• No results found

Problems of variable biomarker evaluation in stratified medicine research—A case study of ERCC1 in non-small-cell lung cancer

N/A
N/A
Protected

Academic year: 2021

Share "Problems of variable biomarker evaluation in stratified medicine research—A case study of ERCC1 in non-small-cell lung cancer"

Copied!
7
0
0

Loading.... (view fulltext now)

Full text

(1)

ContentslistsavailableatScienceDirect

Lung

Cancer

j o ur na l h o me p a g e :w w w . e l s e v i e r . c o m / l o c a t e / l u n g c a n

Problems

of

variable

biomarker

evaluation

in

stratified

medicine

research—A

case

study

of

ERCC1

in

non-small-cell

lung

cancer

Kinga

Malottki

a,∗

,

Sanjay

Popat

b

,

Jonathan

J.

Deeks

c

,

Richard

D.

Riley

d

,

Andrew

G.

Nicholson

e

,

Lucinda

Billingham

a

aCancerResearchUKClinicalTrialsUnit(CRCTU),MRCMidlandHubforTrialsMethodologyResearch,InstituteofCancerandGenomicSciences,University ofBirmingham,UnitedKingdom

bDepartmentofMedicine,RoyalMarsdenHospital,LondonSW36JJ,UnitedKingdom cInstituteofAppliedHealthResearch,UniversityofBirmingham,UnitedKingdom dResearchInstituteforPrimaryCareandHealthSciences,KeeleUniversity,UnitedKingdom

eDepartmentofHistopathology,RoyalBromptonandHarefieldNHSFoundationTrustandNationalheartandLungInstitute,ImperialCollege,London, UnitedKingdom

a

r

t

i

c

l

e

i

n

f

o

Articlehistory:

Received15September2015 Receivedinrevisedform 18November2015 Accepted23November2015 Keywords: ERCC1protein Human Biologicalmarkers Drugtherapy Antineoplastictherapy Carcinoma Non-small-celllung Clinicaltrialsastopic

a

b

s

t

r

a

c

t

Objectives:Consistencyofproceduresfortheevaluationofapredictivebiomarker(includingsample collection,processing,assayandscoringsystem)basedonadequateevidenceisnecessarytoimplement researchfindingsinclinicalpractice.Asacasestudyweevaluatedhowaparticularpredictivebiomarker, ERCC1,wasassessedinresearchonplatinum-basedchemotherapyinnon-small-celllungcancerand whatmotivatedthechoiceofprocedure.

Materialsandmethods:Asystematicreviewofstudiescompletedsince2007andongoingwasundertaken. QuestionnairesondetailsofERCC1evaluationproceduresandtherationalefortheirchoiceweresentto contactsofidentifiedstudies.

Results:Thirty-threestudiesofplatinum-basedchemotherapyinnon-small-celllungcancerusingERCC1 wereidentified.Areplytothequestionnairewasreceivedfor16studies.ProceduresforERCC1evaluation variedsubstantiallyandincludedreversetranscriptasequantitativepolymerasechainreaction(nine studies),immunohistochemistry(fivestudies)andothermethods(multiplemethods–twostudies,NER polymorphism–onestudy).InfivestudiesERCC1usewasplanned,butnotundertaken.Inninedatawas insufficienttoidentifytheprocedure.Foreachassaytherewasvariationacrossstudiesinthedetailsof thelaboratorytechniques,scoringsystemsandmethodsforobtainingsamples.

Conclusions:WefoundlargevariationacrossstudiesinERCC1evaluationprocedures.Thiswilllimit thefuturecomparabilityofresultsbetweenthesedifferentstudies.Toenableevidence-basedclinical practice,consensusisneededonavalidatedproceduretoassessapredictivebiomarkerintheearly phaseofresearch.WebelievethatERCC1isnotuntypicalofbiomarkersbeinginvestigatedforstratified medicine.

©2015TheAuthors.PublishedbyElsevierIrelandLtd.ThisisanopenaccessarticleundertheCCBY license(http://creativecommons.org/licenses/by/4.0/).

Abbreviations: ERCC1,excisionrepaircross-complementationgroup1;FISH, fluorescenceinsituhybridization;IHC,immunohistochemistry;NER,nucleotide excisionrepair; NR, not reported; NSCLC,non-small-cell lung cancer;PD-L1, programmed-deathligand 1; RTqPCR,reversetranscriptase quantitative poly-merasechainreactio.

∗ Corresponding authorat:CancerResearchUKClinicalTrialsUnit(CRCTU), InstituteofCancerandGenomicSciences,UniversityofBirmingham,B152TT Birm-ingham,UnitedKingdom.Fax:+441214147471.

E-mailaddress:k.malottki@bham.ac.uk(K.Malottki).

