*Graphical Abstract (for review)
Research Highlights
1. Replacement of the conserved Trp at Arkadia RING domain.
2. NMR models of W972A and W972R Arkadia RING domain mutants.
3. Differences in conformational properties between the mutated RINGs 4. Different interaction properties of the mutated RINGs with E2/UbcH5B 5. W972A RING domain mutant retain its ligase activity.
*Research Highlights
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
1
A residue-specific insight into the Arkadia E3
2
ubiquitin ligase activity and conformational plasticity
3
4
5
Maria Birkou
a, Christos T. Chasapis
a, Konstantinos D. Marousis
a, Ariadni K.
6
Loutsidou
a, Detlef Bentrop
b, Moreno Lelli
c,#, Torsten Herrmann
c, Jonathon M.
7
Carthy, Vasso Episkopou
d*, and Georgios A. Spyroulias
a*
8
9
a Department of Pharmacy, University of Patras, GR-26504, Patras, Greece.
10
b Institute of Physiology II, Faculty of Medicine, University of Freiburg, 79104 Freiburg, 11
Germany.
12
c Institut des Sciences Analytiques, Centre de RMN à Très Hauts Champs, UMR 5280 CNRS, 13
ENS Lyon, UCB Lyon 1, Université de Lyon, 5 rue de la Doua, 69100 Villeurbanne, France 14
# Current Address: Center for Magnetic Resonance, University of Florence, Via L. Sacconi 15
6, 50019 Sesto Fiorentino, Italy 16
d Faculty of Medicine, Imperial College London, Hammersmith Hospital Campus, 17
Burlington Danes, London W12 0NN, United Kingdom 18
19
Running Title: Structure-Function correlation of Arkadia RING-H2 Trp mutants.
20
Keywords: Rnf111, RING domain, TGF-β, NMR, APSY 21
22
* Correspondence to: V. Episkopou, Tel: +44 (0)20 7594 6587, Email:
23
[email protected], URL: http://www.imperial.ac.uk/people/vasso.episkopou 24
G. A. Spyroulias, Tel: +30 2610962350-1-2, Fax: +30 2610997693. E-mail:
25
[email protected] , URL: http://bionmr.upatras.gr, 26
27
*Manuscript
Click here to view linked References
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61
Abstract
28
Arkadia (Rnf111) is an E3 Ubiquitin ligase that plays a central role in the amplification of 29
TGF-β signaling responses by targeting for degradation the negative regulators of the 30
pathway, Smad6 and Smad7 and the nuclear co-repressors Ski and Skil (SnoN). Arkadia’s 31
function in vivo depends on the RING-H2 association with the E2 enzyme in order to ligate 32
ubiquitin chains on its substrates. A conserved tryptophan (W972) in its C-terminal α-helix is 33
widely accepted as essential for E2 recruitment, interaction and thus also for E3 enzymatic 34
activity.
35
The present, NMR-driven study provides an atomic-level investigation of the structural and 36
dynamical properties of two W972 Arkadia RING mutants, attempting to illuminate for the 37
first time the differences between a functional and a nonfunctional mutant (W972A and 38
W972R, respectively). A TGF-β responsive promoter driving luciferase was used to assay for 39
Arkadia function in vivo. These experiments showed that the Arkadia W972A mutant has the 40
same activity, as wt Arkadia in enhancing TGF-β signaling responses while W972R does not.
41
Only minor structural differences exist between the W972A RING domain and WT-RING. In 42
contrast, the W972R mutant hardly interacts with E2. The loss of function correlates with 43
structural changes in the α-helix and an increase in the distance between the Zn(II) ions. Our 44
data show that position, which occupied by W972 on wt Arkadia is critical, both for the 45
structure and the function of RING, but these properties are found to depend on the 46
physicochemical properties of the residue at this position of the α-helix.
47 48 49 50 51 52 53
Abbreviations: Ub, ubiquitin; TGF-β, transforming growth factor beta; RING, Really 54
Interesting New Gene; NMR, Nuclear Magnetic Resonance; HSQC, heteronuclear single 55
quantum coherence; NOESY, Nuclear Overhauser Effect Spectroscopy; APSY, Automated 56
Projection Spectroscopy 57
58
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Introduction
59
TGF-β secreted factors belong to a large family of growth factors. At the cellular level, TGF- 60
β proteins regulate fundamental processes such as proliferation, differentiation, death, 61
cytoskeletal organization, adhesion and migration1. Disruptions in TGF-β family signaling 62
are detrimental to human health and indeed mutations or alterations in components of this 63
pathway have been associated with human diseases notably cancer and various skeletal, 64
autoimmune, cardiovascular, muscle, and fibrotic disorders2,3. The wide variation in cellular 65
responses to TGF-β signaling and especially the cross talk with other pathways constitute a 66
complex network of biochemical processes which has proven difficult to target for cancer 67
therapy.
