Penile hypoplasia and rudimentary prepuce in a dog (78,XY; SRY positive): a case report

0
0
9
1 week ago
PDF Preview
Full text
(1)Veterinarni Medicina, 61, 2016 (5): 279–287. Case Report. doi: 10.17221/8884-VETMED. Penile hypoplasia and rudimentary prepuce in a dog (78,XY; SRY-positive): a case report D. Rozanska1, I. Szczerbal2, M. Stachowiak2, P. Debiak1, A. Smiech1, P. Rozanski1, M. Orzelski1, B. Zylinska1, M. Switonski2, B. Slaska1 1 2. University of Life Sciences in Lublin, Lublin, Poland Poznan University of Life Sciences, Poznan, Poland. ABSTRACT: This is the first report in the literature concerning penile hypoplasia and rudimentary prepuce in a 78,XY; SRY-positive male that received a successful surgical treatment. A six-month-old male mixed-breed dog with body weight of 3.5 kg and with symptoms of prolonged stranguria and abnormalities of the external genitalia were presented by the owner at the University Surgical Clinic. Clinical, biochemical, radiological, pathological, and genetic examinations of the dog were carried out. Penile hypoplasia and rudimentary prepuce were diagnosed. Early diagnosis of penile hypoplasia and rudimentary prepuce in small animals requires a high level of vigilance and is based on clinical and ultrasonographical findings. The radiography revealed a fan-shaped widening of the caudal part and shortening of the os penis. A hyperechogenic os penis with a wide posterior part and a slightly curved, smooth anterior end was imaged. No normal prepuce structures were observed. The endocrinological examination showed a substantially decreased testosterone level. Fast surgical intervention is preferable and confirms the diagnosis. In the presented case report enlargement of the preputial orifice was applied in order to prevent urinary retention and recurrent urinary tract infections. Orchiectomy was also performed. After the surgery, immediate clinical improvement was noted. The testicular atrophy diagnosed in the histological analysis explains the low level of the hormone. The cytogenetic analysis revealed a normal male set of chromosomes – 78,XY. The molecular analysis showed presence of the SRY gene as well as the ZFY gene, which reside on the Y chromosome and the ZFX, which is X-linked. The successful amplification of the SRY, ZFX, and ZFY genes confirmed the presence of both X and Y chromosomes. Sequencing and comparison with the reference sequence of the canine SRY gene indicated a normal sequence in the examined dog. Given the absence of polymorphisms and mutations in the coding sequence of the SRY gene, it can be assumed that it is not associated with the observed phenotype. The studied case was classified as testicular XY (SRY-positive) disorder of sex development (DSD), the aetiology of which remains unknown. Keywords: dog; disorder of sex development; penile hypoplasia; rudimentary prepuce; SRY; ZFX/ZFY. Determination of sex in mammals consists of a number of genetically and hormonally controlled phases. Disturbances in successive developmental stages result in congenital disorders collectively referred to as disorders of sex development (DSD; Meyers-Wallen 2012). The causes of DSD include sex chromosome abnormalities, mutations of genes involved in sex determination, and environmental factors that disturb the process (Poth et al. 2010; Meyers-Wallen 2012). Among chromosomal DSD the most frequent in dogs are X monosomy (77,X), as well as trisomies (79,XXX and 79,XXY).. Moreover, several cases of lymphocyte chimerism 78,XX/78,XY have been diagnosed (Szczerbal et al. 2014). Among monogenic DSD, the most frequent cases involve the presence of testes or ovotestes (despite the absence of the SRY gene) in individuals with a female karyotype (78,XX) and lack of the SRY gene (Salamon et al. 2014). The molecular background of this developmental defect has not been fully elucidated yet, but it is expected to be related to duplications or multiplications in the region harbouring the SOX9 gene (Rossi et al. 2014; Marcinkowska-Swojak et al 2015). The only 279.