1. Introduction

Lungcancerisone oftheleadingcausesofcancermortality globally[1–3].Themajorityofpatientshavenon-small-celllung cancer(NSCLC)histology[3,4].Prognosisinthesepatientsis gen-erallypoor[2,4],withafiveyearsurvivalofabout5%foradvanced NSCLCandabout15%irrespectiveofstage[3].Inspiteof develop-mentofnew,targetedtreatments,platinum-basedchemotherapy remainsamajorpartofNSCLCcare[2,4–6].

Theeffectivenessofplatinum-basedchemotherapyishowever limited[1,7],withresistancetotreatmentresultinginlittleorno benefitandpotentiallyunnecessarytoxicityinsomepatients[8]. http://dx.doi.org/10.1016/j.lungcan.2015.11.017

(2)

Ina significantnumber ofpatients, identificationofbiomarkers predictiveof resistancetoplatinum-based chemotherapycould potentiallyresultinavoidingunnecessarytreatment,aswellas bet-terallocationofhealthcareresources.Expressionofexcisionrepair cross-complementationgroup1(ERCC1)genehasbeensuggested asabiomarkerpotentiallyrelevanttopredictionofresponseto platinum-basedchemotherapy[2].

Theuseofpredictivebiomarkersisbecomingmorecommon. Theaccuracyandreplicabilityoftheproceduresusedtoevaluate thesebiomarkers(includingsamplecollection,processing,assay, scoringsystemand threshold)are thereforecrucial. The useof standardisedproceduresisimportanttofacilitatecombinationof resultsofmultiplestudiesinameta-analysisandimplementation oftheirfindingsinclinicalpractice.Therearehoweverreasonsto believethatin practicethere maybelittleconsistencyinthese procedures. A review of published papers investigating ERCC1 expressiontopredictresponsetoplatinum-basedchemotherapy inlungcancerfoundthattherewaslargevariabilityintheassays used[2].Thisreviewwaspublishedin2011,thusincluding rela-tivelyearlyERCC1evaluations.Therewasapossibilitythatmore recentresearchpracticehasbecomemoreharmonised.

ERCC1wasalsochosenasacasestudy,astheresearch investi-gatingitasapotentialpredictivebiomarkerwasrelativelyrecent andthereforelikelytoillustratecurrentpractice.Aninteresting developmentwasthatitwassuggestedthatcurrentlytheremaybe nolaboratoryprocedurecapableofidentifyingtheERCC1isoform thatmayberesponsibleforresistancetocisplatin[7].

Theaimofthissystematicreviewundertakenin2013and subse-quentquestionnairewastoinvestigatetheconsistencyofmethods forevaluationofERCC1asabiomarkerpredictiveofresponseto platinum-basedchemotherapyinongoingorcompletedsince2007 studiesinNSCLC,andtoinvestigatetherationaleforchoiceofa specificmethod.Thisprojectsetsouttoprovideacasestudyof currentresearchpractice,fromwhichlessonscanbelearnedthat mayapplytoawidercontextofpredictivebiomarkerresearch.

2. Materialsandmethods

Searchesforstudiescompletedsince2007andongoingwere undertaken on 26 March 2013 in ClinicalTrials.gov, WHO and theControlled-Trialsdatabases.Searchtermswerebasedonthe patient population (NSCLC), the biomarker (ERCC1) and treat-ment(platinum-basedchemotherapy).Thefullsearchstrategies areavailableintheonlinesupplement.

Studiesmeetingthefollowingcriteriawereincluded: • Population:patientswithNSCLC(anystage).

• Intervention:atleastoneofthestudyarmsincluded platinum-basedchemotherapy.

• Biomarker assay: any assay measuring ERCC1 expression or nucleotideexcisionrepair(NER)geneexpressionintumour tis-sueorblood.

• Outcome:any.

• Study: any ongoing study or completed/terminated after 1st January2007.

Titlesofstudieswerescreenedbytwoindependentreviewers (KMand LB) and thoseclearly notmeeting theinclusion crite-riawereexcluded.Fortheremainingstudiesfullrecordsobtained fromdatabasesofongoingtrialswereconsideredforinclusionby twoindependentreviewers(KMandLB).Studieswereincludedif theymetallinclusioncriteria.Studiesonlyspecifyingthe inter-ventionaschemotherapyorsystemictherapywerealsoincluded ifall the remaining criteria were met.Disagreements between

reviewerswereresolvedbydiscussionandintwocasesbyseeking furtherinformationonthestudiesininternetsearches.

Forall includedstudies,informationwasextractedfromthe databases on: studyphase, design, plannedsample size, status (ongoing,completed,terminatedorwithdrawn),startandplanned enddate,primaryoutcome,patientinclusioncriteria,intervention, ERCC1evaluation,location,sponsorandcontactdetails.

AquestionnaireaskingaboutthedetailsofERCC1evaluation proceduresandreasonsfortheirchoicewaspreparedin collabo-rationwithclinicalandpathologyexpertsandsenttocontactsfor eachincludedstudy,thesponsororforpublishedstudiesthe corre-spondingauthor(whicheverwasavailable).Thequestionnairewas senton5thAugust2013andifnoreplywasreceived,againon28th January2014.Forcompletedstudiessearchesforpublicationswere alsoundertaken.

