Reversal of Salt Preference Is Directed by the Insulin/PI3K and Gq/PKC Signaling in Caenorhabditis elegans

(1)

DOI: 10.1534/genetics.110.119768

Reversal of Salt Preference Is Directed by the Insulin/PI3K and G

q

/PKC

Signaling in

Caenorhabditis elegans

Takeshi Adachi

,*

Hirofumi Kunitomo

,*

,1

_{Masahiro Tomioka}

_,

†,1

_{Hayao Ohno}

_,*

Yoshifumi Okochi

,**

,2

_{Ikue Mori}

_{** and}

_{Yuichi Iino}

_*

,3

*_{Department of Biophysics and Biochemistry,}†_{Molecular Genetics Research Laboratory, Graduate School of Science, The University} of Tokyo, Bunkyo-ku, Tokyo 113-0033, Japan and**Group of Molecular Neurobiology, Division of Biological Science,

Graduate School of Science, Nagoya University and CREST–JST, Nagoya 464-8602, Japan Manuscript received June 9, 2010

Accepted for publication August 29, 2010

ABSTRACT

Animals search for foods and decide their behaviors according to previous experience.Caenorhabditis elegansdetects chemicals with a limited number of sensory neurons, allowing us to dissect roles of each neuron for innate and learned behaviors.C. elegansis attracted to salt after exposure to the salt (NaCl) with food. In contrast, it learns to avoid the salt after exposure to the salt without food. In salt-attraction behavior, it is known that theASEtaste sensory neurons (ASELandASER) play a major role. However, little is known about mechanisms for learned salt avoidance. Here, through dissecting contributions of ASEneurons for salt chemotaxis, we show that bothASELandASERgenerate salt chemotaxis plasticity. In ASER, we have previously shown that the insulin/PI 3-kinase signaling acts for starvation-induced salt chemotaxis plasticity. This study shows that the PI 3-kinase signaling promotes aversive drive ofASERbut not ofASEL. Furthermore, the Gqsignaling pathway composed of GqaEGL-30, diacylglycerol, and nPKC (novel protein kinase C) TTX-4 promotes attractive drive of ASER but not of ASEL. A putative salt receptorGCY-22guanylyl cyclase is required inASERfor both salt attraction and avoidance. Our results suggest thatASELandASERuse distinct molecular mechanisms to regulate salt chemotaxis plasticity.

A

NIMALS show various behaviors in response to environmental cues and modulate behaviors according to previous experience. To understand neuronal plasticity underlying learning, it is important to dissect neurons and molecules for sensing environ-mental stimuli, storing memory, and executing learned behaviors.

The nematode Caenorhabditis elegans has only 302 neurons and functions of sensory neurons are well characterized (Whiteet al.1986; Bargmann2006).C.

elegans is attracted to odorants sensed by the AWC olfactory neurons or to salts sensed by theASEgustatory neurons (Bargmann and Horvitz 1991; Bargmann

et al.1993). TheASEneuron class consists of a bilaterally symmetrical pair, ASE-left (ASEL) and ASE-right (ASER), which sense different sets of ions including Na1 _{and Cl , respectively (P}_ierce_-S_himomura _{et al.}

2001; Suzuki et al. 2008; Ortiz et al. 2009). ASEL is

activated by an increase in salt concentration, whereas ASER is activated by a decrease in salt concentration (Suzuki et al.2008). In theASE gustatory neurons, a

cyclic GMP (cGMP) signaling pathway mediates sensory transduction (Komatsuet al.1996; Suzukiet al.2008;

Ortizet al.2009).ASELandASERexpress different sets

of receptor-type guanylyl cyclases (gcys) (Ortiz et al.

2006). Of these,gcy-22, which is specifically expressed in ASER, is important for attraction toASER-sensed ions such as Cl (Ortizet al.2009).

Preference for salts changes according to previous experience (known as gustatory plasticity or salt che-motaxis learning) (Saekiet al.2001; Jansenet al.2002;

Tomioka et al. 2006). When worms are grown on a

medium that contains sodium chloride (NaCl) and food (Escherichia coli), they show attraction to NaCl by using ASE neurons (Bargmann and Horvitz1991; Suzuki

et al.2008). In contrast, after exposure to the salt under starvation conditions, they show reduced attraction to or even avoid the salt (Saeki et al.2001; Jansen et al.

2002; Tomiokaet al.2006). InC. elegans, it was proposed

that preference for a sensory cue is defined by the sensory neuron that detects the cue (Troemel et al.

1997).ASEneurons play a major role for salt attraction (Bargmann and Horvitz 1991; Suzuki et al. 2008;

Ortiz et al. 2009). However, little is known about

Supporting information is available online athttp://www.genetics.org/ cgi/content/full/genetics.110.119768/DC1

1_{These authors contributed equally to this work.}

2_{Present address:}_{Laboratory of Integrative Physiology, Department of} Physiology, Graduate School of Medicine, Osaka University, Osaka 565-0871, Japan.

3_{Corresponding author:} _{Department of Biophysics and Biochemistry,} Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan.

E-mail: [email protected]

(2)

sensory neurons that drive the learned salt avoidance; it remains unclear whether ASE neurons act as salt receptors for the learned avoidance.

We have previously shown that an insulin/PI 3-kinase signaling pathway is essential for salt chemotaxis learn-ing (Tomiokaet al.2006). InC. elegans, the insulin-like

signaling is composed ofdaf-2,age-1,andakt-1, which encode homologs of insulin receptor, PI 3-kinase, and protein kinase B, respectively (Morris et al. 1996;

Kimura et al. 1997; Paradis and Ruvkun 1998).

Mutants ofdaf-2,age-1,andakt-1show attraction to salt even after starvation/NaCl conditioning (Tomiokaet al.

2006).

daf-18 encodes a homolog of phosphatase PTEN (phosphatase and tensin homolog deleted on chromo-some ten), which dephosphorylates phosphatidylinosi-tol (3,4,5)-triphosphate and counteracts the insulin/PI 3-kinase signaling (Ogg and Ruvkun 1998; Gil et al.

1999; Mihaylova et al. 1999; Rouault et al. 1999;

Solariet al.2005). Mutants ofdaf-18, in which the PI

3-kinase signaling is activated, show reduced attraction to NaCl even without conditioning. Since the insulin/PI 3-kinase signaling acts inASER, we proposed that the insulin/PI 3-kinase signaling attenuates the attractive drive ofASER(Tomiokaet al.2006).

InC. elegans, diacylglycerol (DAG) regulates functions of motor neurons and sensory neurons. egl-30, which encodes thea-subunit of heterotrimeric G -protein Gq,

facilitates production of DAG and enhances locomotory movements (Brundageet al.1996; Lackneret al.1999).

