Ingrijpen of niet?: een experimenteel onderzoek naar de invloed van in en outgroups op antisociaal en prosociaal gedrag van mensen
Full text
Figure
Related documents
We have defined conserved and unconserved features of NepR structure that determine its function as an anti- factor and uncovered a functional role for intrinsically
Our initial study surveyed expert witnesses, lawyers employing ex- perts, judges hearing cases involving the experts, and jurors in civil cases who heard the expert
albicans FKBP12 crystal structures revealed a symmetric, intermolecular interaction involving the deep insertion of an active-site loop proline into the active-site pocket of
Finley Resources, Inc.,159 the Amarillo Court of Appeals held that a saltwater-disposal agreement granting lessee authority to dis- pose of saltwater from off-lease wells
reasoning, recovery of consortium damages by spouses and children, as previously recognized by this court, would not be warranted since the primary victims' causes
PDGFRA EXON PRIMER DOG1 EXON PRIMER EXON 1 FORWARD gccccattgattctttcatc EXON 1 FORWARD cggaaaatctgaccggcg EXON 1 REVERSE aactgccactggagagcatt EXON 1 REVERSE tgagctcttggttgggctc EXON
investigate the function of WWP1 in osteosar- coma, two cell lines, MG63 and HOS, which showed higher WWP1 mRNA and protein level, were transiently transfected with siRNA against
Table 3 displayed the PCOS associated symptoms of the studied women by polycystic ovary.. syndrome (PCOS)