Data obtained from databases of ongoing trials and replies receivedwere summarisedusing descriptive analysis.No addi-tionalinformationwasobtainedthroughsearchesfor published studies.

3. Results

3.1. Detailsofstudiesincludedinthesystematicreview

Thesearchesidentified730uniquerecordsindatabasesof clin-icaltrials.ThereviewprocessispresentedindetailinFig.1,leading to33studiesbeingincludedinthestudy.

Eighteenoftheincludedstudieswereongoing,eightcompleted, twoterminatedearlyandonewithdrawnpriortoenrolment.The statusoffourstudieswasunknown.Nineoftheincludedstudies wereconductedinAsia,eightinEurope,13inNorthAmerica,one includedlocationsinEuropeandNorthAmericaandfortwothe locationwasnotreported.Thephaseandsizeofstudiestogether withdesignisshowninFig.2.

There were two key types of study design (see Fig. 2 cap-tionfordetails).In19studiesERCC1wasnotanintegralpartof thestudydesign, but acorrelationbetweenthe biomarker sta-tusandtreatmentoutcomewasinvestigated(correlativestudies). TheremainderusedERCC1asanintegralpartofthedesign: thir-teenusedERCC1aloneorincombinationwithotherbiomarkersto determinetreatmentstrategy(biomarkerstrategydesign)andone studyusedERCC1tostratifyrandomisation.

As expected, single arm correlative studies were most fre-quentlyearlyphasestudies(phase0,IandII).Nineof15phaseII studiesreportedtestingastrategythatwasbasedonERCC1andin somecasesalsoincludedotherbiomarkers.PhaseIIItrialsincluded onecorrelativeRCT,oneRCTstratifiedbyERCC1andthreeRCTs usingERCC1toselectatreatmentstrategy.ThephaseIVstudywas abiomarker-basedstrategyRCT.

Detailedcharacteristicsofincludedstudiesarereportedinthe onlineSupplement.

3.2. ERCC1Informationonallincludedstudies

The procedures for evaluation of ERCC1varied across stud-ies(Fig.3).Data wasavailableinsufficient detailtoenablethe identificationofthelaboratoryprocedureusedin24ofthe33 stud-ies.Ofthese,reversetranscriptasequantitativepolymerasechain reaction(RTqPCR)wasusedinnine(38%)and immunohistochem-istry(IHC)infive(21%)studies.Twostudiesreportedtheuseof multiplemethods.Inoneimmunofluorescence-basedautomated quantitativeanalysisforinsituexpressionwasusedastheprimary assayand ifadditionalsampleswereavailable,RT-PCR,RTqPCR, polymorphism analysisand tissue microarray analysis ofgenes associatedwithDNAsynthesis,damagerepair,anddrugefficacy

(3)

ClinicalTrials.gov -317

records WHO -303 records

921 study tles

730 study tles screened

330 studies potenally relevant 33 studies included -quesonnaires sent 17 no reply received 16 replies received - 8 quesonnaires - 8 email only exclusions:

285 no ERCC1 assessment 5 not NSCLC paents

4 duplicate entries with different numbers in different databases

2 no planum-based chemotherapy 1 completed prior to 2007 400 studies not considered

relevant 191 duplicates

removed

Controlled-Trials -301 records

Fig.1.Flowdiagramoutliningtheresultsofsearchesinongoingtrialsdatabases,reviewofstudiesandrepliesreceivedforthequestionnaire.

werealsoundertaken.Inanotherstudybothfluorescenceinsitu hybridization(FISH)andIHCwereused.Onestudyinvestigated NERpolymorphism.Infivestudies,althoughinitiallyplanned,no ERCC1evaluationwasundertaken.

Thetypeofspecimenusedalsovaried,asshowninFig.3,with biopsybeingthemostfrequent.

Itappearsthatirrespectiveofthestudyphasetherewas vari-ationinthelaboratoryproceduresusedforevaluationofERCC1 status.Therewasnorelationshipbetweentheyearofstudy initia-tionandlaboratoryprocedure(datainSupplementaryfigure). 3.3. AdditionalInformationonERCC1evaluationobtainedfrom thequestionnaire

Areplytothequestionnairewasreceivedfor16studies(shown in Fig. 2). Five of these did not undertake ERCC1 evaluation,

althoughinitiallyplanned(reasonsincluded:earlystudy termina-tion,insufficientsamples,lackoffunding).

In the 11 studies that evaluated ERCC1, it was prospective (priortopatientsreceivingtreatment)inalleightstudiesusingthe biomarkertoidentifytreatmentstrategyorstratifyrandomisation. ThreestudieswerecorrelativeandalloftheseevaluatedERCC1 retrospectivelyandblindtopatientoutcome.Instudiesassessing ERCC1prospectivelythetimeneededforresultstobereturnedto thetreatingphysicianvariedbetweenaminimumofonetotwo daysto14days.Itwashoweverusuallynotindicatedifthistime wasmeasuredfrompatientenrolmentorreceiptofsamplebythe laboratory.