68
TGF-β ligands bind and activate serine/threonine kinase receptors type I and type II which 69
activate by C-terminal phosphorylation of receptor Smads (R-Smads)4. Activated R-Smads 70
(pSmads) complex with the common Smad4 and go to the nucleus where they bind to DNA 71
sites along with other transcription partner factors and regulate target genes5,6. Several factors 72
regulate signaling intracellularly and moreover, the ubiquitin-proteasome pathway plays a 73
critical role in regulation of TGF-β signaling7. Specifically Smad6 and Smad7 inhibits 74
receptor phosphorylation of R-Smads by interacting with the receptors and by mediating their 75
degradation by recruiting Smurf2, an E3 ubiquitin ligase8,9. Furthermore, Ski and Skil 76
(SnoN) are nuclear co-repressors that bind to R-Smads and Smad4 and recruit histone 77
deacetylases to repress Smad-target gene transcription10,11,12,13
. All the above negative factors 78
are substrates of Arkadia (RNF111), a RING-domain E3 ubiquitin-ligase that targets them for 79
degradation14,15,16. 80
E3 ubiquitin ligases recognize the target substrates and ligate onto them conserved 76-residue 81
ubiquitin protein chains. Proteins tagged with ubiquitin chains mainly are targeted for 82
degradation by the proteasome17. Arkadia is widely expressed broadly in mammalian tissues 83
and as it degrades negative regulators of the TGF-β pathway, it is a positive regulator 84
resulting in enhancing signalling18. Arkadia was shown to enhance a subset of TGF-β 85
signalling functions in mouse embryos, only those required for head development and not 86
those required for more posterior structures19. Furthermore, Arkadia like TGF-β signaling 87
exhibits tumor-suppressing function in colon18 and to enhance metastasis of human tumor cell 88
lines injected into mice20. As Arkadia is a positive regulator of TGF-β responses and is 89
involved in cancer, it represents a possible therapeutic target20. For this additional structural 90
and functional studies are required.
91
Arkadia is a nuclear protein with a 994 amino acid open reading frame (ORF) in humans and 92
bears a characteristic RING-H2 domain at its C-terminus21. The heterologous expression, 93
solution structure and dynamics of this RING-H2 domain (residues 927-994) have been 94
presented elsewhere22,23(PDB 2KIZ). Its tertiary structure is determined by two or three β- 95
strands, namely β1, β2 and β3 forming an antiparallel β-sheet, two large Zn(II) binding loops 96
and a 3-turn α-helix with the secondary structure being arranged in the βββα topology that is 97
characteristic for RING domains.
98
The E3 ubiquitin ligase enzymatic activity of Arkadia depends on its interaction with the E2 99
enzyme UbcH5b24. This interaction has been studied through titration experiments monitored 100
by 1H-15N HSQC nuclear magnetic resonance (NMR) spectra, since NMR can study transient 101
complexes and the interaction of molecules that take place in a fast-exchange regime. The 102
interaction interface between the two proteins suggested a major role for the RING-H2 103
residue Trp972 of Arkadia in E2 recognition and binding23. This tryptophan is located in the 104
α-helix and conserved in the RING domains of many proteins with proven E3 Ub ligase 105
activity. Replacement of this Trp by Ala in RING domains of proteins such as EL5, c-Cbl 106
and Kaposi’s sarcoma-associated Herpes virus K3 variant lead to a reduced affinity for E2 107
enzyme and a complete loss of E3 activity25,26,27. On the other hand, the RING domains of 108 BRCA1 and CNOT4, in which the Trp position in the C-terminal -helix is occupied by Leu 109
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61
or Ile, are functional. However, mutation of these residues to Ala resulted again in a loss of 110
E3’s ability to interact with its E2 partner and to perform ubiquitination28,29. Therefore, the 111
available literature data strongly suggest that Trp or another large hydrophobic residue like 112
Leu and Ile is crucial for RING E3 ligase function and the association with E2 enzymes, 113
whereas mutation to Ala leads to loss of function25,26,27,28,29
114 .
In this work, we aim to elucidate the requirements of E2 recruitment by the RING domain of 115
Arkadia for its enzymatic activity. For this we mutated the conserved Arkadia Trp972 both to 116
alanine and to arginine. The three dimensional structure of each mutant in solution was 117
determined by NMR spectroscopy applying an identical protocol for automated NMR 118
structure elucidation that consisted of automated projection spectroscopy (APSY) and fully 119
unsupervised NMR data analysis and structure calculation with the program UNIO30,31. The 120
function of the full length Arkadia bearing these two mutations in the RING domain was 121
tested in vivo in tissue culture using a Smad-dependent CAGA12 promoter driving the 122
expression of a luciferase reporter gene. Moreover, we performed NMR titration experiments 123
with the RING927-994 mutants to investigate their interaction with the UbcH5b E2 enzyme, 124
which suggest that E2 interaction with the two Arkadia RING mutants, differs significantly.