In theAWC olfactory neurons, a novel protein kinase C-e/h(nPKC-e/h) orthologTTX-4(also known asPKC-1), which is one of DAG targets, plays an essential role in attraction behavior toAWC-sensed odors (Okochiet al.

2005; Tsunozaki et al. 2008). GOA-1 G_oa regulates

olfactory adaptation by antagonizing Gqa–DAG

signal-ing (Matsukiet al.2006).

This study investigated the involvement of the ASE taste receptor neurons in the starvation-induced salt avoidance. We show that bothASELandASER contrib-ute to salt chemotaxis learning. Activation of the PI 3-kinase signaling and the Gq/DAG/PKC signaling acted

antagonistically in reversal of ASERfunction, whereas these signaling pathways did not have prominent effects onASEL function. In ASER,GCY-22 was required for both salt attraction and avoidance. These results suggest that ASE neurons are important for bidirectional chemotaxis and also suggest that distinct molecular mechanisms regulate functions ofASEL and ASERin salt chemotaxis learning.

MATERIALS AND METHODS

Strains and culture:C. elegansstrains were cultivated at 20°

under standard conditions (Brenner1974), except that theE.

colistrainNA22was used as a food source. Strain used were wild-typeN2, che-1(p674) I,age-1(hx546), age-1(m333) II,

daf-18(e1375), daf-18(mg198) IV, akt-1(ok525), gcy-22(pe902),

gcy-22(pe905), gcy-22(pe917), gcy-22(pe922), gcy-22(tm2364),

lsy-6(ot71), ttx-4(nj3) V, dyf-11(pe554) X, OH7621 otIs204 [ceh-36Tlsy-6, elt-2Tgfp], OH8585 otIs4[gcy-7Tgfp]; otEx3822 [ceh-36TCZ-caspase3(p17); gcy-7Tcaspase3(p12)-NZ; myo-3TmCherry], andOH8593ntIs1[gcy-5Tgfp] V;otEx3830[ceh-36TCZ-caspase3(p17); gcy-5Tcaspase3(p12)-NZ; myo-3TmCherry].

Salt chemotaxis assays:Experiments for Figures 1A, 6A, and 6B were performed on a 9-cm assay plate using a 100 mmNaCl

agar plug as a source of chemoattractant (5 mm in diameter and 7 mm thick) (supporting information, Figure S1A), which was previously described (Tomioka _{et al.}2006). In

experi-ments for Figure 1B, a 100 mmammonium chloride agar plug

(100 mm ammonium chloride adjusted to pH 6.0 with

ammonium hydroxide, 5 mmpotassium phosphate, pH 6.0,

1 mmCaCl

2, 1 mmMgSO4, 2% agar) was placed on a plate (Figure S1A) and animals were preexposed to a mock-conditioning liquid (5 mm potassium phosphate, pH 6.0,

1 mmCaCl

2, 1 mmMgSO4) for 1 hr at room temperature (23°). In other experiments, the chemotaxis assay was performed using a 9-cm assay plate (5 mmpotassium phosphate, pH 6.0,

1 mmCaCl

2, 1 mmMgSO4, 2% agar, 10 ml), on which a salt gradient had been formed for 18–24 hr by placing two agar plugs containing 100 mm of NaCl (100 mm NaCl, 5 mm

potassium phosphate, pH 6.0, 1 mmCaCl

2, 1 mmMgSO4, 2% agar) close to the edge of the plate (Figure S1B). Just before placing the animals, the plugs were removed, and 1ml each of 0.5m_{sodium azide was spotted at the gradient peak(s) and at}

point(s) on the opposite end of the plate (Figure S1). In experiments for Figures 1–4 (except 1B), and 5E, naive animals were used. In experiments for Figure 1B, Figure 5, A– D, and Figure 6, conditioned animals were used. For naive assays, young adults grown on NGM plates seeded withE. coli NA22at 20°were washed three times with wash buffer (5 mm

potassium phosphate, pH 6.0, 1 mm_{CaCl2, 1 m}m _MgSO4,

0.5g/liter gelatin) and directly placed at the center of the assay plates, and then incubated at room temperature (23°) for 30 min. For learning assays, washed young adults were transferred to a conditioning buffer with 20 mm_{NaCl (NaCl}

condition-ing) or without (mock conditioncondition-ing), and incubated at room temperature (23°) for 1 hr. After the incubation, animals were directly placed at the center of the assay plates, and then incubated at room temperature (23°) for 30 min. The chemotaxis index was calculated as described inFigure S1,A was the number of animals within the area including peak(s) of the salt gradient,Bwas the number of animals within the area including the control spot(s),Nwas the number of all animals on an assay plate, andCwas the number of animals that did not move in the central region (Figure S1). In all experiments, 100–200 animals were put on an assay plate.

Genetic screens for suppressor mutations that improve salt chemotaxis ofdaf-18 mutants:Mutagenesis with EMS (ethyl methanesulfonate) was performed as described (Brenner

1974). F1 progeny (15,000) of mutagenized daf-18(e1375) mutants were divided into 46 independent groups and cultured separately. F2 animals were tested for naive chemo-taxis; animals that were attracted to salt were collected. These suppressor candidates were cultured and the progeny were further screened with the same procedure for additional five generations to concentrate suppressor mutants. Finally, single worms were picked from each group and the progeny were tested for suppression.

(3)

alleles were mapped to the left arm of chromosome V (see

results). After sequencing the_gcy-22genomic region of each

suppressor mutant, the mutations were identified.

pe902was identified as a G to A substitution, whose 59and 39 flanking sequences are CCGGCAAATTTTTCCAGGTA and AACAATTGGTGATGGATATT, respectively. pe905 was iden-tified as a G to A substitution, whose 59 and 39 flanking sequences are CAACTTGTGTAAATTCATCG and TTATCTC TTGACTCACCAAC, respectively.pe917was identified as a G to A substitution, whose 59 and 39 flanking sequences are TTAAATTTCAGCCTAACATG and GTGTTAACTAACTGTCG AGA, respectively.pe922was identified as a G to A substitution, whose 59 and 39 flanking sequences are TTACCTATCACA AAAGAAAT and GATATCTACTCATTCGCGAT, respectively.

Mapping and cloning ofpe914:Before mapping ofpe914, the originalpe914;e1375mutant was outcrossed withN2strain and thee1375mutation was removed. Thepe914single mutant showed hyperactive locomotion and egg-laying constitutive phenotype, which is a typical phenotype caused by activation ofegl-30Gqsignaling.pe914was mapped to the right arm of chromosome I using SNPs between CB4856and the pe914

strain. Genomic region ofegl-30was sequenced and a missense mutation was identified. pe914 was identified as a T to A substitution, whose 59and 39flanking sequences are GAATTA TCCACGGTCAGGGA and ATTCGGAAGAGGACAAGCGA, respectively.