NineoftherepliesreportedthesiteofERCC1evaluation:in sevenitwasacentrallaboratoryandintwoanindividualhospital. OfthefivestudieswhereERCC1wasevaluatedwithIHC,the monoclonal8F1antibodyclonewasusedinthree(in1:300dilution

(4)

* response to quesonnaire received and ERCC1 evaluaon undertaken; ** response to quesonnaire received and ERCC1 evaluation not undertaken

Correlave studies: the correlaon between the biomarker status and response to treatment was invesgated, but paents were not allocated to treatments or study cohorts based on the biomarker status; RCTs

and non-RCTs

Studies where ERCC1 is integral to trial design:

Biomarker strategy design:the treatment strategy is based on the biomarker: -For RCTs in the biomarker-strategy arm

-For non-RCTs for all paents

Strafied design:paents were included in the trial irrespecve of their biomarker status, randomisaon was strafied by the biomarker status; only RCTs

0 20 0 40 0 60 0 80 0 100 0 120 0 140 0 160 0 0 I II III IV NR trial phase pl anned sam p le si ze

single arm correlative correlative RCT

single arm biomarker strategy biomarker strategy RCT stratified RCT

analysis of samples from multiple trials

NC T 0126129 9 NC T 0141696 1 NC T 0105955 2 NC T 0138638 5 NC T 0058263 4 NC T 00191308 ** NC T 01731626 ** NC T 00729612 ** NC T 0100396 4 NC T 01194453 * NC T 0135636 8 MA D e I T* S 072 0 NC T 00705549 * PT INC LC * NC T 0073681 4 NC T 0164851 7 T AS TE * CO NT ES T* NC T 00113386 ** MA D e IT GI L T D o c e ta x e l* IT AC A* ET * Ch iC T R -T RC -1100132 7 NC T 0044252 0 NC T 0114168 6 NC T 0079723 8 NC T 00422500 ** C AS TL E P ha rm a c ogeno sc an * NC T 0090017 2 LA C E -B IO *

Fig.2.PlannedtrialsamplesizeanddesignwithrespecttoERCC1bytrialphaseinidentifiedstudies.

intwoandnotreportedinone),theZSGB-Bio,Chinaantibodyclone inone(in1:50dilution)anditwasnotreportedinone.Ancillary methodswerereportedfortwoofthesestudiesandwere: auto-matedICHstainerinonestudyandexposingsamplesto10mM citratebuffer(pH6.0)andthenheatingfor30mininawaterbath intheother.

ToobtainanIHCexpressionscorefourstudiesusedtheH-score andonestudyusedtheAllredQuickScore.Thethresholdsfor clas-sifyingpatientsaspositivewere:

• H-score1andaboveintwostudies,

• medianH-scoreinonestudy(retrospectiveanalysis), • AllredQuickScore6andabove.

InsixstudieswhichusedRTqPCRitappearsthatdifferentsets ofprimerswereused,althoughthiscouldnotbeestablishedwith certainty(detailsshowninTable1).␤-actinonitsownwasusedas thereferencegeneinfourstudies.Inonestudy␤-actinwasused togetherwithPGKandinonestudy18SrRNAwasused.Onlytwo studiesreportedthemethodusedtocalculatethequantityofERCC1 RNAanditwastheCTmethod.Thethresholdsforclassifying patientsaspositivewere:

• medianinthreestudies,

• ratioofERCC1toreferencegenetranscriptsof1.7inonestudy, • 8.7(nofurtherdetailsprovided)inonestudy,

• inonestudythethresholdwasnotclearlyreported.

The proportion of patients classed as ERCC1 positive was reportedfortwostudiesusingRTqPCRandwas0.6and0.64. 3.4. RationaleforchoiceofERCC1procedures

Therationaleforthechoiceoftheprocedurevariedacross stud-ies(showninTable2).Thereasonsprovidedwereexperienceofthe

laboratory,publishedliterature,previousresearchexperience(for examplepilotstudy),beliefthatthemethodofchoicewassuperior orlimitationsimposedbythetypeoftheavailablesamples.Forone studyitwasdeclaredthataswithcurrentknowledgethereareno antibodiesthatwereisoform-specific,therewasnorationalefor selectionofthelaboratoryprocedure.

4. Discussion

Applicationofstratifiedmedicineintherealworldrequiresthat themeasurementofbiomarkersandassociatedclassification algo-rithmsused tostratifypatientsfollowsa standardisedprotocol withinclinicaltrials,especiallyinthelaterphases.Thisensuresthat theevidence-basebehindthestratifiedtreatmentisconsistentand valid,sothatevidence-baseddecisionscanbemadeaboutwhether aparticularmarkercanbeutilisedinpracticeand,ifso,how.We haveundertakentoresearchthisissueviaaspecificcase-studyand ouraimwastoinvestigatewhetherlaboratoryproceduresusedfor ERCC1evaluationhavebecomemorestandardisedsincea meta-analysispublishedin2011foundlargevariation[2].

