococcus coproantigens by enzyme-linked immunosorbent assay in dogs, dingoes and foxes. Parasitol. Res., 78, 303–308.

14. DINKEL A., VON NICKISCH-ROSENEGK M., BILGER B.,MERLI M., LUCIUS R. & ROMIG T. (1998). Detection of Echinococcus multilocularis in the definitive host: coprodiagnosis by PCR as an alternative to necropsy. J.

Clin. Microbiol., 36,1871–1876.

15. DUSCHER G., PROSL H. & JOACHIM A. (2005). Scraping or shaking – a comparison of methods for the

quantitative determination of Echinococcus multilocularis in fox intestines. Parasitol. Res., 95, 40–42. 16. ECKERT J. (2003). Predictive values and quality control of techniques for the diagnosis of Echinococcus

multilocularis in definitive hosts. Acta Trop., 85, 157–163.

17. ECKERT J.,GEMMEL M.A.,MESLIN F.X.&PAWLOWSKI Z.S. (EDS) (2001). WHO/OIE Manual on Echinococcosis

in Humans and Animals: a Public Health Problem of Global Concern. World Organization for Animal Health (OIE), Paris, France, pp 265.

18. ELAYOUBI F.A.&CRAIG P.S. (2004). Echinococcus granulosus coproantigens: chromatographic fractionation and characterization. Parasitology, 128, 455–465.

19. FASIHI HARANDI M., HOBBS R.P., ADAMS P.J., MOBEDI I., MORGAN-RYAN U.M. & THOMPSON R.C.A. (2002).

Molecular and morphological characterization of Echinococcus granulosus of human and animal origin in Iran. Parasitology, 125, 367–373.

20. HILDRETH M.B.,SRIRAM S., GOTTSTEIN B.,WILSON M. &SCHANTZ P.M. (2000). Failure to identify alveolar

echinococcosis in trappers from South Dakota in spite of high prevalence of Echinococcus multilocularis in wild canids. J. Parasitol., 86, 75–77.

21. HOFER S., GLOOR S., MULLER U., MATHIS A., HEGGLIN D. & DEPLAZES P. (2000). High prevalence of

Echinococcus multilocularis in urban red foxes (Vulpes vulpes) and voles (Arvicola terrestris) in the city of

Zurich, Switzerland. Parasitology, 120 (Pt 2), 135–142.

22. ITO S. (1980). Modified Wisconsin sugar centrifugal-floatation technique for nematode eggs in bovine faeces.

J. Jpn Vet. Med. Assoc., 33, 424–429.

23. KAMIYA M. (2007). Collaborative control initiatives targeting zoonotic agents of alveolar echinococcosis in the

Northern Hemisphere. J. Vet. Sci., 8 (4), 313–321.

24. KAMIYA M.,LAGAPA J.T., NONAKA N.,GANZORIG S.,OKU Y.&KAMIYA H. (2006). Current strategies against Echinococcus zoonosis in Japan. Rev. Sci. Tech. Off. Int. Epiz., 25, 1055–1066.

25. KAMIYA M.,LAGAPA J.T.&OKU Y. (2007) Research on targeting sources of alveolar echinococcosis in Japan.

Comparat. Immunol. Microbiol. Infect. Dis. 30 (5–6), 427–48.

26. KAMIYA M., NONAKA N., GANZORIG S. & OKU Y. (2004). Effective countermeasures against alveolar

echinococcosis in red fox population of Hokkaido, Japan. In: Echinococcosis in Central Asia: Problems and Solutions, Torgerson P. & Shaikenov B., eds. INTAS Network Project, Zurich, Switzerland and Almaty, Kazakhstan, 273–282.

27. KAPEL C.M.,TORGERSON P.R.,THOMPSON R.C.&DEPLAZES P.(2006). Reproductive potential of Echinococcus multilocularis in experimentally infected foxes, dogs, raccoon dogs and cats. Int. J. Parasitol., 36 (1), 79–86.

28. KOHNO H.,SAKAI H.,OKAMOTO M.,ITO M.,OKU Y.&KAMIYA M. (1995). Development and characterization of

murine monoclonal antibodies to Echinococcus multilocularis adult worms and its use for the coproantigen detection. Jpn J. Parasitol., 44, 404–412.

(14)

29. LIGHTOWLERS M.W. (2006). Cestode vaccines: origins, current status and future prospects. Parasitology, 133,

S27–42.