PMA treatment: Young adult animals were washed and soaked in a mock-conditioning liquid or a NaCl-conditioning liquid with 1.0mg/ml phorbol 12-myristate 13-acetate (PMA) for 1 hr. After the exposure, animals were directly placed at the center of the assay plates and then incubated at room temperature (23°) for 30 min.

Cloning ofgcy-22cDNA:yk1153.b08(a generous gift from Y. Kohara) corresponds to 39-terminal half of a predictedgcy-22

cDNA. To obtain predicted 59-terminal half ofgcy-22cDNA, reverse transcription reaction was performed using total RNA as a template and a gene-specific primer 59-TAGATCTTCTGT TATCTGCATCAC-39 and SuperScriptIII kit (Invitrogen). 59-terminal gcy-22 cDNA was amplified by RT-PCR using primers 59-GCTAGCATGAGTTTCATATCAAAATGTTTTAT TTGC-39 and 59-TAATGGTCCAACTTGTGACACCGTTGG ATC-39. Then, the obtained 59-terminal fragment ofgcy-22

cDNA was sequenced. The 59-terminal gcy-22 cDNA and yk1153.b08were fused by PCR using primers 59-GCTAGCAT GAGTTTCATATCAAAATGTTTTATTTGC-39 and 59-GGTAC CTTAGATAGATTCTCCATTCTCCTTCGCCTC-39, which yielded a full-lengthgcy-22cDNA. The full-lengthgcy-22cDNA was found to be identical to the gene modelT03D8.5. The full-lengthgcy-22

cDNA was inserted into the pPD-DEST vector to generate agcy-22

destination vector.

Plasmid construction and germline transformation: venus Tdyf-11, egl-30(pe914), ttx-4(A160E), and gcy-22 expression vectors were constructed using the GATEWAY system (Invi-trogen). Procedures for creating these original cDNA con-structs were described previously (Okochi_{et al.}2005; Tomioka

et al.2006; Kunitomo_{and I}ino_{2008). Expression constructs}

composed of particular promoters and the cDNAs were created by LR reactions (site-specific recombination) between the entry plasmids and the destination plasmids. To generate entry vectors carrying gcy-22 promoter sequences, the 2-kb promoter region of gcy-22 were amplified by PCR from C. elegansgenomic DNA and then inserted into the pDONR201 vector by site-specific recombination. Thettx-4(A160E)cDNA was inserted into the pPD-DEST vector to generate a ttx-4(A160E)destination plasmid.

Plasmids were injected into the gonad arms as previously described (Melloet al.1991). Expression constructs for

egl-30(pe914),ttx-4(A160E), andgcy-22were injected at 20 ng/ml

anddyf-11Tvenusexpression constructs were injected at 5 ng/ml, along withmyo-3pTvenus(20 ng/ml) as a transformation marker and pPD49.26 as carrier DNA. In each case, the final concen-tration of injected DNA was 100 ng/ml.

RESULTS

The receptor-type guanylyl cyclase GCY-22 in ASER promotes avoidance indaf-18 PTENmutants:Previously, we have reported that the insulin/PI 3-kinase signaling is required in theASERneuron to attenuate salt attraction after starvation/salt conditioning (Tomioka et al.2006).

daf-18encodes a homolog of phosphatase PTEN, which dephosphorylates PIP3 to negatively regulate the PI

3-kinase signaling (Oggand Ruvkun1998; Gilet al.1999;

Mihaylovaet al.1999; Rouaultet al.1999; Solariet al.

2005). Mutants of daf-18 show reduced attraction even without conditioning (naive conditions), suggesting that the PI 3-kinase signaling is important for the regula-tion ofASERfunction (Tomiokaet al.2006).

To further investigate how the insulin/PI 3-kinase signaling modulates ASER function to regulate salt chemotaxis, we screened for suppressors of the chemo-taxis defect indaf-18mutants. Suppressor mutants were expected to show salt attraction similar to wild-type animals in thedaf-18genetic background. About 30,000 EMS-mutagenized haploid genomes were screened in the daf-18(e1375) genetic background by salt chemo-taxis assay (seematerials and methods). Through the

screening, we obtained 23 suppressor mutants (data not shown). Of these, four suppressor mutations, pe902,

pe905, pe917, and pe922, which clearly suppressed the chemotaxis defect of thedaf-18mutant, were picked up for further analysis (Figure 1A).

The suppressor mutations pe902, pe905, pe917, and

pe922, were mapped by using the SNPs between theN2 strain and theCB4856strain (Wickset al.2001). All of

these suppressor mutations were mapped to the left arm of chromosome V and resided between two SNPs,

pkP5135 and cE5-269. This region contains the gcy-22

gene, which is required for attraction to ASER-sensed ions including chloride ion (Ortizet al.2009). The four

alleles caused reduced attraction to ammonium chlo-ride in the wild-type background, similar to the deletion mutant,gcy-22(tm2364)(Figure 1B). Thetm2364 muta-tion suppressed chemotaxis defect of thedaf-18(e1375) mutant (Figure 1A), indicating that loss of gcy-22

improves chemotaxis ofdaf-18mutants. By sequencing the gcy-22genomic region of each suppressor mutant, nonsense and missense mutations were identified (Fig-ure 1C;Figure S2;materials and methods).

gcy-22encodes a receptor-type guanylyl cyclase, which is specifically expressed in the ASER neuron (Ortiz

et al. 2006; Ortiz et al. 2009). gcy-22 mutants show

diminished calcium responses of ASER to changes of salt concentration (Ortizet al. 2009), suggesting that

(4)

explanation is thatASERpromotes both salt attraction and aversion depending on the activity of the insulin/PI 3-kinase signaling.

ASER promotes salt avoidance and ASEL promotes salt attraction indaf-18mutants: Next, we analyzed salt chemotaxis ofdaf-18mutants in a modified chemotaxis assay (Figure S1B). The new assay format is suitable for characterizing salt avoidance because all animals that avoid salt contribute negatively to the chemotaxis index, which was not the case in the former assay format (Figure S1A).

The new assay format revealed that daf-18 mutants showed a remarkable salt avoidance, whereas wild-type animals were attracted under naive conditions (Figure 2A). The avoidance in the daf-18 mutants was sup-pressed by mutations ofage-1 PI3K andakt-1Akt/PKB

(Figure 2A), indicating that the behavioral switching is dependent on the activity of the PI 3-kinase signaling. The mutation ofakt-1did not restore wild-type chemo-taxis in the daf-18 mutants, suggesting that other molecules act in parallel with AKT-1. These results suggest that activation of the PI 3-kinase signaling promotes salt avoidance rather than downregulates salt attraction under naive conditions.