Therewere33studiesthatmetourinclusioncriteria,ranging fromphase 0tophase IV.Fifteen ofthestudiesusedERCC1as anintegralpartoftheirdesign:eithertoallocatetreatmentorto stratifypatients.

Ourfindingssuggestthattherewasstilllargevariationinboth the laboratoryprocedures and thetumour specimens used for ERCC1evaluation. Althoughtheyattempt toevaluatethesame biomarker, somesmall studiessuggest that classifying patients asERCC1 positiveand negativebased oneither RTqPCRor IHC canleadtorelativelylargediscrepancies[9,10].Forexample,one studyinvestigatingsamplesfrom91patientsfoundthattherewas astatisticallysignificantcorrelationbetweentheERCC1mRNAand proteinexpressionlevels.Howeverwhenthresholdsfor classify-ingpatientsaspositiveandnegativewereused,33%oftumours ERCC1negativebyRTqPCRwereIHCpositiveand32%IHC-negative

(5)

Table1

DetailsofRTqPCRusedinstudieswhereinformationwasreturned.

Study Primers Referencegene(s) Thresholdchosen

EUCTR2008-001764-36-IT(ITACA) Exons-spanning ␤-Actin Median(usingCTmethod,value NR)

EUCTR2011-005267-24-IT(CONTEST) Notknown(carriedoutbyexternal laboratory)

␤-Actin RatioofERCC1toreferencegene transcripts:0.14(low),13.4(high), Cut-off:1.7

NCT00174629(GILTDocetaxel) DesignedaccordingtotheirRef.Seqin https://www.ncbi.nlm.nih.gov/sites/ entrez?db/gene

␤-Actin Median(3.42usingCTmethod) NCT00705549 “Primershavebeenpreviously

describedindetails(PapadakietalBRJ Ca)”–papercouldnotbeidentified

␤-ActinandPGK Unclear(“thecut-offwasbasedonthe achartanalysisin>800samples”) NCT01194453 Primersspanningexons7–9ofthe

ENST00000300853ERCC1transcript: 5TCGTCTCCCGGGTGACTG

3and5TTCTCTTGATGCGGCGATGAG3

␤-Actin Median(valueNR)

NCT00215930(MADeIT) Intron-spanningprimers Housekeepinggene18SrRNA Above/below8.7

ERCC1 assessment in identified studies based on ongoing trials databases and returned information

tumour sample assay

20 15 10 5 phase 5 10 15 20

number of studies number of studies

NR 0 I II III IV RTqPCR IHC

gene expression NER polymorphism

multiple methods NR

not undertaken biopsy

(FF)PE tumour tissue surgical resection

surgical resection or biopsy

surgical resection, biopsy or cytology NR

not undertaken

Fig.3.ERCC1evaluationinidentifiedstudies.

Table2

RationaleforthechoiceofmethodofERCC1assessmentinstudiesforwhichinformationwasprovided. Published

literature

Previousownresearch experience

Laboratory experience

Believemethod mostappropriate

Methodsuitablefor availablesamples None NR EUCTR2007-007639-17-GB(ET) √ √ EUCTR2008-001764-36-IT(ITACA) √ EUCTR2011-005267-24-IT(CONTEST) √ NCT00174629(GILTDocetaxel) √ NCT00705549 √ √ NCT00775385(TASTE) √ NCT01194453 √ NCT01294280(LACE-BIO) √ NCT01781988(PTINCLC) √ NCT00215930(MADEIT) √ √ NCT00222404(Pharmacogenoscan) √

(6)

tumorswereclassedasERCC1positiveusingRTqPCR[11].These findingssuggestthatbothtechniquesmaynotbeinterchangeable. Inourreviewevenwhenthesameassaywasused,detailsof thelaboratoryproceduresandscoringsystemsappearedtovary. Thiscouldfurtherdecreasethecomparabilityofresultsbetween studies.

Inthequestionnaire,threeoutoffivestudiesusingIHCreported usingthe8F1antibodyclone(Nomarkers).Intwoofthethree stud-iesusingthe8F1clone,thedilutionwasreportedanditwasthe same.Theuseofthesameantibodycloneiscrucial,asdifferent clones forthe sameantigen bindtodifferent epitopesand can thereforehavedifferentsensitivitiesandspecificities[12,13].

TherewaslargevariationinthetechniquesusedforRTqPCR, especiallyin termsof theprimersused,whichcan havea sub-stantialimpactontheresultsobtainedusing this method[14]. Fiveofthesixstudiesused␤-actinasthereferencestandard(in onecase togetherwithanothergene).Thechoiceofareference standardcan bechallengingand severalpublications have sug-gestedthatlevelsof␤-actinexpressioncanvaryandmaynotbea goodreferencestandard[15,16].Thethresholdschosenin individ-ualstudiesalsovariedand,interestingly,threestudieschosethe medianvalueobtainedwithinthestudy.Thisseemstoimplyan underlyingassumptionthathalfofthepatientsinthesestudiesare resistanttoplatinum-basedchemotherapyduetoERCC1 overex-pression,howevernoreasonforthisassumptionwasprovided.