125 126 127
Results
128
To address the recruitment of E2 enzyme by the RING of Arkadia the residue tryptophan 972 129
(W972), which is conserved and presumed critical for the interaction with E2, was 130
mutagenized. Tryptophan was chosen to be substituted by an alanine (A) as this substitution 131
has been used to inactivate the enzymatic function of several other RING domain E3 132
ubiquitin ligases25,26,27,28,29
. Furthermore, this residue was substituted with arginine (R) 133
because it is a positively charged residue and bears a long, bulky side-chain, which could also 134
affect the structure of RING and this could address the role of the structure of the RING in 135
the recruitment of E2. Both Arkadia tryptophan mutants exhibit the basic ββα-fold of RING 136
domains (Figure 1 & 2), which was also found for the native Arkadia RING-H223. The 137
identified long-range NOEs support the cross-brace Zn(II)-ligating topology of RING 138
domains. As in WT the zinc ions are coordinated by six cysteines and two histidines in the 139
sequence motifs Cys942-X2-C945-Zn1-His965-X2-Cys968 and Cys960-X-His962-Zn2- 140
Cys979-X2-Cys982. The tautomeric state of the histidine ligands is identical in the two 141
mutants with the Nδ1 atoms of the imidazole ring being the donor atoms according to 1H–15N 142
HSQC experiments optimized for the 2JHN couplings (Figure S3). The same donor atoms 143
were identified in the WT RING-H2 domain23. 144
145
Solution structure and 15N relaxation studies of the W972A mutant.
146
The solution structure of the W972A mutant was determined from a total of 842 NOEs. In 147 the average energy minimized NMR model, there are four -strands the first two of which are 148
at the first Zn-binding site and consist of two residues each, namely β1 (Lys941-Cys942) and 149
β1’ (Ser947-Ile948). The remaining two -strands are longer and comprise Val955-Leu958 150
(β2) and His962-His965 (β3), respectively. They form the same antiparallel β-sheet as in the 151
WT RING domain23. Moreover, the a-helix observed in the W972A mutant is identical to the 152
native Arkadia RING helix; it spans the same three turns from residues Gln966 to Thr975 as 153
in WT, indicating that the replacement of Trp972 by Ala does not affect the helical 154
propensity. Thus, the secondary structure elements of the W972A RING domain are arranged 155
into a ββββα-fold as in the Pirh232 and rnf38 (PDB 1X4J) RING domains. The average 156
distance between the two metal centers in the final 30 NMR models is 14.0 ± 0.5 Å (13.1- 157
14.9 Å) and 14.3 Å in the mean model (Figure 2C & D). The final family of 30 energy- 158
minimized models of W972A exhibits backbone and heavy atom RMSDs of 1.02 ± 0.32 Å 159
and 1.66 ± 0.27 Å, respectively, for a superposition of the core region between Thr938 and 160
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Ala988. Quality assessment of the final models reveals that 98.6% of the non-glycine/non- 161
proline residues fall into favorable or allowed regions of the φ/ψ dihedral angle space in the 162
Ramachandran plot. Analysis of the surface electrostatic charges reveals a high similarity 163
between the W972A mutant and WT.
164 15
N relaxation studies of the W972A construct exclude the formation of homo-dimers since 165
the correlation time for isotropic tumbling in solution based on the R2/R1 ratio is 4.60 ± 0.02 166
ns corresponding to MW ∼8-9 kDa (theoretical MW of W972A RING is 7710 Da). In 167
addition, model-free analysis of 15N relaxation data as implemented in the Tensor2 program 168
shows that the core exhibits a rather rigid structure. The order parameters of the region 169
Thr938-Ala988 (average S2=0.77) are higher than those of the N- and C-terminal residues 170
(Lys927-Asp937 and Glu989-Ser994) with average S2 values of 0.41 and 0.42, respectively, 171
closely resembling the 15N-relaxation properties of the native Arkadia RING23(Figure 3).
172 173
Solution structure and 15N relaxation studies of the W972R mutant 174
The solution structure of the W972R mutant was determined from a total of 752 NOEs. The 175
secondary structure elements, according to the average energy minimized model, comprise 176
two short β-strands, namely β1 (Lys941-Cys942) and β1’ (Ser947-Ile948), forming again an 177
antiparallel β-sheet at the first Zn-binding site, two longer β-strands composed of residues 178
Val955-Leu958 (β2) and His962-His965 (β3), respectively, and a 2-turn α-helix 179
encompassing Gln966–Arg972. In a few models (5 out of 30 models), a 310-helix was 180
observed for the segment Leu973-Thr975. This region forms a loose turn in most of the 181
models (25 models), indicating that Arg972 distorts the last turn of the native Arkadia α- 182 helix. In two models, the Lys978-Cys979 and Val984-Asp985 adopt a -conformation. The 183
average distance between the two metal centers in the final 30 NMR models is 16.4 ± 0.5 Å 184
(15.5-17.7 Å) and 16.6 Å in the mean model (Figure 2E & F). The final family of 30 energy- 185
minimized models of W972R exhibits backbone and heavy atom RMSDs of 1.16 ± 0.23 Å 186
and 1.93 ± 0.23 Å, respectively, for the core region Thr938–Ala988 (51 residues). In the 187
Ramachandran plot, 98.1% of the non-glycine/non-proline residues fall into favorable or 188
allowed regions. The electrostatic surface potential of RING W972R has mainly two negative 189
surface patches and one small positively charged stretch, similar to WT. The two negatively 190
charged, solvent-accessible segments are comprised of residues Glu935/936 and Glu939/940 191
preceding the first Zn(II) binding motif and residues Glu950/951/953/Asp954, respectively.
192
The positively charged stretch comprises two consecutive arginines (Arg956/957), while the 193
additional Arg972 introduces a positive charge to the surface of the α-helix.