30. LIGHTOWLERS M.W. & GOTTSTEIN B. (1995). Echinococcosis/hydatidosis: Antigens, immunological and

molecular diagnosis. In: Echinococcus and Hydatid Disease, Thompson R.C.A. & Lymbery A.J., eds. CAB International, Wallingford, UK, 355–410.

31. LIGHTOWLERS M.W,LAWRENCE S.B., GAUCI C.G.,YOUNG J., RALSTON M.J., MAAS D. &HEATH D.D.(1996).

Vaccination against hydatidosis using a defined recombinant antigen. Int. J. Parasitol., 18, 457–462.

32. LYMBERY A.J.(1995). Genetic diversity, genetic differentiation and speciation, in the genus Echinococcus Rudolphi 1801. In: Echinococcus and Hydatid Disease, Thompson R.C.A. & Lymbery A.J., eds. CAB International, Wallingford, UK, 51–87.

33. MATHIS A.,DEPLAZES P.&ECKERT J. (1996). An improved test system for PCR-based specific detection of Echinococcus multilocularis eggs. J. Helminthol., 70, 219–222.

34. MATHIS A.&DEPLAZES P.(2006).Copro-DNA tests for diagnosis of animal taeniid cestodes. Parasitol. Int., 55,

S87–90.

35. MATSUO K.&KAMIYA H. (2005). Modified sugar centrifugal flotation technique for recovering Echinococcus

multilocularis eggs from soil. J. Parasitol., 91, 208–209.

36. MCMANUS D.P. (2006). Molecular discrimination of taeniid cestodes. Parasitol. Int., 55, S31–S37.

37. MCMANUS D.P.&BRYANT C.(1995). Biochemistry, Physiology and Molecular Biology of Echinococcus. In: Echinococcus and Hydatid Disease, Thompson R.C.A. & Lymbery A.J., eds. CAB International, Wallingford, UK, 135–182.

38. MOKS E.,SAARMA U.&VALDMANN H.(2005). Echinococcus multilocularis in Estonia. Emerg. Infect. Dis., 11,

1973–1974.

39. MORISHIMA Y.,TSUKADA H.,NONAKA N.,OKU Y.&KAMIYA M.(1999). Evaluation of coproantigen diagnosis for

natural Echinococcus multilocularis infection in red foxes. Jpn. J. Vet. Res., 46, 185–189.

40. NAIDICH A., MCMANUS D.P., CANOVA S.G., GUTIERREZ A.M.,ZHANG W., GUARNERA E.A.&ROSENZVIT M.C.

(2006). Patent and pre-patent detection of Echinococcus granulosus genotypes in the definitive host. Mol.

Cell. Probes, 20, 5–10.

41. NONAKA N.,OKA M.,KAMIYA M.&OKU Y.(2008).A latex agglutination test for the detection of Echinococcus multilocularis coproantigen in the definitive hosts. Vet. Parasitol., (in press).

42. NONAKA N., TSUKADA H., ABE N., OKU Y.& KAMIYA M. (1998). Monitoring of Echinococcus multilocularis

infection in red foxes in Shiretoko, Japan, by coproantigen detection. Parasitology, 117 (Pt 2), 193–200. 43. RAUSCH R.L. (1995). Life cycle patterns and geographical distribution of Echinococcus species. In:

Echinococcus and Hydatid Disease, Thompson R.C.A. & Lymbery A.J., eds. CAB International, Wallingford, UK, 89–134.

44. ROSENZVIT M.C.,ZHANG L.H.,KAMENETZKY L.,CANOVA S.G.,GUARNERA E.A.&MCMANUS D.P. (1999). Genetic variation and epidemiology of Echinococcus granulosus in Argentina. Parasitology, 118, 523–530.

45. SAKAI H., NONAKA N., YAGI K., OKU Y. & KAMIYA M. (1998). Coproantigen detection in a survey of Echinococcus multilocularis infection among red foxes, Vulpes vulpes schrencki, in Hokkaido, Japan. J. Vet.

Med. Sci., 60, 639–641.

46. SAKASHITA M., SAKAI H., KOHNO H., OOI H., OKU Y., YAGI K., ITO M. & KAMIYA M. (1995). Detection of Echinococcus multilocularis coproantigens in experimentally infected dogs using murine monoclonal antibody against adult worms. Jpn J. Parasitol., 44, 413–420.

47. STEFANIC S.,SHAIKENOV B.S.,DEPLAZES P.,DINKEL A.,TORGERSON P.R. & MATHIS A. (2004). Polymerase chain reaction for detection of patent infections of Echinococcus granulosus (‘sheep strain’) in naturally infected dogs. Parasitol. Res., 92, 347–351.