Apartfromusingdifferentassays,themethodsoftumour sam-ple collection also varied. A small study using IHC for ERCC1 assessmentsuggestedthattheremightbeadiscrepancyin clas-sifyingpatients’ERCC1expressionlevelsdependingonwhether tumourtissuewasobtainedusingbiopsyorsurgicalresection[17]. Anotherstudy found discrepant results depending onwhether a tumour sample was obtainedfrom theprimary tumour or a metastaticsite[18].

Wherereported,theproportionof patientsclassedasERCC1 positiverangedfrom0.25to0.78.Thiswouldfurthersuggestthat proceduresand criteriaused in different studiesfor classifying ERCC1expressionlevelsdonotproducecomparableresults.Itis howeverpossiblethatthisvariationislargelyduetochanceor,for example,prognosticpropertiesofERCC1.

Onundertakingthisreviewandquestionnaireitwas hypothe-sisedthatthehighestvariationintheassaysforERCC1evaluation shouldbeseeninearlyphasetrialsandhigherlevelsof standardis-ationwereexpectedforlaterphasestudies.Thiswashowevernot observed.Therewasrelativelylargevariationinthemethods cho-senforERCC1evaluationinphaseIIandIIItrials.Therewasalsono evidenceofatrendsuggestingcertainmethodsofERCC1 evalua-tionbecamemorepopularataparticulartime(forexampledueto publicationofresearchsuggestingonemethodcouldbesuperior). Withregards to the rationale for thechoice of a particular method,itwasoftenmotivatedbyexperienceofeitherthe lab-oratory or theresearchers involved, although for three studies publishedliteraturewasalsoreferredto.

Asrecentresearchsuggests,theremaybenoERCC1assay capa-ble ofidentifyinga subgroupof patientsmore likely tobenefit fromplatinum-basedchemotherapy.Whentumourtissuesamples fromthesamepatientsoriginallyenrolledintheIALTtrialwere re-evaluatedusingexactlythesameIHCprocedures,36%ofpatients classedasERCC1positiveononeoccasionwereclassedas nega-tiveonanother.[7].Thisraisestheissueofunnecessarilyenrolling patientsintrialswhereERCC1is,orwasintegraltotrialdesign.This potentiallyresultedinsuboptimaltreatmentofthesepatientsand asuboptimalallocationofresources.

Thissystematic reviewisbased ona relativelysmallsample ofstudiesanddetailedinformation(fromthequestionnaire)was limitedto16.Theobjectiveherewashowevernotofquantitative nature,butmainlytocollectinformationonanexampleoflarge

dis-crepanciesinevaluationofapotentialpredictivebiomarker.There isnoreasontobelievethatthisexampleisnotrepresentativeof atleastsomestratifiedmedicineresearch,andtheconclusionsare unlikelytochangeiffurtherstudieshadbeenobtained(indeed, heterogeneityinlaboratorymethodswouldlikelyincrease).

Fromtheperspectiveofreviewingevidenceand implement-ingbiomarkersinclinicalpractice,itwouldbeidealiftherewas onevalidlaboratoryprocedureusedforbiomarkerevaluationin allstudies.Howeverinpracticethisisunlikely,asthetechnology inthisfieldisrapidlydeveloping.Newlaboratoryproceduresare beingdeveloped,whichcanoffermoreaccuratebiomarker evalu-ation,aswellascostandtimesavings.Itisthereforenotsurprising thattheseareimplementedinstudies(althoughourreviewdid notidentifyaneffectofdisseminationofnewtechnologiesonthe choiceofthelaboratoryprocedures).Someofthevariabilitymay alsobeduetothecompetitionbetweendifferentresearchgroups anddifferencesinopiniononthesuitabilityofagivenassay.This presentsachallengeforimplementing findingsofstudiesusing differentproceduresinclinicalpractice,especiallythat,assome researchonERCC1suggests,theresultsobtainedusingdifferent proceduresmaynotbecomparable.Thereforethereisaneedfor moreresearchtoensurethatproceduresusedtoevaluatethesame predictive biomarker actually stratify patients into comparable cohorts.

Thisexamplehighlightstheneedforamorestructuredapproach todevelopmentandvalidationofbiomarkertestspriortotheiruse inclinicaltrials.Althoughitmayappearthatstudiesareusingthe sameassay,variationinimportantdetailsofthelaboratory pro-ceduresmayresult in lackof comparability betweenresultsof differentstudies.

ItappearsthatthecaseofERCC1isnotisolated.Apotentially similarsituationhasbeenrecentlyidentifiedinprogrammed-death ligand1(PD-L1)testinginNSCLC,wheremultipleIHCassaysusing differentantibodyclonesareunderdevelopmentforfourdifferent drugsandthereisstilluncertaintywithregardstohowwellthese assayscanpredictpatientresponse[19].