To identify neurons that promote salt avoidance in

daf-18 mutants, we tested whether ASE neurons are involved in the avoidance behavior of daf-18 mutants.

che-1encodes a zinc finger transcription factor, which is required for specification ofASEneurons, and mutants Figure1.—Loss of a receptor-type guanylyl cyclase GCY-22

suppresses the chemotaxis defect of daf-18 mutants. (A) pe902,pe905,pe917, andpe922were obtained in a suppressor screen for mutations that rescue the chemotaxis defect of daf-18(e1375)mutants. Naive animals were tested for NaCl che-motaxis. A deletion mutationgcy-22(tm2364)also suppresses the chemotaxis defect of the daf-18 mutants. (B) pe902, pe905,pe917,pe922, andtm2364cause defects in attraction be-havior to the ASER-sensed chemical ammonium chloride. (C) Genomic structure of gcy-22 receptor-type guanylyl cyclase. Solid boxes indicate predicted protein domains. Locations of the four suppressor mutations in thegcy-22gene are de-picted. Error bars represent standard error of the mean (SEM). (***)P,0.001, (**)P,0.01, Bonferronit-test.

Figure_{2.—ASER promotes salt avoidance and ASEL}

(5)

ofche-1show defects in salt-attraction behavior (Uchida

et al. 2003). A che-1 mutation suppressed the salt-avoidance behavior, suggesting thatASEmediates the salt aversion indaf-18mutants (Figure 2B).

TheASEneurons consist of a pair of neurons,ASEL and ASER, which are bilaterally symmetrical in mor-phology but functionally distinct (Pierce-Shimomura

et al.2001; Suzuki et al.2008; Ortizet al. 2009).lsy-6

encodes a microRNA that regulates determination of the asymmetrical cell fates ( Johnston and Hobert

2003). Loss of lsy-6 leads to a ‘‘2-ASER’’ mutant phe-notype, whereas ectopic expression of lsy-6 causes a ‘‘2-ASEL’’ phenotype ( Johnston and Hobert 2003;

Ortiz et al. 2009). Calcium responses of the

trans-formedASEL(orASER) to changes in concentration of various ions are comparable to that of authenticASEL (orASER) (Ortizet al.2009).

To dissect contributions of ASEL and ASER to the aversive response ofdaf-18mutants,2-ASELand2-ASER strains that carry thedaf-18mutation were tested for salt chemotaxis. lsy-6; daf-18 double mutants with 2-ASER exhibited stronger salt avoidance compared to the daf-18 mutants, whereas daf-18 mutants with 2-ASEL ex-hibited attraction to NaCl (Figure 2C). These results suggest thatASERpromotes salt avoidance and ASEL promotes salt attraction in daf-18 mutants and also suggest that activation of the insulin/PI 3-kinase signal-ing switches the function of ASER(Figure 2D). They also complement our previous cell-specific rescue ex-periments showing that the DAF-18 acts in ASER to promote salt attraction (Tomiokaet al.2006).

The attraction ofdaf-18;gcy-22mutants was reduced by expression ofgcy-22under thegcy-5promoter, which drives specific expression inASER(Figure 3A). On the other hand, the strong avoidance oflsy-6;daf-18mutants with 2-ASER was suppressed by the gcy-22 mutation (Figure 3B). Taken together, these results suggest that GCY-22 in ASER promotes salt avoidance in daf-18

mutants. In thedaf-18;gcy-22mutant,ASERis dysfunc-tional andASELpromotes salt attraction, which leads to the suppression of the avoidance behavior ofdaf-18.

A Gq/diacylglycerol/PKC signaling promotes salt attraction antagonistic to the insulin/PI 3-kinase signaling: Another suppressor allele, pe914, was identi-fied as a missense mutation inegl-30, which encodes the a-subunit of the heterotrimeric G-protein Gq(Tomioka

et al. 2006). egl-30(pe914) is a presumptive gain-of-function mutation because it caused hyperactive loco-motion and constitutive egg-laying phenotypes (data not shown), which are typical phenotypes ofegl-30(gf)alleles (Schadeet al.2005; Williamset al.2007).pe914is a

mis-sense mutation in linker I, a well-conserved domain of Gqa

across phylogeny (Figure 4A). Expression ofegl-30(pe914) in ASER of daf-18 mutants suppressed the avoidance behavior and switched it to strong attraction. (Figure 4B). In C. elegans motoneurons, egl-30 Gqa facilitates

production of DAG (Brundageet al.1996; Lackner

et al. 1999). An nPKC-e/h ortholog, ttx-4, which is a target of DAG, regulates locomotion behavior (Sieburthet al. 2007).TTX-4also plays an essential

role for the attractive response to odors (Okochiet al.

2005; Tsunozakiet al.2008). Similar to the effects of

egl-30(pe914), expressing TTX-4(A160E), a gain-of-function form ofTTX-4(Dekkeret al.1993; Okochi

et al.2005), inASERswitched the avoidance behavior ofdaf-18mutants to attraction (Figure 4C). Therefore, the Gq/PKC signaling acts antagonistically to the PI

3-kinase signaling.

Taste-receptor ASE neurons promote the learned avoidance: Wild-type animals show salt attraction after exposure to a salt-free liquid without food (mock con-ditioning). In contrast, they show salt avoidance after exposure to a salt-containing liquid without food (NaCl conditioning) (hereafter referred to as ‘‘learned avoid-ance’’). In salt-attraction behaviors,ASEneurons func-tion as main salt receptors (Bargmannand Horvitz

1991; Suzukiet al.2008). To ask whetherASEneurons

are also involved in salt avoidance after NaCl condition-ing, che-1 mutants were subjected to chemotaxis assay after NaCl conditioning. Consistent with the previous report (Hukemaet al.2006),che-1mutants did not show

either attraction or avoidance after conditioning (Fig-ure 5A). This suggests thatASEneurons are required for the learned salt avoidance.

Next, we tested the learning abilities of animals with genetically ablatedASELorASERneuron (Ortizet al.

2009). In these strains, the apoptosis-inducing protein caspase is expressed in ASEL or ASER (Ortiz et al.

2009). Both ablated animals showed defects in the aversive response after NaCl conditioning compared to control animals (Figure 5B), suggesting that bothASEs Figure 3.—The receptor-type guanylyl cyclase GCY-22 in

(6)

are required for the learned avoidance. Both ablated animals and animals with 2-ASER or 2-ASEL showed chemotaxis plasticity following the conditioning (Fig-ure 5, A and B), suggesting that bothASEscontribute to salt chemotaxis plasticity. The learned avoidance of animals with 2-ASER was fully dependent on gcy-22, indicating thatASERpromotes learned salt avoidance depending onGCY-22function (Figure 5C). Thegcy-22

mutant also showed learned avoidance, suggesting that GCY-22-independent plasticity, probably mediated by

ASEL, also contributes to salt chemotaxis learning (Figure 5C).