(2) Case Report. Veterinarni Medicina, 61, 2016 (5): 279–287 doi: 10.17221/8884-VETMED. monogenic DSD with a defined molecular background is the persistent Müllerian duct syndrome – PMDS (Wu et al. 2009). However, it should be noted that, besides the aforementioned disorders of sex development, there are important defects with a complex background such as cryptorchidism and hypospadias diagnosed in male individuals with a normal set of sex chromosomes (78,XY; MeyersWallen 2012; Switonski et al. 2012). Present knowledge regarding the genetic background of canine DSD is obscure and thus a detailed description of a larger number of such cases is important. The aim of this study was to perform radiological, histological, cytological, and molecular analyses, as well as a successful surgical treatment of the first reported case of a DSD male dog with a hypoplastic penis and a rudimentary prepuce and preputial orifice.. Case description A six-month-old male mixed-breed dog with body weight of 3.5 kg and with symptoms of difficult urination was presented by the owner at the Department and Clinic of Animal Surgery, Faculty of Veterinary Medicine. The dog had been kept by the owner since birth. The dysfunction, which was manifested by painful and prolonged urination, was noted after one month of life. From then until the time of the appointment at our clinic, the owner helped the animal in removing urine retained in the preputial cavity by manual massage. The clinical examination revealed a rudimentary prepuce. The preputial orifice was located distally relative to the nipples of the preputial region. It had a form of a 2-mm slit extending in the skin of the rudimentary prepuce over the external urethral meatus (Figure 1). In the preputial cavity, large amounts of retained urine were observed as a fluctuating bulge in the preputial region, which was clearly visible in the standing position. Palpation revealed penile and testicular atrophy; both testicles were located in the scrotum. Measurements of rectal temperature as well as the pulse and respiratory rates showed physiological values. Thoracic auscultation revealed no abnormalities. Additional examinations were performed, including biochemical blood tests, chest and abdominal radiography and abdominal ultrasound. The dog was qualified for reconstruction of the preputial orifice and castra280. Figure 1. External genitalia of the studied dog. Arrow indicates the preputial orifice. tion. Pathomorphological examination of the testes as well as cytogenetic analysis, molecular analysis of the SRY gene, and identification of the ZFX and ZFY genes were performed. Biochemical and endocrinological blood tests were carried out in a specialised veterinary laboratory. Apart from an elevated level of blood urea nitrogen (62 mg/dl; reference range: 8–28 mg/dl), biochemical parameters were within physiological ranges. Serum testosterone concentration was decreased (0.17 ng/ml, range for intact male dog from 1 to 10 ng/ml), while the level of oestradiol in the patient was normal. Abdominal radiographical examinations were performed in two projections: right lateral and ventro-dorsal. Ultrasonography of the abdomen was performed using a microconvex 6.5 MHz probe and the region of the scrotum and penis were examined with a 12 MHz linear probe. The radiological and ultrasonographical examinations showed a normal image of the abdominal organs. The radiography revealed a fan-shaped widening of the caudal part and shortening of the os penis. For objective estimation of the size of penile bone (baculum), retrospective measurements of the length of the bone in twelve previously examined six-month-old different-breed dogs with similar body weights and normally developed genital organs were performed. The length of the.

(3) Veterinarni Medicina, 61, 2016 (5): 279–287. Case Report. doi: 10.17221/8884-VETMED. Figure 2. Radiographic image of the abdomen. A widened os penis (marked with red arrows) in the caudal part. The length of the os penis measured relative to the lumbar spine reaches ¾ of the L2 vertebra length (red line). This implies shortening of the os penis. Figure 3. Longitudinal section of the apex of the penis (pars longa glandis) using B-mode ultrasound. 0 = subcutaneous tissue; 1 = area of urine; 2 = external urethral orifice; 3 = erectile tissue; 4 = fibro-cartilaginous portion of the os penis; 5 = os penis. baculus was compared with the length of the first lumbar vertebrae. X-ray examinations performed in the analysed case revealed shortening of the penile bone, as its length relative to the lumbar spine reached ¾ of the L2 vertebra length. In all the dogs from the compared group, the baculus was longer in relation to the lumbar spine and was more than half the length of the L3 vertebra (Figure 2). Ultrasonography of the scrotum showed no changes in the echogenicity and morphology of both descended testes. Longitudinal ventro-dorsal B-mode ultrasonograms of the penile region re-. vealed structures typical of this organ and located entirely under the skin (Figure 3). A hyperechogenic os penis with a wide posterior part and a slightly curved, smooth anterior end was imaged. No normal prepuce structures were shown. The urethral meatus was located on the penis in the typical site approximately 0.5 cm under the skin. Close to the urethral meatus, a 1-cm long liquid (urine) cistern was found in the subcutaneous tissues. The dog was pre-medicated intramuscularly with xylazine hydrochloride (Sedazin, Biowet, Pulawy, Poland) at a dose of 2 mg/kg, atropine sulphate. Figure 4. External urethral meatus (arrow) after posthioplasty. Figure 5. Penis visible in the reconstructed preputial orifice. 281.