5. Conclusions

Ifabiomarkeristobeusedinclinicalstudies,especiallylater phase,ideallyitsaccuracyshouldbeestablished.Therealsoneeds tobeconsensusonastandardisedvalidatedprotocoltobefollowed inclinicaltrials,whichwouldensurethereisadefinitivebiomarker evaluationproceduretobeusedinfutureclinicalpractice.Existing internationalresearchinfrastructurecouldpotentiallybeutilised toaccomplishconsensus,howeverthismaynotbestraightforward duetoindividualopinionsandexperience.

Conflictsofinterests

K.M.andS.P.declarednoconflictsofinterest;J.D.reported insti-tutioninreceiptofaCRUKprojectgrant;R.R.reportedapending MRCgrantandbeingaStatisticsEditorfortheBMJ;A.N.provided consultancyforMerck,BoehringerIngelheim,Pfizer,Novartisand AstraZeneca,waspayedforlecturesforEliLilyandAstraZeneca andwaspayedfortraveltoIASLCPathologyCommitteeMeetings; L.B.wasa memberof EliLillyAdvisoryBoard andwaspaidfor lecturesbyRoche.

Acknowledgements

WethankKarenBiddleforadministrativesupportinsending outandcollectingrepliestothequestionnairesandDoctorDavid GonzalezdeCastroforadviceonthedesignofthequestionnaire; K.M.wassupportedbyMRCMidlandHubforTrialsMethodology

(7)

Research,UniversityofBirminghamandCRUKPopulationResearch Committee—ProjectAward;J.J.D.wassupportedbyNIHRSenior InvestigatorAward,AGNwassupportedbytheNationalInstitute ofHealthResearchRespiratoryDiseaseBiomedicalResearchUnit attheRoyalBromptonandHarefieldNHSFoundationTrustand ImperialCollegeLondon.S.P. acknowledgesNHSfundingtothe RoyalMarsdenHospitalNIHR-BiomedicalResearch Centre;This workwasfundedbytheMRCMidlandsHubforTrialsMethodology ResearchattheUniversityofBirmingham(MedicalResearch Coun-cilGrantIDG0800808);thefunderhadnoinfluenceonthedesign oftheproject,datacollection,analysis,interpretationorwriting thereport.

AppendixA. Supplementarydata

Supplementarydataassociatedwiththisarticlecanbefound,in theonlineversion,athttp://dx.doi.org/10.1016/j.lungcan.2015.11. 017.

References

[1]K.A.Olaussen,A.Dunant,P.Fouret,E.Brambilla,F.Andre,V.Haddad,E. Taranchon,M.Filipits,R.Pirker,H.H.Popper,R.Stahel,L.Sabatier,J.P.Pignon, T.Tursz,T.LeChevalier,J.C.Soria,InvestigatorsIBDNArepairbyERCC1in non-small-celllungcancerandcisplatin-basedadjuvantchemotherapy,N. Engl.J.Med.355(2006)983–991.

[2]R.A.Hubner,R.D.Riley,L.J.Billingham,S.Popat,Excisionrepair

cross-complementationgroup1(ERCC1)statusandlungcanceroutcomes:a meta-analysisofpublishedstudiesandrecommendations,PLoSOne6(2011) e25164.

[3]D.Allingham-Hawkins,A.Lea,S.Levine,ERCC1expressionanalysistoguide therapyinnon-smallcelllungcancer,PLoSCurr.2(2010)RRN1202. [4]NationalInstituteforHealthandCareExcellence,Thediagnosisand

treatmentoflungcancer(CG121),treatmentoflungcancer(CG121),National CollaboratingCentreforCancer,https://www.nice.org.uk/guidance/cg121/ evidence/full-guideline-181636957,2011.

[5]J.Vansteenkiste,D.DeRuysscher,W.E.Eberhardt,E.Lim,S.Senan,E.Felip,S. Peters,E.G.W.Group,Earlyandlocallyadvancednon-small-celllungcancer (NSCLC):ESMOClinicalPracticeGuidelinesfordiagnosis,treatmentand follow-up,Ann.Oncol.24(Suppl.6)(2013)vi89–vi98.

[6]S.Peters,A.A.Adjei,C.Gridelli,M.Reck,K.Kerr,E.Felip,E.G.W.Group, Metastaticnon-small-celllungcancer(NSCLC):ESMOClinicalPractice

Guidelinesfordiagnosis,treatmentandfollow-up,Ann.Oncol.23(Suppl.7) (2012)vii56–vii64.