Next, we asked whetherASEneurons are sufficient to direct the learned avoidance. We tested salt chemotaxis of animals with disrupted chemosensory neurons except ASERorASEL.dyf-11encodes a protein that is required for cilium biogenesis of sensory neurons. Loss ofdyf-11

causes truncation of sensory endings and defects in responses to water-soluble compounds (Kunitomoand

Iino2008). Animals with functionalASERorASEL, or

both, by cell-specific rescue of these neurons, showed salt chemotaxis plasticity: mock-conditioned animals showed attraction behavior and NaCl-conditioned ani-mals showed diminished attractive responses but did not show learned avoidance (Figure 5D). This result sug-gests that ASEL andASER are sufficient to direct salt attraction but insufficient to direct salt avoidance after conditioning. Sensory neurons other thanASEare also required for the learned avoidance.

Next, we asked whether salt reception by ASER is sufficient to direct salt avoidance indaf-18mutants. We tested salt chemotaxis ofdaf-18mutants with disrupted chemosensory neurons except ASER. Expressing DYF-11 in ASER of dyf-11 mutant restored wild-type salt attraction under naive conditions (Figure 5E). However, under thedyf-11;daf-18mutant background, expression of DYF-11 in ASER was insufficient to direct the salt avoidance (Figure 5E). This result is in contrast todaf-18

anddaf-18; 2-ASER mutants whereASER-mediated salt avoidance behaviors were observed. These results suggest that ASERis not sufficient and chemosensory neurons other thanASERare required for the full expression of the PI 3-kinase-dependent avoidance behavior.

Enhanced Gq/DAG/PKC signaling impairs the learned salt avoidance: As described above, the Gq/

DAG/PKC signaling acts in ASER and promotes salt attraction. We further tested whether activity of the Gq/

DAG/PKC signaling is crucial for the reorientation of chemotaxis in starvation-induced learning. Treatment with a DAG analog PMA during the conditioning caused attraction behavior even after NaCl conditioning (Figure 6A), an effect similar to overexpression of egl-30(pe914) in ASER (Tomioka et al. 2006). Enhanced

activity of nPKC byTTX-4(A160E) expression inASER disturbed the learned avoidance and caused strong salt attraction (Figure 6B). These results suggest that the normal regulation of the Gq/DAG/PKC signaling is

required for switching ofASERfunction by the condi-tioning; the enhanced activity of the Gq/DAG/PKC

signaling fixes ASER to the mode that promotes salt attraction. On the other hand, activation of TTX-4in ASEL did not cause significant effects on the learned avoidance (Figure 6B), suggesting that the roles of TTX-4are different depending on cell types. Notably, while loss of function mutants ofttx-4showed defects in salt attraction, they showed salt avoidance after NaCl conditioning comparable to, or greater than, wild-type Figure4.—G

(7)

animals (Figure 6C). This suggests that TTX-4 is re-quired for salt attraction but not for salt avoidance.

DISCUSSION

In this study, we reported that bothASELandASER generate starvation-induced salt chemotaxis plasticity. We showed that the PI 3-kinase signaling and the Gq/

DAG/PKC signaling inASERcontribute to reversal of the orientation of salt chemotaxis. Attractive and aversive drives ofASERdepend onGCY-22function.

GCY-22 is essential for attractive and repulsive responses mediated by ASER: GCY-22 is localized to the cilium and is required for calcium responses of ASER, suggesting thatGCY-22 mediates sensory trans-duction ofASER(Ortizet al.2009). However, it has not

been tested whether the activity ofGCY-22or cGMP level inASERis regulated by changes in salt concentration. Another possibility that cannot be excluded at this point is that GCY-22 acts for modulation of ASERfunction. Because several guanylyl cyclases are expressed in interneuronsor nonneuronal cells (Ortizet al.2006),

Figure5.—Taste receptor

(8)

guanylyl cyclases includingGCY-22may not be directly involved in odor or salt sensation. One prominent example is GCY-28, which regulates odor preference switching in theAWCneuron (Tsunozakiet al.2008).

GCY-28.d isoform is localized to the axon and may regulate synaptic transmission (Tsunozakiet al.2008).

The extracellular domain ofGCY-22is most homologous to mammalian guanylyl cyclase B (data not shown), which binds natriuretic peptides, raising a possibility thatGCY-22might be a receptor for hormonal peptides. The fact thatgcy-22mutations suppress salt repulsion ofdaf-18mutants can be explained by simply assuming that ASER promotes avoidance in daf-18 mutants and

gcy-22is required for ASERfunction. In addition, there might be functional interactions betweenGCY-22and the PI 3-kinase signaling pathway, as well as the Gqpathway.

For example, it is possible that the PI 3-kinase signal-ing and the Gq/DAG/PKC signaling may modulate the

function ofGCY-22to help behavioral switching between attraction and avoidance. Conversely, it is also possible thatGCY-22/cGMP signaling regulates the activities of the insulin/PI 3-kinase signaling and the Gq/DAG/PKC

signaling.

In this study, the suppression of the chemotaxis de-fect ofdaf-18mutants bygcy-22mutation was not fully rescued by the expression ofgcy-22under the control of theASER-specificgcy-5orgcy-22promoters (Figure 3A). Several possibilities may explain the result. One is that

gcy-22 may have several splicing isoforms. Another possibility is that GCY-22 also acts in cells other than ASER. Alternatively, expression level ofGCY-22was not sufficient for the rescue.

Activation of EGL-30/DAG/TTX-4 signaling in ASER promotes salt attraction:Activation ofEGL-30orTTX-4 or treatment with a DAG analog PMA causes strong salt attraction even after starvation/NaCl conditioning and reverses salt avoidance indaf-18mutants to attrac-tion.EGL-30 was suggested to be coupled with several G-protein-coupled receptors, such as muscarinic acetyl-choline receptors (mAChR) (Lackner et al. 1999), a

DOP-1dopamine receptor (Chaseet al.2004; Kindtet al.

2007), GAR-3 mAChR (Liu et al. 2007), and SER-3

octopamine receptor (Suoet al.2006). Although

activa-tion ofEGL-30and addition of a DAG analog promote salt attraction, it is unknown whetherEGL-30is required for the production of DAG in ASER. GPA-12/G12/13a

(Hileyet al.2006),RHO-1Rho (Mcmullanet al.2006),

and UNC-73 Rho GEF (Williams et al. 2007) also

stimulate production of DAG. In motor neurons, EGL-30activates phospholipase C-bEGL-8 phospholi-pase C-b, which results in production of DAG (Lackner

et al.1999). In ASER, it is unknown which phospholi-pase produces DAG. How environmental stimuli and signaling molecules control the DAG level inASERis an important question, which is to be addressed in the future.