(4) Case Report. Veterinarni Medicina, 61, 2016 (5): 279–287 doi: 10.17221/8884-VETMED. Figure 7. Postoperative status. Figure 6. Posthioplasty: sewing the outer preputial lamina to the skin with a Chassaignac and Halsted intradermal suture. (Atropinum Sulfuricum, Polfa, Warsaw, Poland) at a dose of 0.05 mg/kg, and butorphanol (Butomidor, Boehringer, Richter Pharma AG, Austria) at a dose of 0.2 mg/kg. General anaesthesia was achieved by intravenous administration of a mixture of ketamine (Vetaketam 10%, Vet Agro, Lublin, Poland) and midazolam (Midanium, WZF Polfa, Warsaw, Poland) at doses of 5 mg/kg and 0.3 mg/kg, respectively. A 1-mm diameter catheter was inserted into the rudimentary preputial orifice and the preputial cavity was thoroughly rinsed with an antiseptic so-. Figure 8. Microscopic image of testicular parenchyma. Visible Sertoli cells (short arrow), spermatogonia (arrowhead), and clusters of interstitial cells (long arrow); HE staining, × 200. 282. lution. The hair on the dog’s abdomen was clipped and the skin was aseptically prepared. The dog was placed in dorsal recumbency with tied legs. Next, a grooved guide was inserted into the rudimentary preputial orifice and a 12-mm incision of the outer preputial lamina was made along the long axis of the body in the cranial direction. The length of the incision was correlated with the perimeter of the penis and was sufficiently large to prevent paraphimosis (Figures 4, 5). After incision of the tissues, the inner preputial lamina was found and sewn to the skin with an absorbable polyglycolic acid surgical suture (5-0 Dexon, Vetoquinol Biowet, Gorzow Wlkp., Poland) using a Chassaignac and Halsted absorbable intradermal suture (Figure 6). Afterwards, the dog was castrated (Figure 7), and a catheter was inserted into the bladder to check urethral patency.. Figure 9. Metaphase spread (78,XY) from the examined dog. The arrows indicate sex chromosomes.

(5) Veterinarni Medicina, 61, 2016 (5): 279–287. Case Report. doi: 10.17221/8884-VETMED. Figure 10. Molecular detection of the SRY gene amplicon (PCR) in the studied DSD dog and control, healthy male and female. Figure 11. Molecular detection (PCR-RFLP) of the ZFX/ ZFY genes in the DSD case and the controls. Cimicoxib (Cimalgex, Vetoquinol, Lure, France) at a dose of 2 mg/kg, q 24 h for four days was prescribed perorally as an analgesic and amoxicillin with clavulanic acid (Synulox, Pfizer, Warsaw, Poland) at a dose of 8.75 mg/kg, q 24 h for seven days was administered intramuscularly as a protective agent. The movement of the animal was limited and the sutures were protected from destruction using an Elizabethan collar. Hygienic treatment of the wound was applied three times a day using 0.5% povidone iodine (Betadine, Egis Pharmaceuticals, Budapest, Hungary) compresses until removal of the sutures, which was done after 10 days. The surgery yielded a distinct improvement in patient’s urination comfort. After the surgery, no urine retention in the preputial cavity was observed. The pathomorphological examination of the testes was carried out after the samples were fixed in 10% buffered formaldehyde, pH = 7.2, and passed through a series of increasing alcohol concentrations, acetone, and xylene into paraffin blocks in a tissue processor. Tissue sections with 4-μmthickness were cut in a sled microtome and placed on slides. For histopathological analysis, the slides were stained with haematoxylin and eosin (HE) and evaluated under a light microscope. The histopathological examinations of the testes showed a normal microscopic structure of the organ in the pre-sexual maturity stage of development. Histological analy-. sis showed a predominance of elongated Sertoli cells resting on the basilar membrane; they had oval nuclei and cytoplasmic projections protruding into the tubule lumen. Among them were round seminal cells exhibiting features of spermatogonia with a spherical nucleus. The loose interlobular connective tissue comprised spherical interstitial cells with a vesicular cytoplasm (Figure 8). In the microscopic structure of the testis with a normal spermatogenesis process there are seminal cells in different developmental stages, from stem forms to mature germ cells. The histological image reveals spermatogonia, over which there are large spherical meiotically dividing first-order spermatocytes. Closer to the tubule lumen, smaller second-order spermatocytes can be seen. The smallest spherical or oval spermatids transforming into sperm are located most superficially. In the analysed case, spermatogonia lying between the sustentacular (Sertoli) cells were the only germ cells found in the wall of convoluted tubules, which may indicate impairment of the spermatogenesis process caused by a low testosterone level. The macroscopic image of the epididymis showed bands of connective tissue surrounding the seminiferous tubules and efferent ducts. The wall of the tubules was formed of cylindrical and cubic cells located on the basilar membrane, and the structure of the epididymal ducts comprised a double-layered epithelium composed 283.