194
Analysis of 15N backbone relaxation data of the W972R mutant provides a correlation time 195
for isotropic tumbling in solution of 4.83 ± 0.01 ns, which corresponds to MW ∼8-9 kDa 196
(theoretical MW of W972R RING is 7790 Da). Thus the RINGvariant is in the monomeric 197
state, while model-free analysis shows that the RING core region exhibits a rather rigid 198
structure. The order parameters of the region Thr938-Ala988 (average S2=0.78) are much 199
higher than those of the N- and C-terminal residues (Lys927-Asp937 and Glu989-Ser994 200
with average S2 values of 0.47 and 0.44 respectively), closely resembling the 15N-relaxation 201
properties of both the native Arkadia RING23 and W972A (Figure 3).
202
Interestingly, residues Arg972-Thr975 following the short α-helix of W972R show 203
significantly smaller S2 values (average S2= 0.61) than in WT and W972A. This indicates that 204
the W972R mutation imposes higher mobility to the neighbouring residues, which leads to a 205
distortion of the C-terminal end of the α-helix. Moreover, residues Glu951-Val955 in the 206
loop before the β2-strand, neighboring to the first Zn(II) binding site, exhibit slightly higher 207
mobility and a limited number of NOEs as illustrated by the highest rmsd values in the core 208
region of the 30 NMR models (average rmsd 1.65 Å for BB and 2.80 for HA). In contrast, 209
this loop is well-defined in the alanine mutant and the wild-type RING.
210 211
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61
NMR study of the interaction between Arkadia mutants and UbcH5b.
212
The interaction of both mutated Arkadia RING domains with the E2 enzyme UbcH5b was 213
studied through titrations of 15N-labeled Arkadia samples with non-labeled UbcH5b and vice 214
versa. They were performed up to a final molar ratio of 1:2 of labeled: unlabeled protein and 215
monitored after each addition by a 1H–15N HSQC spectrum, allowing the identification of 216
Arkadia mutant and UbcH5b residues that participate in RING-E2 interaction. Chemical shift 217
perturbations of Arkadia mutants and E2 enzyme amide resonances were plotted as a 218
function of the E2/E3 or E3/E2 molar ratio, respectively, and mapped onto the amino acid 219
sequence of the respective protein (Figure 4).
220 221
W972A & UbcH5b:
222
During the titration of 15N W972A RING with UbcH5b E2 enzyme, most of the resonances 223
exhibited either fast or intermediate exchange behavior, suggesting relatively fast exchange 224
between the bound and unbound states and a moderate affinity of the two proteins. The 225
largest chemical shift changes were observed for the sequential stretches Lys941–Leu949, 226
Val955-Leu958, Leu963-Val969, Ile974-Cys979, and for residues Ala972 and Arg983. The 227
backbone amide cross peak of Gln971 in the -helix was the only one that was broadened 228
beyond detection during the titration(Figure 4B). The first and the third perturbed region 229
comprise the first and the third Zn(II)-binding motif, respectively, while the fourth one is at 230
the C-terminus of the α-helix; Arg983 is located right at the beginning of the C-terminal loop.
231
The above regions are essentially identical with those exhibiting the largest chemical shift 232
changes in the native RING23. Surprisingly, the UbcH5b induced chemical shift differences 233
(CSDs) are overall bigger for the W972A variant than for Arkadia WT RING (Figure 4A &
234 235 B).
The addition of unlabeled E3 partner to 15N-labeled UbcH5b resulted in the loss of only four 236
UbcH5b amide resonances (Leu3, Asp12, Leu13 and Ser100) in the 1H–15N HSQC spectra 237
during the titration. The largest CSDs in UbcH5b were observed for residues in the N- 238
terminal helix α1 (Lys4-Glu9), in loop L1 (Asp59, Phe62) between the β3 and β4 strands, 239
and for residues in loop L2b and the first half of helix α2 (Glu92, Ser94, Ala96, Thr98, Ile99, 240
Lys101, Leu103 and Leu104) (Figure 4E). The maximum chemical shift perturbation was 241
0.10 ppm as opposed to 0.20 ppm for WT. All of the above residues were also found to 242
participate in native Arkadia RING–E2 interactions23, suggesting that E2 utilizes the same 243
interface for its interaction with the Arkadia RING mutant W972A.
244 245
W972R & UbcH5b:
246
The NMR data from the titration of 15N W972R RING with the unlabelled UbcH5b E2 247
enzyme suggests a weaker interaction of the polypeptides, compared with the native RING 248
and E2. The CSDs are considerably smaller than those observed for the native RING and 249
exhibit a threshold of 0.048 ppm. Moreover, the number of RING interacting residues is 250
smaller (18 residues above threshold) compared with native RING and W972A (22 and 21 251
residues above threshold, respectively). The largest chemical shift changes were observed for 252
the sequential stretches Thr943-Ile944, Val955-Arg956, Leu963-Val969 and for the residues 253
Leu946, Leu958, Leu973, Lys977, Ile981 and Ile 986. These results show that the surface 254
areas that interact with the E2 partner in native RING and mutant are relatively well 255
conserved. However, a smaller number of residues from these regions in the W972R mutant 256
participate in the interaction (Figure 4C). All these data hint at a weaker interaction of 257
W972R compared to native RING.