Althoughttx-4mutants display a defect in salt attrac-tion, they show learned salt avoidance comparable to the wild-type animals. This observation suggests that TTX-4 is required for salt attraction but not for salt avoidance. Inmotor neuronsofttx-4mutants, release of neuropeptides is impaired, whereas release of acetyl-choline is intact (Sieburth et al. 2007). Therefore,

release of neuropeptides regulated byTTX-4 inASER Figure6.—Constitutive activation of the

Gq/diacylglycerol/PKC signaling fixes ASER to promote attraction behavior. (A) Animals were treated in a mock-conditioning liquid or a NaCl-conditioning liquid with or with-out the diacylglycerol analog PMA. Treat-ment with PMA disrupts starvation/NaCl learning and causes attraction behavior after the NaCl conditioning. (B) TTX-4(A160E) was expressed in ASER under thegcy-5 pro-moter or in ASEL under thegcy-7promoter. Expression of TTX-4(A160E) in ASER causes attraction behavior even after NaCl conditioning. (C)ttx-4mutants show defects in salt attraction but not in salt avoidance. (D) Schematic of molecular mechanisms in ASE neurons and AWC neurons that reg-ulate gustatory and olfactory plasticity, re-spectively (see text). Guanylyl cyclases GCY-22, GCY-14, DAF-11, and ODR-1 are re-quired for chemosensation. GCY-22 acts in ASER and GCY-14 acts in ASEL for sensing ions (Ortiz et al. 2009). In AWC, ODR-1

and DAF-11 are required for sensing odors (Birnby et al. 2000; L’etoile and B arg-mann 2000). Error bars represent SEM.

(9)

may promote salt attraction.UNC-13is also known as a presynaptic target of DAG and is essential for synaptic vesicle priming (Maruyamaand Brenner1991; Lackner

et al.1999; Richmondet al.1999). In theASERneuron,

UNC-13is likely to be involved in the release of classical neurotransmitters such as glutamate, and its roles in salt chemotaxis need to be determined.

Although activation ofTTX-4inASERpromotes salt attraction, activation ofTTX-4inASELdid not promote attraction (Figure 6B).TTX-4positively regulates func-tion of the nociceptive neuronsASHand the olfactory neurons AWA, whereas TTX-4 negatively regulates function of thethermosensory neurons AFD(Okochi

et al.2005). These pieces of evidence imply that roles of the targets ofTTX-4are different among each sensory neuron. One possibility is that different sets of neuro-peptides have distinct functions in each sensory neuron. In mammals, diacylglycerol analog PMA augments release of synaptic vesicles and dense core vesicles in a Munc-13- and PKCs-dependent manner (Majewskiand

Iannazzo 1998; Broseet al. 2000). Although in vitro

analyses revealed potential targets of PKCs (Leenders

and Sheng2005), little is known about targets of nPKC

in vivo.

Neurons involved in salt chemotaxis plasticity: Al-though ASEL, as well as ASER, contributes to salt chemotaxis plasticity, we have not found prominent roles of the insulin/PI 3-kinase signaling and the Gq/

DAG/PKC signaling for regulation of ASEL. These results imply that signals of food/starvation and salt may be encoded by distinct molecules depending on cell types. Thus, it is important to investigate molecules that regulate the plasticity of each cell.

How do neural circuits includingASE neurons direct the learned avoidance? There are at least two possible mechanisms. One model is that unidentified sensory neurons (such as ASH neurons) direct the learned avoidance and these avoidance neurons are modulated by ASE neurons. In accordance with this model, Hukema

et al.(2006) showed thatASI,ADF, andASHneurons are required for salt avoidance and proposed that ASEs sensitizeASH, which directs salt avoidance.ASH, as well as ASE, is activated by changes in salt concentration (Suzuki et al. 2008; Thiele et al. 2009), making ASH

neurons good candidates for salt receptors in the learned avoidance. However, it is still unknown whether ASH directs salt avoidance. Another model is thatASEneurons act as salt receptors and other supporting neurons modulateASEsto direct the learned avoidance. In this model, supporting neurons modulate signaling such as the PI 3-kinase signaling or the Gq/DAG/PKC signaling

in ASEs. At present, there is no direct evidence that discriminates these two possibilities. Our results point out the importance ofGCY-22 in ASERfor salt avoid-ance behavior, which supports the second model.

Since the PI 3-kinase signaling may mediate a starva-tion signal, food-sensing neurons may be also important

for regulating the salt preference directed byASER, for example, through secretion of an insulin-like ligand. Apart from possible roles for interaction between sensory neurons, it is also possible that signals from several sensory neurons are integrated atinterneurons to establish the learned avoidance.

The salt-avoidance behavior indaf-18mutants required functions of neurons other than ASER (Figure 5E). Although expression ofDAF-18inASERis sufficient to restore wild-type salt attraction (Tomiokaet al.2006), it is

possible thatDAF-18also acts in cells other thanASER. Alternatively, the supporting neurons might be required to induce the salt avoidance caused by loss ofDAF-18in ASER.

The preference switch as a common property of sensory neurons: In mouse, fly, andC. elegans, character-istics of each sensory neuron define each innate behavior (Yarmolinsky et al. 2009). C. elegans shows dramatic

changes of preference for AWC-sensed odors and ASE-sensed salts; when worms are conditioned with odor (salts) and starvation, they show avoidance behavior to the same odorants (salts) (Hukemaet al.2006; Tomioka

et al.2006; Tsunozakiet al.2008).ASERandAWChave

some common features (summarized in Figure 6D). Both neurons use cGMP in sensory transduction (Coburn and Bargmann 1996; Komatsu et al. 1996;

Birnbyet al.2000; L’etoileand Bargmann2000; Ortiz

et al. 2009). Calcium concentration is elevated upon decreases of odor or salt concentration (Chalasaniet al.

2007; Suzukiet al.2008). Furthermore,AWCandASER

have common synaptic targets (White et al. 1986).

Therefore,ASERandAWCmay share common molec-ular mechanisms that switch preferences for the chemicals.

InASER, the insulin/PI 3-kinase signaling and the Gq/

DAG/PKC signaling regulate salt preference. Similarly, the insulin/PI 3-kinase signaling and the DAG/PKC signaling regulate odor preference inAWCneurons (Matsukiet al.

2006; Tsunozakiet al.2008; Linet al.2010). It is interesting

that gcy-28and ttx-4mutants show repulsive behavior to odors in an AWC-dependent manner (Tsunozakiet al.

2008). From analysis of these mutants, Tsunozaki et al.