(6) Case Report. Veterinarni Medicina, 61, 2016 (5): 279–287 doi: 10.17221/8884-VETMED. amplicons were, respectively, for the SRY gene fragment - F: 5'CTTTCCAACTTCCCTCCGTA; R: 5' GGACGTTTCGTTAGCCAGAG, 813 bp (according to Switonski et al. 2012); for the ZFX and ZFY gene fragments – F: 5' ATAATCACATGGAGAGCCACCAGCT; R: 5' GCACTTCTTTGGTATCTGAGAAAGT, 448 bp. The RFLP (restriction fragments length polymorphism) technique was applied to distinguish between the ZFX and ZFY genes. The PCR product (448 bp) was digested using the HaeIII enzyme. The fragments obtained were 403 and 45 bp for the ZFX and 448 bp for the ZFY gene (according to Senese et al. 1999). The SRY gene coding sequence (663 bp) important for normal male sex development was selected for sequence analysis and compared to the canine SRY gene reference sequence (AF107021). Amplicons were sequenced using the same primers as above. The molecular analysis showed the presence of the SRY gene (Figure 10) as well as the ZFY gene, which reside on the Y chromosome and ZFX, which is X-linked (Figure 11). Sequencing and comparison with the reference sequence of the canine SRY gene indicated a normal sequence in the examined dog.. DISCUSSION AND CONCLUSIONS Figure 12. Healing process – preputial orifice on Day 10 after posthioplasty. of columnar and basal cells. Small lymphatic and blood vessels were present between these structures in the connective tissue. Further diagnostics involved cytogenetic analysis. Chromosome preparations were obtained from skin fibroblasts cultured in vitro using standard methods. Conventional staining with the Giemsa solution was applied to assess the normal diploid number and morphology of the chromosomes. The sex chromosomes of the dog were identified easily given their bi-armed morphology (X – large and sub-metacentric, Y – small and metacentric). The cytogenetic analysis revealed a normal male set of chromosomes (78,XY; Figure 9). The next step of the investigations was the molecular analysis. The presence of X-linked (ZFX) and Y-linked (SRY and ZFY) genes was detected with the use of PCR. The primer sequences and length of the 284. The case described concerns a six-month-old male dog in which we diagnosed DSD of the penis, prepuce, and preputial orifice. To the authors’ best knowledge, this is the first report of this type of developmental disorder diagnosed in a male dog. Penile hypoplasia is usually asymptomatic and diagnosed incidentally during routine examination. Currently, there are no literature data concerning radiographic imaging of the size and structure of the os penis in dogs. The comparative measurements performed in this study indicated that the length of this organ in the examined patient was shorter than the total length of the first two lumbar vertebrae. In all the dogs from the compared group, the os penis was longer than the total length of the first two lumbar vertebrae. Investigations presented in the literature have mainly focused on urethral abnormalities (Adelsberger and Smeak 2007; Vnuk et al. 2014). The authors of the few papers available presenting the results of penile bone radiography describe problems related to posttraumatic, inflammatory, or neoplastic lesions of.

(7) Veterinarni Medicina, 61, 2016 (5): 279–287. Case Report. doi: 10.17221/8884-VETMED. this organ (Bleier et al. 2003; Erne and McNicholas 2009). Reports in the literature data hardly ever include ultrasonographic examinations of the canine penis, although the technical ease and great diagnostic potential of this examination in evaluation of penile structure and pathological processes affecting the organ has been demonstrated (Payan-Carreira and Bessa 2008; Goericke-Pesch et al. 2013). Hence, we recommend ultrasonography to be an adequate diagnostic tool for evaluation of penile soft tissue structures in the case of physiological abnormalities. Analysis of the reported case proves that there is a need for radiological and ultrasound examinations of the penis and penile bone in dogs in order to determine the normal value range. Knowledge of this range would contribute to diagnosis of anatomical defects of these organs. The most common defects of the prepuce comprise phimosis, paraphimosis, and a short prepuce. In terms of function, the defect of the structure presented in the study resembles phimosis, which involves prepuce tightness