258
The addition of unlabelled E3 partner to the 15N labelled UbcH5b confirms a weak 259
interaction, supported by small CSDs (threshold 0.012) and a limited number of residues 260
participating in the interaction with the Arkadia W972R mutant (Figure 4F). The largest 261
chemical shift changes are observed for the UbcH5b regions Lys4-Ile6, Asp12-Ala15, Ala96- 262
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Leu97, Ile99-Leu104, as well as for the residues Ala2, Lys8, Phe51, Ile54, Phe56, Thr58, 263
Tyr60, Phe62, Lys63 and Lys66. These residues belong to the N-terminal α1-helix, the β3 264
strand, the loop L1 and the first half of the α2-helix. Interestingly, two regions found to 265
interact with the native RING domain and the W972A mutant are not involved in E2 266
interaction with W972R. The first one is near the β1 strand which follows the α1-helix 267
(Ala19-Ser22) and a number of β2 strand residues (Met30-Gln34, Thr36, Ile37). The second 268
region consists of the α3/10 helix and other residues nearby (Cys85, Asp87, Arg90, Gln92, 269
Ser94). Taken together the NMR data indicate a very weak interaction of W972R RING and 270
UbcH5b E2 enzyme.
271 272
The role of W972 on Arkadia function in vivo 273
In order to examine the impact of the Arkadia W972 mutations in TGF-β signaling we 274
performed experiments employing the luciferase reporter assay. Specifically, we tested the 275
functionality of W972A and W972R mutants in FAK cells using the CAGA12-Luc reporter 276
assay (Figure 5). Overexpression of the full length GAKD carrying the W972A mutation 277
enhanced the reporter expression to a similar level as the wild type GAKD. In contrast, the 278
W972R mutant reduced signaling suggested that exhibits a dominant-negative function 279
similar to the control plasmid GAKD-ΔRING. These data suggest that the two residues, Ala 280
and Arg, imposed completely different function in the mutated RING; the former retains the 281
RING E3 Ub ligase activity, while the latter does not.
282 283 284
Discussion
285
Conformational properties of the W972R mutant – Comparison with WT 286
There are significant structural differences between WT RING and the W972R mutant on the 287
level of secondary structure and regarding the distance between the two metal ions. The WT 288
Arkadia RING domain23 (PDB 1KIZ) has a () topology with a 3-turn -helix whereas 289
the W972R variant shows a topology with a 2-turn -helix. On the other hand, it is 290
important to note that according to 15N relaxation measurements the internal rigidity of the 291
RING core on the ps-ns time scale is not abolished by the W972R mutation (Figure 3 and 292
Figure S1 & S2).
293 In the WT structure, Trp972 is located at the beginning of the third turn of the -helix that is 294
the major structural element of the Zn-2 binding loop encompassing residues Cys960- 295
Cys982. Its bulky indole ring is packed into a mainly hydrophobic pocket lined by the side 296
chains of Ile944 (part of the first Zn-binding motif CTIC), Asn976 and Pro980 (almost 297
parallel to the indole ring). The NE1 atom of the pyrrole moiety is hydrogen-bonded to the 298
carbonyl oxygen of Lys978, stabilizing the conformation of the Zn-2 binding loop.
299
Substitution of Trp972 with a positively charged arginine abolishes this interaction, thus 300
destabilizing the Zn-2 binding loop which adopts a more open, solvent exposed conformation 301
in the mutant. In the structure of W972R RING the long side chain of Arg972 is oriented 302
towards the solvent as defined by NOE connectivities with the side chains of Ile944, Gln 971, 303
Leu973 and Ile974. This orientation avoids unfavorable repulsive interactions of the 304
guanidinium group with other positively charged residues in or immediately following the 305
Zn-2 binding loop, namely Lys977, Lys978 and Arg983. In addition the W972R mutation 306
enhances the ps-ns mobility of the following residues and destabilizes the last turn of the 307
RING -helix which is a 2-turn helix (Q966-R972) instead of a 3-turn helix in WT (Q966- 308
T975). This provides additional conformational freedom to the Zn-2 binding loop and 309
contributes to the stretching of the RING core (Figure 2) as clearly identified by an 310
unusually long distance of more than 16 Å between the two Zn(II) binding sites (16.4 ± 0.5 Å 311
for the final 30 NMR models and 16.6 Å in mean model). In WT RING, the Zn2+-Zn2+
312
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61
distance is 14.7 ± 0.2 Å while in other RING domains of known structure this value varies 313
only between 15.1 ± 0.2 Å and 13.3 ± 0.1 Å15 (Figure 2A & B).
314
Long-range structural effects of the W972R mutation on the Zn-1 binding site are also 315 evident from the fact that two key NOE connectivities between the H protons of Val955 and 316 Gln966 and between CH3 of Ile948 and H of Glu950, respectively, observed in the spectra 317
of WT, are now missing. As a consequence the characteristic antiparallel -sheet formed by 318 -strands 2 and 3 and the loop spanning residues 951-955 close to the Zn-1 site are somewhat 319
distorted in W972 RING.