(2008) proposed thatAWCneurons can switch between attractive and repulsive signaling modes. However, it was not tested whether reception of odors byAWCdirects the learned odor avoidance. It is important to determine gustatory or olfactory neurons that act as receptors in the learned behavior. Nevertheless,ASERandAWCcontribute to both attraction and avoidance according to past experience and have potential to act as receptors for bidirectional chemotaxis.

(10)

study were provided by the Caenorhabditis Genetics Center (CGC). This work was supported by the Grant-in-Aid for Scientific Research on Priority Area ‘‘Molecular Brain Sciences,’’ Innovative Area ‘‘Systems Molecular Ethology,’’ and Global COE Program (Integrative Life Science Based on the Study of Biosignaling Mechanisms) from the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan.

LITERATURE CITED

Bargmann, C., 2006 Chemosensation inC. elegans(October 25, 2006),

WormBook, ed. TheC. elegansResearch Community, WormBook, doi/10.1895/wormbook.1.123.1, http://www.wormbook.org. Bargmann, C., and H. Horvitz, 1991 Chemosensory neurons with

overlapping functions direct chemotaxis to multiple chemicals in C. elegans. Neuron7:729–742.

Bargmann_{, C., E. H}artwieg _{and H. H}orvitz_{, 1993}

Odorant-selective genes and neurons mediate olfaction inC. elegans. Cell 74:515–527.

Birnby, D., E. Link, J. Vowels, H. Tian, P. Colacurcio et al.,

2000 A transmembrane guanylyl cyclase (DAF-11) and Hsp90 (DAF-21) regulate a common set of chemosensory behaviors in Caenorhabditis elegans. Genetics155:85–104.

Brenner, S., 1974 The genetics of_{Caenorhabditis elegan}s. Genetics

77:71–94.

Brose_{, N., C. R}osenmund_{and J. R}ettig_{, 2000} _{Regulation of}

trans-mitter release by Unc-13 and its homologues. Curr. Opin. Neuro-biol.10:303–311.

Brundage, L., L. Avery, A. Katz, U. Kim, J. Mendel et al.,

1996 Mutations in aC. elegansGqalpha gene disrupt movement, egg laying, and viability. Neuron16:999–1009.

Chalasani, S., N. Chronis, M. Tsunozaki, J. Gray, D. Ramot_{et al.},

2007 Dissecting a circuit for olfactory behaviour in Caenorhabdi-tis elegans. Nature450:63–70.

Chase_{, D., J. P}epper_{and M. K}oelle_{, 2004} _{Mechanism of}

extrasy-naptic dopamine signaling inCaenorhabditis elegans. Nat. Neuro-sci.7:1096–1103.

Coburn, C., and C. Bargmann, 1996 A putative cyclic

nucleotide-gated channel is required for sensory development and function inC. elegans. Neuron17:695–706.

Dekker, L., P. McIntyreand P. Parker, 1993 Mutagenesis of the

reg-ulatory domain of rat protein kinase C-eta: a molecular basis for restricted histone kinase activity. J. Biol. Chem.268:19498–19504. Gil_{, E., E. M}alone _Link_{, L. L}iu_{, C. J}ohnson _{and J. L}ees_,

1999 Regulation of the insulin-like developmental pathway of Caenorhabditis elegansby a homolog of the PTEN tumor suppres-sor gene. Proc. Natl. Acad. Sci. USA96:2925–2930.

Hiley_{, E., R. M}c_Mullan_{and S. N}urrish_{, 2006} _{The Galpha12-RGS}

RhoGEF-RhoA signalling pathway regulates neurotransmitter re-lease inC. elegans. EMBO J.25:5884–5895.

Hukema, R., S. Rademakers, M. Dekkers, J. Burghoorn and

G. Jansen, 2006 Antagonistic sensory cues generate gustatory

plasticity inCaenorhabditis elegans. EMBO J.25:312–322. Jansen, G., D. Weinkoveand R. Plasterk, 2002 The G -protein

gamma subunit gpc-1 of the nematodeC.elegansis involved in taste adaptation. EMBO J.21:986–994.

Johnston_{, R., and O. H}obert_{, 2003} _{A microRNA controlling left/}

right neuronal asymmetry inCaenorhabditis elegans. Nature426: 845–849.

Kimura, K., H. Tissenbaum, Y. Liuand G. Ruvkun, 1997 daf-2, an

insulin receptor-like gene that regulates longevity and diapause inCaenorhabditis elegans. Science277:942–946.

Kindt, K., K. Quast, A. Giles, S. De, D. Hendrey et al.,

2007 Dopamine mediates context-dependent modulation of sensory plasticity inC. elegans. Neuron55:662–676.

Komatsu_{, H., I. M}ori_{, J. R}hee_{, N. A}kaike _{and Y. O}hshima_,

1996 Mutations in a cyclic nucleotide-gated channel lead to ab-normal thermosensation and chemosensation inC. elegans. Neu-ron17:707–718.

Kunitomo_{, H., and Y. I}ino_{, 2008} _{Caenorhabditis elegans}_{DYF-11, an}

orthologue of mammalian Traf3ip1/MIP-T3, is required for sen-sory cilia formation. Genes Cells13:13–25.

Lackner, M., S. Nurrishand J. Kaplan, 1999 Facilitation of

synap-tic transmission by EGL-30 Gqalpha and EGL-8 PLCbeta: DAG binding to UNC-13 is required to stimulate acetylcholine release. Neuron24:335–346.

Leenders_{, A., and Z. S}heng_{, 2005} _{Modulation of}

neurotransmit-ter release by the second messenger-activated protein kinases: implications for presynaptic plasticity. Pharmacol. Ther.105: 69–84.

L’Etoile_{, N., and C. B}argmann_{, 2000} _{Olfaction and odor}

discrim-ination are mediated by theC. elegansguanylyl cyclase ODR-1. Neuron25:575–586.

Lin, C., M. Tomioka, S. Pereira, L. Sellings, Y. Iinoet al., 2010 Insulin

signaling plays a dual role inCaenorhabditis elegansmemory acquisi-tion and memory retrieval. J. Neurosci.30:8001–8011.

Liu, Y., B. LeBoeufand L. Garcia, 2007 G alpha(q)-coupled

mus-carinic acetylcholine receptors enhance nicotinic acetylcholine receptor signaling in Caenorhabditis elegans mating behavior. J. Neurosci.27:1411–1421.

Majewski_{, H., and L. I}annazzo_{, 1998} _{Protein kinase C: a}

physiolog-ical mediator of enhanced transmitter output. Prog. Neurobiol. 55:463–475.

Maruyama_{, I., and S. B}renner_{, 1991} _{A phorbol}

ester/diacylglycerol-binding protein encoded by the unc-13 gene ofCaenorhabditis el-egans. Proc. Natl. Acad. Sci. USA88:5729–5733.