and its inability to be retracted (England 1998). The presented case was related to hypoplasia of the prepuce skinfold and partial atrophy of the preputial orifice. Phimosis can have a congenital, traumatic, or post-inflammatory background (Gobello et al. 2003; Feldman and Nelson 2004). In the case of the examined dog, acquired causes were excluded given the fact that the animal had been kept since birth by the same owner, who did not report any traumatic event. Therefore, a congenital factor at the developmental level was assumed to be the most probable cause. Genital malformations constitute a high proportion of congenital defects reported in animals and humans. More than 85% of genital anomalies in populations of domestic animals and humans are not associated with chromosomal aberrations or mutations of genes known to be responsible for sex differentiation (Basrur and Basrur 2004). The high prevalence of defects rather seems to be a result of the emergence of new mutations, genetic-environmental interactions, or epigenetic regulation. There is extensive data available on the abnormalities of the reproductive system in dogs (England 1998; Wierzbowski 1999; Switonski et al. 2000; Switonski et al. 2003; Switonski et al. 2004; Ndikuwera 2005; Christensen 2012). The most common penile defects include persistent frenulum, hypospadias, penile bone deformation, and penile hypoplasia (England 1998; Gobello et al.. 2003; Feldman and Nelson 2004). Penile hypoplasia is usually one of the symptoms of testicular DSD. An abnormal karyotype was detected in some dogs with penile hypoplasia; therefore, cytogenetic analysis should be performed in similar cases (Gobello et al. 2003; Gurel et al. 2014). In the presented case, the chromosomal and gonadal sex coincided, and no female traits were detected. The successful amplification of the SRY, ZFX, and ZFY genes confirmed the presence of the X and Y chromosomes. Given the absence of polymorphisms and mutations in the coding sequence of the SRY gene, it can be assumed that this gene is not associated with the observed phenotype, as the sequence is present in dogs with normally developed external genital organs. In accordance with the current nomenclature proposed by Poth et al. and Meyers-Wallen, the reported case can be classified as a testicular XY (SRY-positive) DSD (Poth et al. 2010; Meyers-Wallen 2012). It should be mentioned that phenotypic variation of sex development in XY dogs is quite wide and includes cryptorchidism, hypospadias and ambiguous external genitalia. In the latter group an enlarged clitoris (Meyers-Wallen et al. 1999; Wernham and Jerram 2006; Alam et al. 2007; Nowacka-Woszuk et al. 2007; Dianovsky et al. 2013) was usually reported. In addition, a rare case manifested by lack of scrotum and penis, but with the presence of a vulva was also described (Bigliardi et al. 2011). Penile hypoplasia may also develop as a secondary disorder due to early neutering (Switonski et al. 2004). It should be noted, however, that the examined dog was young (six months) and had not been castrated, while the blood testosterone level was 0.17 ng/ml. In healthy adult dogs, the level ranges between 1 and 10 ng/ml; the wide range results from pulsed hormone release in canine males. In neutered dogs, the level of testosterone declines below 0.5 ng/ml (Kaneko et al. 2008). Small- and miniature-breed dogs reach sexual maturity at the age of five to six months, therefore the testosterone level in the examined patient should be regarded as decreased (Johnston et al. 2001; Gobello 2014). The testicular inactivity diagnosed in the histological analysis explains the low level of the hormone. According to the literature, surgery is only recommended in the case of urine retention and recurrent inflammations caused by prepuce abnormalities (Feldman and Nelson 2004). In the presented case, a cosmetic technique was applied and postoperative wound healing proceeded well (Figure 12) and 285.