320
The molecular surface of the RING domain between the two metal-binding sites constitutes 321
the interaction interface with E2 enzymes in which the RING -helix plays an important role 322
and provides a number of contacts with E2 residues. In the W972R RING, the destabilization 323
and enhanced backbone mobility of the C-terminal turn of this helix contribute to the 324
displacement of the Zn-2 binding loop and the stretching of the Zn2+-Zn2+ distance, which 325
can readily explain the observation that the mutant interacts only weakly with the E2 enzyme 326
UbcH5b (Figure 4) and has lost its ubiquitination capacity (Figure 5). Relatively few 327
chemical shift changes were detected in 1H-15N HSQC spectra of W972R during titration 328
with UbcH5b, while the chemical shift changes observed for 15N E2 are the smallest among 329
the three Arkadia RING variants studied so far (Figure 4F). In a biological assay, full length 330
Arkadia with the W972R mutation reduced the luciferase reporter expression to the same 331
levels as the empty control plasmid and the ΔRING Arkadia plasmid (Figure 5).
332 333
Conformational properties of the W972A mutant – Comparison with WT 334
The W972A RING variant has the same topology as W972R, but the replacement of 335
Trp972 by alanine causes only minor changes of the RING structure and its molecular 336
surface with respect to WT. Most importantly, the distance between the two Zn(II)-binding 337
sites is 14.0 ± 0.5 Å (14.3 Å in the mean model). This number is very close to the 14.7 ± 0.2 338
Å in WT and well within the range of Zn2+-Zn2+ distances in other RING-H2 domains28. The 339
-helix in W972A is a 3-turn helix encompassing exactly the same residues as in the native 340
RING domain (Gln966-Thr975).
341
The W972A mutation eliminates again the abovementioned hydrogen bond between the 342
indole NE1 atom of Trp972 and the carbonyl oxygen of Lys978. However, the small CH3
343
group of Ala972 is easily accommodated in the hydrophobic core of the protein so that it can 344
become more compact allowing the two Zn(II) binding sites to approach each other a little 345
more than in WT. Therefore, from a structural point of view, the alanine mutation has the 346
opposite effect on the Zn2+-Zn2+ distance than the arginine mutation which results in an 347
increase of about 1.7 Å. As far as the ps-ns mobility is concerned, the alanine mutation has 348
essentially no effects on the RING core.
349
Most importantly, the W972A mutant is capable of interacting with E2 UbcH5b as shown by 350
titration experiments monitored by 1H-15N HSQC spectra and a biological assay (Figure 4B 351
& E; Figure 5). The observed chemical shift perturbations in 15N RING are even bigger than 352
those in titrations of WT and UbcH5b (Figure 4A & D). This finding strongly suggests a 353
native-like interaction via a molecular surface involving the two metal-binding loops and 354
parts of the -helix (including residue 972). Interestingly, another recently reported structural 355
study of a RING E3 ligase, namely RNF4 (which also functions as SUMO-targeted ubiquitin 356
ligase, like Arkadia)33,34 bears a serine at the position of the tryptophan, and the RING 357
interaction surface with E2, exhibits remarkable similarities with WT Arkadia and W972A 358
mutant. The luciferase reporter assay showed convincingly that full length Arkadia with the 359
W972A mutation has the same ubiquitination efficiency as WT Arkadia (Figure 5).
360
Overall, the conformational features of the Arkadia RING domain are not dramatically 361
affected by the mutation of Trp972 to arginine. However, it imposes small structural changes 362
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
on the RING scaffold with the most important being those observed on the -sheet 363
components, the second half of the α-helix and the distance between the two metal sites 364
which becomes larger. The low internal mobility of the RING core is not significantly 365
affected by Arg972 according to 15N-relaxation measurements, but this RING variant does 366
not interact with the UbcH5b E2 enzyme, in contrast with the native Arkadia RING.
367
On the other hand, the mutation of Trp972 to alanine hardly influences the conformational 368
properties of the RING domain. Its molecular surface between the two metal binding sites 369
seems to remain intact, with the distance between the two Zn(II)-sites practically unchanged.
370
The replacement of Trp972 by Ala endows some regions (Ser947-Glu951 and Thr975- 371
Asn976) with slightly higher backbone mobility, but the non-native RING domain interacts 372
almost normally with UbcH5b.
373
The enzymatic activity of the full-length Arkadia E3 ligase with either the native RING 374
domain or the W972A or W972R mutation was tested in FAK cells using the CAGA12-Luc 375
reporter assay (Figure 5). The obtained data provide clear experimental evidence that full 376
length Arkadia carrying the W972A mutation enhances reporter expression to a similar level 377
as WT Arkadia. In contrast, the W972R mutation reduced the reporter expression similar to 378
the empty control plasmid and the ΔRING Arkadia plasmid. These results are in agreement 379
with the NMR data showing that W972R RING does not interact effectively with the partner 380
E2 enzyme. Thus, W972R Arkadia exhibits a dominant-negative function.
381 382 383
Conclusion
384
E3-E2 recognition and interaction is among the key events in the ubiquitin pathway.
385
According to literature data, mutation of the conserved Trp residue in RING E3 Ub ligases 386
(mostly to alanine) has a dramatic effect on Ub ligase activity24,25,35,36,37
, while the present 387
study reveals for the first time24,25,37,38,39
that a mutated RING with tryptophan substituted by 388
an alanine retains its ligase activity, according to luciferase assays described in this work. In 389
contrast, when tryptophan is replaced by arginine, the Arkadia RING loses the Ub ligase 390
function. Moreover, the present structural study comprises the first atomic-level investigation 391
of the conformational dynamics properties of two Trp mutants with different function.