Matsuki, M., H. Kunitomoand Y. Iino, 2006 Goalpha regulates

ol-factory adaptation by antagonizing Gqalpha-DAG signaling in Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA103:1112–1117. McMullan, R., E. Hiley, P. Morrisonand S. Nurrish, 2006 Rho is

a presynaptic activator of neurotransmitter release at pre-existing synapses inC. elegans. Genes Dev.20:65–76.

Mello_{, C., J. K}ramer_{, D. S}tinchcomb_{and V. A}mbros_{, 1991} _Efficient

gene transfer inC.elegans: extrachromosomal maintenance and in-tegration of transforming sequences. EMBO J.10:3959–3970. Mihaylova, V., C. Borland, L. Manjarrez, M. Sternand H. Sun,

1999 The PTEN tumor suppressor homolog inCaenorhabditis el-egans regulates longevity and dauer formation in an insulin receptor-like signaling pathway. Proc. Natl. Acad. Sci. USA96: 7427–7432.

Morris, J., H. Tissenbaumand G. Ruvkun, 1996 A

phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in Cae-norhabditis elegans. Nature382:536–539.

Ogg, S., and G. Ruvkun, 1998 The_{C. elegans}PTEN homolog,

DAF-18, acts in the insulin receptor-like metabolic signaling pathway. Mol. Cell2:887–893.

Okochi_{, Y., K. K}imura_{, A. O}hta_{and I. M}ori_{, 2005} _Diverse

regula-tion of sensory signaling byC. elegansnPKC-epsilon/eta TTX-4. EMBO J.24:2127–2137.

Ortiz, C., J. Etchberger, S. Posy, C. Frøkjaer-Jensen, S. Lockery

et al., 2006 Searching for neuronal left/right asymmetry: ge-nomewide analysis of nematode receptor-type guanylyl cyclases. Genetics173:131–149.

Ortiz, C., S. Faumont, J. Takayama, H. Ahmed, A. Goldsmithet al.,

2009 Lateralized gustatory behavior ofC. elegansis controlled by specific receptor-type guanylyl cyclases. Curr. Biol.19:996–1004. Paradis_{, S., and G. R}uvkun_{, 1998} _{Caenorhabditis elegans}_Akt/PKB

transduces insulin receptor-like signals from AGE-1 PI3 kinase to the DAF-16 transcription factor. Genes Dev.12:2488–2498. Pierce_-Shimomura_{, J., S. F}aumont_{, M. G}aston_{, B. P}earson_{and S.}

Lockery_{, 2001} _{The homeobox gene lim-6 is required for}

dis-tinct chemosensory representations in C. elegans. Nature 410: 694–698.

Richmond, J., W. Davisand E. Jorgensen, 1999 UNC-13 is

re-quired for synaptic vesicle fusion inC. elegans. Nat. Neurosci. 2:959–964.

Rouault, J., P. Kuwabara, O. Sinilnikova, L. Duret, D. Thierry

-Mieg et al., 1999 Regulation of dauer larva development in

Caenorhabditis elegansby daf-18, a homologue of the tumour sup-pressor PTEN. Curr. Biol.9:329–332.

Saeki_{, S., M. Y}amamoto_{and Y. I}ino_{, 2001} _{Plasticity of chemotaxis}

revealed by paired presentation of a chemoattractant and starva-tion in the nematodeCaenorhabditis elegans. J. Exp. Biol.204: 1757–1764.

Schade_{, M., N. R}eynolds_{, C. D}ollins_{and K. M}iller_{, 2005} _Mutations

(11)

mutants activate the Ga(s) pathway and define a third major branch of the synaptic signaling network. Genetics169:631–649. Sieburth, D., J. Madisonand J. Kaplan, 2007 PKC-1 regulates

se-cretion of neuropeptides. Nat. Neurosci.10:49–57.

Solari, F., A. Bourbon-Piffaut, I. Masse, B. Payrastre, A. Chan

et al., 2005 The human tumour suppressor PTEN regulates lon-gevity and dauer formation inCaenorhabditis elegans. Oncogene 24:20–27.

Suo_{, S., Y. K}imura_{and H. V}an_Tol_{, 2006} _{Starvation induces cAMP}

response element-binding protein-dependent gene expression through octopamine-Gq signaling in Caenorhabditis elegans. J. Neurosci.26:10082–10090.

Suzuki_{, H., T. T}hiele_{, S. F}aumont_{, M. E}zcurra_{, S. L}ockery_{et al.}_,

2008 Functional asymmetry inCaenorhabditis eleganstaste neurons and its computational role in chemotaxis. Nature454:114–117. Thiele, T., S. Faumontand S. Lockery, 2009 The neural network

for chemotaxis to tastants inCaenorhabditis elegansis specialized for temporal differentiation. J. Neurosci.29:11904–11911. Tomioka, M., T. Adachi, H. Suzuki, H. Kunitomo, W. Schafer_{et al.},

2006 The insulin/PI 3-kinase pathway regulates salt chemotaxis learning inCaenorhabditis elegans. Neuron51:613–625. Troemel_{, E., B. K}immel_{and C. B}argmann_{, 1997} _{Reprogramming}

chemotaxis responses: sensory neurons define olfactory prefer-ences inC. elegans. Cell91:161–169.

Tsunozaki, M., S. Chalasaniand C. Bargmann, 2008 A behavioral

switch: cGMP and PKC signaling in olfactory neurons reverses odor preference inC. elegans. Neuron59:959–971.

Uchida, O., H. Nakano, M. Kogaand Y. Ohshima, 2003 TheC.

elegansche-1 gene encodes a zinc finger transcription factor re-quired for specification of the ASE chemosensory neurons. De-velopment130:1215–1224.

White_{, J., E. S}outhgate_{, J. T}homson_{and S. B}renner_{, 1986} _The

structure of the nervous system of the nematodeCaenorhabditis elegans. Philos. Trans. R. Soc. Lond. B Biol. Sci.314:1–341. Wicks_{, S., R. Y}eh_{, W. G}ish_{, R. W}aterston _{and R. P}lasterk_,

2001 Rapid gene mapping inCaenorhabditis elegansusing a high density polymorphism map. Nat. Genet.28:160–164.

Williams, S., S. Lutz, N. Charlie, C. Vettel, M. Ailion _{et al.},

2007 Trio’s Rho-specific GEF domain is the missing Galpha q effector inC. elegans. Genes Dev.21:2731–2746.

Yarmolinsky, D., C. Zukerand N. Ryba, 2009 Common sense

about taste: from mammals to insects. Cell139:234–244.

(12)

GENETICS

Supporting Information

http://www.genetics.org/cgi/content/full/genetics.110.119768/DC1