(8) Case Report. Veterinarni Medicina, 61, 2016 (5): 279–287 doi: 10.17221/8884-VETMED. without obvious discomfort for the patient as reported by the owner. The aim of surgery was correction of anatomical abnormalities that pose a risk of recurrent urinary tract infections, kidney failure, and irritation of the penis and urethra (Adelsberger and Smeak 2007; Guimaraes et al. 2013; Vnuk et al. 2014). The causes of underdevelopment of the prepuce or penis are not fully known. Therefore, assuming that developmental disorders can be potentially heritable (Gobello et al. 2003; Vnuk et al. 2014), it is important that individuals affected by the problem should be eliminated from reproduction if fertility is suspected (Meyers-Wallen et al. 1999; Switonski et al. 2012). The presented case of penile hypoplasia combined with rudimentary prepuce and accompanied by difficult urination was effectively treated with surgery. Since no familial information was available, it was impossible to establish whether the disorder had a hereditary background or was an idiopathic defect.. References Adelsberger ME, Smeak DD (2007): Repair of extensive perineal hypospadias in a Boston terrier using tubularized incised plate urethroplasty. Canadian Veterinary Journal 50, 937–942. Alam MR, Cho YG, Cho SJ, Lee JI, Lee HB, Tae HJ, Kim IS, Kim NS (2007): Male pseudohermaphroditism in dogs: three case reports. Veterinarni Medicina 52, 74–78. Basrur PK, Basrur VR (2004): Genes in genital malformations and male reproductive health. Animal Reproduction 1, 64–85. Bigliardi E, Parma P, Peressotti P, De Lorenzi L, Wohlsein P, Passeri B, Jottini S, Cantoni AM (2011): Clinical, genetic, and pathological features of male pseudohermaphroditism in dog. Reproductive Biology and Endocrinology 9, 12. Bleier T, Lewitschek HP, Reinacher M (2003): Canine osteosarcoma of the penile bone. Journal of Veterinary Medicine Series A 50, 397–398. Christensen BW (2012): Disorders of sexual development in dogs and cats. The Veterinary Clinics of North America: Small Animal Practice 42, 515–526. Dianovsky J, Holeckova B, Hajurka J, Sivikova K, Cigankova V (2013): Disorder of sexual development in a Yorkshire terrier (78, XY; SRY-positive). Journal of Applied Genetics 54, 193–199. England GCW (1998): Abnormalities of the Reproductive Tract of the Dog. In: England GCW (ed.): Allen’s Fertility. 286. and Obstetrics in the Dog. 1st ed. SIMA WLW, Warszawa. 115–134. Erne JB, McNicholas WT (2009): What is your diagnosis? Urethral obstruction and fracture of os penis. Journal of the American Veterinary Medical Association 234, 201–202. Feldman EC, Nelson RW (2004): Disorders of the penis and prepuce. In: Feldman EC, Nelson RW (eds.): Canine and Feline Endocrinology and Reproduction. 3rd ed. Elsevier Science, St. Louis. 953–961. Gobello C (2014): Prepubertal and pubertal canine reproductive studies: conflicting aspects. Reproduction in Domestic Animals 49, 70–73. Gobello C, De Luca JC, Corrada Y, Garcia M, Peral Garcia P (2003): Penile hypoplasia in a rottweiler: a case report. Analecta Veterinaria 23, 38–41. Goericke-Pesch S, Holscher C, Failing K, Wehrend A (2013): Functional anatomy and ultrasound examination of the canine penis. Theriogenology 80, 24–33. Guimaraes LD, Bourguignon E, Santos LC, Duarte TS, Andrade EC, Borges APB (2013): Canine perineal hypospadias. Arquivo Brasileiro De Medicina Veterinaria E Zootecnia 65, 1647–1650. Gurel A, Yildirim F, Sennazli G, Ozer K, Karabagli M, Deviren A, Cirakoglu A (2014): Hermaphroditism in two dogs – pathological and cytogenetic studies: a case report. Veterinarni Medicina 59, 51–55. Johnston SD, Root Kustritz MV, Olson PN (2001): The canine estrous cycle. In: Kersey R (ed.): Canine and Feline Theriogenology. Saunders, Philadelphia. 16–31. Kaneko JJ, Harvey JW, Bruss ML (2008): Clinical biochemistry of domestic animals. In: Kaneko JJ, Harvey JW, Bruss ML (eds): Clinical Reproductive Endocrinology, Academic Press. 654 pp. Marcinkowska-Swojak M, Szczerbal I, Pausch H, NowackaWoszuk J, Flisikowski K, Dzimira S, Nizanski W, PayanCarreira R, Fries R, Kozlowski P, Switonski M (2015): Copy number variation in the region harboring SOX9 gene in dogs with testicular/ovotesticular disorder of sex development (78,XX; SRY-negative). Reproductive Sciences 5, 14696. Meyers-Wallen VN (2012): Gonadal and sex differentiation abnormalities of dogs and cats. Sexual Development 6, 46–60. Meyers-Wallen VN, Schlafer D, Barr I, Lovell-Badge R, Keyzner A. (1999): Sry-negative XX sex reversal in purebred dogs. Molecular Reproduction and Development 53, 266–273. Ndikuwera J (2005): A case of hypospadias in a dog. Irish Veterinary Journal 58, 504–506. Nowacka-Woszuk J, Nizanski W, Klimowicz M, Switonski M (2007); Normal male chromosome complement and a.