392
According to the data presented herein the alanine mutant exhibits similarities with native 393
RING and differences with arginine RING, both in conformational properties and interaction 394
with E2.
395
Specifically, we provide experimental evidence that the interaction of the RING domain with 396
UbcH5b E2 enzyme can take place, in a native-like manner, even in the absence of the α- 397
helix tryptophan. A hydrophobic residue such as alanine can replace the bulky Trp side chain 398
without altering RING’s surface properties, thus allowing the interaction with E2, while the 399
long side chain of arginine hinders the contact between the E2 and RING interaction areas.
400
On the other hand, the rigidity of parts of the RING core seems to depend on the Trp residue 401
since the internal mobility of the RING is slightly tuned by the residue replacing Trp.
402
Additionally, the distance between the Zn(II) ions is affected by the amino acid at position 403
972. It becomes shorter in W972A and longer in W972R, but the shorter distance does not 404
prevent W972A to be functional. In contrast, the larger distance between the metal ions in 405
W972R, in concert with the solvent exposed Arg side chain, abolishes its ubiquitination 406
capacity in a luciferase reporter assay.
407
Therefore, this study shows that the absence of the conserved α-helix tryptophan can be 408
counterbalanced by a residue that does not alter dramatically the physicochemical properties 409
of the E2 interaction surface of the RING. Note that there are native functional RING 410
domains that have a leucine (BRCA1, HDM2, HDMX)40,41, a cysteine (BARD1)42 or a serine 411
(RNF4)33 at the position of this tryptophan, as well (Figure S4). In contrast, there are 412
paradigms in the literature, reporting that the replacement of this Trp by an Ala influences 413
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61
both the structure and the function of the RING E3 ligase activity39. According to the NMR 414
data reported by Katoh et al39, the 15N-HSQC spectrum of the EL5 W165A suggests that the 415
polypeptide does not fold properly and therefore the structural role of the Trp in EL5 is really 416
significant.
417
The biologically relevant conformational dynamics of RING domains is an intriguing 418
research topic, which is further pursued in our lab through the design of new mutants inspired 419
by the primary structure of RING and other Zn(II)-binding domains.
420 421 422
Material and Methods
423
Cloning and Mutagenesis of Recombinant Arkadia RING domain 424
The nucleotide sequence for residues Lys927-Ser994 of Arkadia was PCR- amplified using 425
primers 5’- CACCATGAAACAAGATGGGGAAGAAGGG -3’ and 5’-
426
CCCTTCTCCCCCATCTTGTTTCATGGTG-3’. The mutants of the wild type RING domain 427
were created by site- directed mutagenesis (Quick change Site directed mutagenesis kit, 428
Stratagene) using the primers 5’- CACCATGAAACAAGAGCGGGAAGAAGGG-3’ and 5’- 429
CCCTTCTCCCCG CTCTTGTTTCATGGTG -3’ as template for the Trp to Ala mutant and 430
5’- CACCATGAAACAAGACGGGGAAGAAGGG-3’ and 5’- CCCTTCTCCCCCGTC 431
TTGTTTCATGGT G -3’as template for the Trp to Arg mutant. The PCR products were 432
purified by electrophoresis on a 1.8 % agarose gel and isolated using Pure Link Quick gel 433
extraction kit (Invitrogen, Life Sciences). Each purified PCR product was digested with 434
BamH1 and XhoI and then inserted at the BamH1 and XhoI sites of pGEX-4T-1. The 435
sequences of the mutated PCR products were verified by DNA sequencing.
436 437
Recombinant Protein Expression and Purification 438
GST-fusion proteins of Arkadia mutants were expressed in Escherichia coli BL21(DE3) cells 439
(Stratagene) that were first grown to OD600 nm< 0.6, then induced with isopropyl- β-D- 440
thiogalactopyranoside (IPTG, 1 mM final concentration), and finally cultured for an 441
additional 4 h at 37 oC in 1 L of M9 medium with 1 mg/L ampicillin. For labeled protein 442
expression, 15NH4Cl or/and 13C-labelled glucose were used as nitrogen and carbon sources, 443
respectively. After 4 h, bacteria were harvested by centrifugation and the pellets were frozen.
444
Bacterial pellets were suspended in PBS buffer (Biorad) and then sonicated. The lysates were 445
centrifuged at 21,000 g for 45 min and the supernatants were applied to a GST- trap affinity 446
column (GE Healthcare, Life Sciences). After unbound proteins were eluted in column buffer 447
(PBS, 10 mM sodium phosphate, 150 mM sodium chloride, pH= 7.8 ± 0.2), the GST-tag was 448
removed by cleavage with thrombin (Sigma-Aldrich) at 25 oC for at least 12 h. Arkadia 449
mutants without tag were concentrated using Amicon Ultra 15, 3 kDa (Merck Millipore).