[7]L.Friboulet,K.A.Olaussen,J.P.Pignon,F.A.Shepherd,M.S.Tsao,S.Graziano,R. Kratzke,J.Y.Douillard,L.Seymour,R.Pirker,M.Filipits,F.Andre,E.Solary,F. Ponsonnailles,A.Robin,A.Stoclin,N.Dorvault,F.Commo,J.Adam,E. Vanhecke,P.Saulnier,J.Thomale,T.LeChevalier,A.Dunant,V.Rousseau,G. LeTeuff,E.Brambilla,J.C.Soria,ERCC1isoformexpressionandDNArepairin non-small-celllungcancer,N.Engl.J.Med.368(2013)1101–1110. [8]C.A.Rabik,M.E.Dolan,Molecularmechanismsofresistanceandtoxicity

associatedwithplatinatingagents,CancerTreat.Rev.33(2007)9–23. [9]A.Vilmar,J.Garcia-Foncillas,M.Huarriz,E.Santoni-Rugiu,J.B.Sorensen,

RT-PCRversusimmunohistochemistryforcorrelationandquantificationof ERCC1,BRCA1,TUBB3andRRM1inNSCLC,LungCancer75(2012)306–312. [10]B.Besse,K.A.Olaussen,J.C.Soria,ERCC1andRRM1:readyforprimetime?J.

Clin.Oncol.31(2013)1050–1060.

[11]L.Friboulet,D.Barrios-Gonzales,F.Commo,K.A.Olaussen,S.Vagner,J.Adam, A.Goubar,N.Dorvault,V.Lazar,B.Job,B.Besse,P.Validire,P.Girard,L. Lacroix,J.Hasmats,F.Dufour,F.Andre,J.C.Soria,Molecularcharacteristicsof ERCC1-negativeversusERCC1-positivetumorsinresectedNSCLC,Clin.Cancer Res.17(2011)5562–5572.

[12]GerardNuovo(Ed.),InSituMolecularPathologyandCo-expressionAnalyses, ed.,AcademicPress,London,UK,SanDiego,USA,2013.

[13]R.A.Walker,Quantificationofimmunohistochemistry-issuesconcerning methods,utilityandsemiquantitativeassessmentI,Histopathology49(2006) 406–410.

[14]S.A.Bustin,AbsolutequantificationofmRNAusingreal-timereverse transcriptionpolymerasechainreactionassays,J.Mol.Endocrinol.25(2000) 169–193.

[15]A.Radonic,S.Thulke,I.M.Mackay,O.Landt,W.Siegert,A.Nitsche,Guideline toreferencegeneselectionforquantitativereal-timePCR,Biochem.Biophys. Res.Commun.313(2004)856–862.

[16]K.Dheda,J.F.Huggett,S.A.Bustin,M.A.Johnson,G.Rook,A.Zumla,Validation ofhousekeepinggenesfornormalizingRNAexpressioninreal-timePCR, Biotechniques37(2004)112–114,116,118–119.

[17]L.Taillade,F.Penault-Llorca,T.Boulet,P.Fouret,S.Michiels,E.Taranchon,G. Mountzios,P.Validire,J.Domont,P.Girard,D.Grunenwald,T.LeChevalier, J.C.Soria,Immunohistochemichalexpressionofbiomarkers:acomparative studybetweendiagnosticbronchialbiopsiesandsurgicalspecimensof non-small-celllungcancer,Ann.Oncol.18(2007)1043–1050. [18]C.Gomez-Roca,C.M.Raynaud,F.Penault-Llorca,O.Mercier,F.Commo,L.

Morat,L.Sabatier,P.Dartevelle,E.Taranchon,B.Besse,P.Validire,A.Italiano, J.C.Soria,Differentialexpressionofbiomarkersinprimarynon-smallcelllung cancerandmetastaticsites,J.Thorac.Oncol.4(2009)1212–1220.

[19]K.M.Kerr,M.-S.Tsao,A.G.Nicholso,Y.Yatabe,I.I.Wistuba,F.R.Hirsch, Committee.obotIP,PD-L1immunohistochemistryinlungcancer:inwhat stateisthisart?J.Thorac.Oncol.10(2015)985–989.

References

Related documents

The degree of resistance exhibited after 1, 10 and 20 subcultures in broth in the absence of strepto- mycin was tested by comparing the number of colonies which grew from the

Spectrophotometric color analysis of the wines produced from fresh grapes on the 80 kg and 500 kg scale, revealed significantly higher concentrations of total

This study is a systematic review and meta- analysis that was performed in clinical trial about the effect of vitamin D copmpared with placebo on CD4 count of

(2014), Accounts receivables management and financial performance of manufacturing firms in Nakuru County, Kenya , unpublished manuscript, school of business, university of

Anti-inflammatory effects of the preparation were studied according to the below methods: S.Salamon– burn induced inflammation of the skin, caused by hot water (80 0 C) in white

Due to the continued interest and debate in this area, we conducted a scoping systematic literature review and meta-analysis of all observational studies

The absence of any association between frequency of candy consumption and measures of adiposity or cardio- vascular risk factors despite the fact that candy is a source of added

The proposed high step-up interleaved converter with a voltagemultip lier module is shown in Fig.3. The voltage mu ltip liermodule is co mposed of two coupled inductors and two