(9) Veterinarni Medicina, 61, 2016 (5): 279–287. Case Report. doi: 10.17221/8884-VETMED lack of the SRY and SOX9 gene mutations in a male pseudohermaphrodite dog. Animal Reproduction Science 98, 371–376. Payan-Carreira R, Bessa AC (2008): Application of B-mode ultrasonography in the assessment of the dog penis. Animal Reproduction Science 106, 174–180. Poth T, Breuer W, Walter B, Hecht W, Hermanns W (2010): Disorders of sex development in the dog – Adoption of a new nomenclature and reclassification of reported cases. Animal Reproduction Science 121, 197–207. Rossi E, Radi O, De Lorenzi L, Vetro A, Groppetti D, Bigliardi E, Luvoni GC, Rota A, Camerino G, Zuffardi O, Parma P (2014): Sox9 duplications are a relevant cause of Sry-negative XX sex reversal dogs. PLoS One 97, 101244. Salamon S, Nowacka-Woszuk J, Szczerbal I, Dzimira S, Nizanski W, Ochota M, Switonski M (2014): A lack of association between polymorphisms of three positional candidate genes (CLASP2, UBP1, and FBXL2) and canine disorder of sexual development (78,XX; SRY-Negative). Sexual Development 8, 160–165. Senese C, Penedo MC, Shiue YL, Bowlin AT, Millon LV (1999): A HaeIII PCR-RFLP in the ZFY/ZFX genes of horses. Animal Genetics 30, 390–391. Switonski M, Godynicki S, Jackowiak H, Pienkowska A, Turczuk-Bierla I, Szymas J, Golinski P, Bereszynski A (2000): X trisomy in an infertile bitch: cytogenetic, anatomic, and histologic studies. Journal of Heredity 91, 149–150. Switonski M, Szczerbal I, Grewling J, Antosik P, Nizanski W, Yang F (2003): Two cases of infertile bitches with 78,XX/77,X mosaic karyotype: a need for cytogenetic evaluation of dogs with reproductive disorders. Journal of Heredity 94, 65–68. Switonski M, Nowacka J, Skorczyk A, Chmurzynska A, Nizanski W (2004): Hereditary sex-reversal syndrome. (78,XX; SRY-negative) in German Shepherd puppies. Medycyna Weterynaryjna 60, 705–707. Switonski M, Payan-Carreira R, Bartz M, Nowacka-Woszuk J, Szczerbal I, Colaco B, Pires MA, Ochota M, Nizanski W (2012): Hypospadias in a male (78, XY; SRY-positive) dog and sex reversal female (78, XX; SRY-negative) dogs: clinical, histological and genetic studies. Sexual Development 6, 128–134. Szczerbal I, Nowacka-Woszuk J, Nizanski W, Salamon S, Ochota M, Dzimira S, Atamaniuk W, Switonski M (2014): A case of leucocyte chimerism (78, XX/78, XY) in a dog with a disorder of sexual development. Reproduction in Domestic Animals 49, 31–34. Vnuk D, Brkljaca Bottegaro N, Slunjski L, Skrlin B, Musulin A, Stejskal M (2014): Prepubic urethrostomy opening within a prepuce in a dog: a case report. Veterinarni Medicina 59, 107–111. Wernham BG, Jerram RM (2006): Male pseudohermaphroditism in a Labrador Retriever, and a review of mammalian sexual differentiation. New Zealand Veterinary Journal 54, 248–252. Wierzbowski S (1999): Congenital defects of genital organs. In: Wierzbowski S (ed.): Andrology. 1st ed. Platan, Krakow. 347–355. Wu X, Wan S, Pujar S, Haskins ME, Schlafer DH, Lee MM, Meyers-Wallen VN (2009): A single base pair mutation encoding a premature stop codon in the MIS type II receptor is responsible for canine persistent Mullerian duct syndrome. Journal of Andrology 30, 46–56. Received: 2015–06–11 Accepted after corrections: 2016–03–09. Corresponding Author: Brygida Slaska, University of Life Sciences in Lublin, Department of Biological Bases of Animal Production, Akademicka 13 Street, 20-950 Lublin, Poland E-mail: brygida.slaska@up.lublin.pl. 287.

(10)

New documents

Policing vulnerability through building community connections
The underlying aim is to explore how far there is capacity within this community to generate assets that can be drawn on to improve the health and well-being of local people; in this
1 Amino N,N di­benzyl 1,6 di­de­oxy β L fructo­furan­ose
Department of Chemical Crystallography, Chemical Research Laboratory, Oxford University, Mansfield Road, Oxford OX1 3TA, England, and bDepartment of Organic Chemistry, Chemical Research
A proteomic approach for the rapid, multi informative and reliable identification of blood
Since blood provenance is also a forensic question of interest and as the m/z of haem would not permit the determination of the blood source, the m/z of intact Haemoglobin chains were
L Phenyl­alanine L phenyl­alaninium malonate
Data collection: CAD-4 EXPRESS Enraf–Nonius, 1994; cell refinement: CAD-4 EXPRESS; data reduction: XCAD4 Harms & Wocadlo, 1996; programs used to solve structure: SHELXS97 Sheldrick,
3 [(2R*,3S*) 3 (2 Meth­oxy­anilino) 2 methyl 3 phenyl­propionyl]­spiro­[2H 1,3 benzoxazine 2,1′ cyclo­hexan] 4(3H) one
Data collection: PROCESS-AUTO Rigaku, 1998; cell refinement: PROCESS-AUTO ; data reduction: CrystalStructure Rigaku/ MSC, 2004; programs used to solve structure: SHELXS97 Sheldrick,
Competitiveness and the Process of Co adaptation in Team Sport Performance
This definition supports the need to create, within the same team, an ‘interteam’ environment e.g., small-sided and conditioned games, designing task constraints representative of