450
The E2 enzyme UbcH5b was expressed in Rosetta 2 (DE3) cells (Novagen) that were first 451
grown to OD600 nm< 0.6, then induced with IPTG (0.5 mM final concentration), and finally 452
cultured for additional 5 h at 37 oC in 1 L of M9 medium with 1 mg/ mL ampicillin and 1 453
mL/L BioExpress® (Cambridge Isotope Laboratories). For 15N-labeled protein the medium 454
was supplemented with 1 g/L 15NH4Cl. After 5 h, bacteria were harvested by centrifugation 455
and the pellets were frozen. Bacterial pellets were suspended in binding buffer (10 mM 456
imidazole, 20 mM Na2HPO4, 0.5 M NaCl, pH= 8) and then sonicated. The lysate was 457
centrifuged at 21,000 g for 45 min and the supernatant was applied to a His-trap affinity 458
column (GE Healthcare, Life sciences) to which zinc was bound. For protein elution, buffers 459
with increasing concentrations of imidazole (20-400 mM) in binding buffer were used.
460
UbcH5b was eluted in binding buffer with 300 mM imidazole and concentrated using 461
Amicon Ultra 15, 10 kDa (Merck Millipore).
462
For NMR studies and titration experiments, PBS and imidazole buffers were exchanged to 50 463
mM potassium phosphate buffer pH= 7.
464
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
465
NMR spectroscopy and structure determination of Arkadia W972A and W972R 466
NMR measurements were carried out on 0.6-0.8 mM W972A & W972R RING927-994 samples 467
in 300 μl (using shigemi NMR tubes) or 600 μl (using 5 mm NMR tubes) mixed solvent of 468
90% H2O (50 mM KPi, pH 7) and 10% 2H2O. 1D 1H-NMR and 1H-15N HSQC spectra were 469
recorded at 298 K on the following Bruker spectrometers: Avance 600, HD Avance III 700, 470
Avance 1000, all equipped with cryoprobes. 1H 1D spectra were acquired using 16 ppm 471
spectral width using a variety of pulse sequences for water suppression and spectra were 472
calibrated relative to the water proton resonances. The 2D 15N HSQC spectra were acquired 473
using a spectral width of 40 ppm for ω1 and 8 ppm for ω2. Three APSY experiments were 474
recorded on a Bruker Avance III 600 MHz spectrometer equipped with a TCl z-gradient 475
cryogenic probe, namely a 4D APSY-HACANH, a 5D APSY-CBCACONH and a 5D 476
APSY-HACACONH43. Three 3D 15N/13C-HSQC-NOESY experiments were recorded at 477
1000 MHz, whereas 15N relaxation measurements were done at lower magnetic fields (600 478
and 700 MHz). Titration experiments were performed at the 700 MHz HD Avance III 479
instrument equipped with a TCI cryoprobe.
480
Analysis of the three APSY-NMR data sets with the program GAPRO44 yielded three peak 481
lists as input for the software UNIO-MATCH for automated backbone resonance 482
assignment45. The input for automated side chain chemical shift assignment with UNIO- 483
ATNOS/ASCAN46 consisted of the aforementioned 3D 15N-, 13Cali- and 13Caro-resolved 484
[1H,1H]-NOESY spectra and the previously derived backbone chemical shifts. The input for 485
automated NOESY peak picking and NOE assignments with UNIO-ATNOS/CANDID47,48 486
consisted of the UNIO-MATCH chemical shift assignments for the polypeptide backbone, 487
the UNIO-ATNOS/ASCAN output of side chain chemical shift assignments, and the three 488
NOESY data sets. The standard UNIO protocol was employed that consisted of seven cycles 489
of NOESY peak identification, NOE assignment and structure calculation. Each cycle 490
comprised automated NOESY peak picking with ATNOS47, use of the resulting lists of peak 491
positions and intensities as input for automated CANDID NOE assignment48, and use of the 492
final set of meaningful, non-redundant NOE distance restraints from CANDID as input for 493
structure calculation using the simulated annealing routine of CYANA49. In each UNIO–
494
ATNOS/CANDID cycle, the output consisted of an updated list of assigned NOE cross peaks 495
for each input spectrum and a final set of meaningful upper limit distance restraints which 496
constituted the input for the torsion angle dynamics algorithm of CYANA for three- 497
dimensional (3D) structure calculation. In addition, torsion angle restraints for the backbone 498
dihedral angles ϕ and ψ derived from all backbone chemical shifts were automatically 499
generated by UNIO and added to the input for each cycle of structure calculation. During the 500
first six UNIO–ATNOS/CANDID cycles, ambiguous distance restraints were used. For the 501
final structure calculation in cycle 7, only distance restraints were retained by UNIO that 502
could be unambiguously assigned based on the protein three-dimensional structure from 503
cycle 650. 504
Pseudoatom correction before restrained energy minimization (REM) by AMBER was 505
performed according to the DYANA format for pseudoatoms. Each of the 30 lowest target 506
function conformers was energy-minimized in vacuo with the program AMBER51, as already 507
described for the native Arkadia RING domain23. 508
For both mutants the atomic coordinates of the 30 models ensemble and the average, energy 509
minimized, models have been deposited in the Protein Data Bank (PDB IDs: 5LG0 for 510
W972A and 5LG7 for W972R; statistical analysis is reported at Table S1 & S2).
511 512
15N relaxation data 513
The backbone mobility of the two Arkadia RING mutants on the ps-ns time scale was 514
investigated through 15N relaxation measurements (15N T1 and T2, {1HN}-15N NOE at 298 K) 515