(15)

48. STIEGER C.,HEGGLIN D.,SCHWARZENBACH G.,MATHIS A.&DEPLAZES P. (2002). Spatial and temporal aspects of urban transmission of Echinococcus multilocularis. Parasitology, 124 (Pt 6), 631–640.

49. THIENPONT D.,ROCHETTE F.&VANPARIJS O.F.J. (1979). Diagnosing helminthiasis by coprological examination.

Janssen Research Foundation, Beerse, Belgium.

50. THOMPSON R.C.A.(1995). Biology and systematics of Echinococcus. In: Echinococcus and Hydatid Disease,

Thompson R.C.A. & Lymbery A.J., eds. CAB International, Wallingford, UK, 1–50.

51. THOMPSON R.C.A&MCMANUS D.P. (2002). Towards a taxonomic revision of the genus Echinococcus. Trends

Parasitol., 18, 452–457.

52. TRACHSEL D.,DEPLAZES P.&MATHIS A.(2007). Identification of taeniid eggs in the faeces from carnivores

based on multiplex PCR using targets in mitochondrial DNA. Parasitology, 134, 911–920.

53. TORGERSON P.R. & HEATH D.D. (2003). Transmission dynamics and control options for Echinococcus granulosus. Parasitology, 127, S143–S158.

54. VAN DER GIESSEN J.W.,ROMBOUT Y.B.,FRANCHIMONT J.H.,LIMPER L.P.&HOMAN W.L.(1999). Detection of

Echinococcus multilocularis in foxes in The Netherlands. Vet. Parasitol., 82, 49–57.

55. VARCASIA A., CANU S., KOGKOS A., PIPIA A.P., SCALA A., GARIPPA G. & SEIMENIS A. (2007). Molecular

characterization of Echinococcus granulosus in sheep and goats of Peloponnesus, Greece. Parasitol. Res., 101, 1135–1139.

56. WORLD HEALTH ORGANIZATION (WHO)/OFFICE INTERNATIONAL DES EPIZOOTIES (OIE) (2001). WHO/OIE Manual

on Echinococcosis in Humans and Animals: a Public Health Problem of Global Concern, Eckert J., Gemmell, M.A., Meslin F.-X., Pawlowski Z.S., eds. OIE (World Organisation for Animal Health), Paris, France, 1–265. 57. XIAO N.,QIU J.,NAKAO M.,LI T.,YANG W.,CHEN X.,SCHANTZ P.M.,CRAIG P.S.&ITO A. (2005). Echinococcus

shiquicus n. sp., a taeniid cestode from Tibetan fox and plateau pika in China. Int. J. Parasitol., 35, 693–701. 58. XIAO N.,QIU J.,NAKAO M.,LI T.,YANG W.,CHEN X.,SCHANTZ P.M.,CRAIG P.S.&ITO A. (2006). Echinococcus

shiquicus, a new species from the Qinghai-Tibet plateau region of China: Discovery and epidemiological

implications. Parasitol. Int., 55, S233–236.

59. ZHANG L.H.,JOSHI D.D.&MCMANUS D.P.(2000). Three genotypes of Echinococcus granulosus identified in Nepal using mitochondrial DNA markers. Trans. R. Soc. Trop. Med. Hyg., 94, 258–260.

*

* *

NB: There are OIE Reference Laboratories for Echinococcosis/Hydatidosis (see Table in Part 3 of this Terrestrial

References

Related documents

The result revealed that only Nimbe Adedipe Library, FUNAAB engaged in binding of back issues and provided air conditioner to preserve their serials while

The emergence of the H5N1 influenza, and the result- ing policy and public panic, led to the conceptualisation of multisectoral linkages in India, with human health, animal health,

The focus of necrosis is delimited from intact tissues by a layer of young granulation tissue rich in cellular elements, newly formed vessels, and connective tissue fibers.. Figure

In the distance however, our model does not have the same problem because we approximate the utility of paths past the dynamic programming part with the travel time of the

The objective of this thesis is to trace the effects of physical transformations and modernization works on the public life and spaces in the 19 th century Istanbul through

Detection of Salmonella enterica Serovar Typhimurium from Avians

Photomicrograph of Periodic Acid Schiff reaction (PAS)-stained liver sections of the different groups: (a) Control group showing positive deeply stained magenta red glycogen granules

Latent Phase, High Risk Patients (maternal and/or fetal risk factors are present)- Assess and document fetal heart rate and uterine activity every 30 minutes or per provider