1,3,3 Trimeth­yl 6′ (4 phenyl­piperazin 1 yl) 2,3 di­hydro­spiro­[1H indole 2,3′ 3H naphth[2,1 b][1,4]oxazine]
Data collection: SMART Bruker, 1998; cell refinement: SAINT Bruker, 1999; data reduction: SAINT; programs used to solve structure: SHELXS97 Sheldrick, 1997; programs used to refine
Band gap narrowing in ferroelectric KNbO3 Bi(Yb,Me)O3 (Me=Fe or Mn) ceramics
Hence, based on both permittivity measurements and Raman spectroscopy analysis all ceramics studied exhibit dielectric anomalies associated with structural phase transitions and their
An orthorhombic polymorph of di­chloro­bis­­[4 (di­methyl­amino)­phenyl]­tellurium
Data collection: SMART Bruker, 2000; cell refinement: SAINT Bruker, 2000; data reduction: SAINT; programs used to solve structure: SHELXS97 Sheldrick, 1997; programs used to refine
Understanding travel behaviour change during mega events: Lessons from the London 2012 Games
An initial outcome was the understanding that those with a specific intention to change behaviour during the Games or equally, at the minimum, contemplating in reference to the stages

Related documents

Genre in a Changing World
Russell, Mary Lea, Jan Parker, Brian Street, and Tiane Donahue 395 21 Genre and Disciplinary Work in French Didactics Research Tiane Donahue 424 22 Negotiating
0
0
520
Critical Expressivism: Theory and Practice in the Composition Classroom
A new expressivist approach to writing instruction might require teachers to develop strategies that allow a lot of classroom space for low-stakes writing and give
0
1
319
History in the Making: A History of the People of the United States of America to 1877
Grant defeated Horatio Seymour in the presidential race february 1869 Fifteenth Amendment passed by Congress December 1869 Grant encouraged Congress to readmit
0
14
864
The Ideologies of Lived Space in Literary Texts, Ancient and Modern
ideologies.lived.spaces.book Page 229 Saturday, August 17, 2013 11:47 AM 229 Writing space, living space Time, agency and place relations in Herodotus’s Histories1
0
5
261
Teaching in a Digital Age: Guidelines for designing teaching and learning for a digital age
1.4 Change and continuity 1.5 The impact of expansion on teaching methods 1.6 Changing students, changing markets for higher education 1.7 From the periphery to
0
1
583
Reading With My Eyes Open: Embracing the critical and the personal in language pedagogy
vi  Reading With My Eyes Open Social and Cultural Views of Language 37 Hymes’ Theory of Communicative Competence 37 Sapir-Whorf 38 Critical Language Awareness 39
0
0
211
eMarketing: The Essential Guide to Marketing in a Digital World
Glossary › Video search engine optimisation VSEO Glossary › Search engine spiders Search engine spiders Search term Secondary research Segmentation Sender alias
0
5
305
Penile metastasis from rectal adenocarcinoma: a case report
As patients presented usually with a known history of the primary tumors, any clinical symptoms involving the penis should prompt the search for an eventual penile secondary tumor..
0
0
5
Influence of rotor endcaps on the electromagnetic performance of high speed PM machine
below 60A, the core losses predicted by 3D-FEA are lower than that of the 2D-FEA due to the leakage effect, which results in lower magnetic flux density in the machine core..
0
0
9
Understanding the effects of peripheral vision and muscle memory on in vehicle touchscreen interactions
Four hypotheses were proposed based on previous research and understanding in these areas: • During muscle memory conditions, task time time to select a single button will initially be
0
0
8
Numerical simulation of electromagnetic coupling in explicitly meshed wiring looms and bundles
Three core wire bundles In this section, three core wire bundles are modelled and the induced current in the wires for ten sets of different wire bundles are studied upon plane wave
0
0
6
Preselection algorithm based on predictive control for direct matrix converter
The proposed method preselects the finite control set by judging the sectors of the input current vector and the output voltage vector; only the switching states in the preselected
0
0
15
Penile Cancer in Liberia: A Case Report and Review of the Literature
Introduction Penile cancer is believed to be uncommon in Liberia as a result of the absence of any previous report of its occurrence in the literature; there is also a lack of any case
0
0
8
Challenges and Opportunities in the Use of Marketing Tools and the Promotion of Non Wood Forest Products Based Small and Medium Enterprises in the South East Europe
This paper describes the challenges and opportunities related to the use of marketing tools for improving business of the small and medium enterprises SMEs dealing with non-wood forest
0
0
10
The Comparison of Innovations in Slovakian Forestry between 2002 and 2010 a Shift to Multifunctionality?
The positive shift towards non-wood product offer is a result of adopted strategic documents such as National Forest Program, Rural Development Program that emphasize the principle of
0
0
9
Show more