Published online on February 16, 2009; doi: 10.1359/JBMR.090219 Ó 2009 American Society for Bone and Mineral Research
Activin A Enhances Prostate Cancer Cell Migration Through Activation of Androgen Receptor and Is Overexpressed in
Metastatic Prostate Cancer
Hong-Yo Kang,1,2Hsuan-Ying Huang,3Chang-Yi Hsieh,2Chien-Feng Li,4Chih-Rong Shyr,5Meng-Yin Tsai,6 Chawnshang Chang,7Yao-Chi Chuang,8and Ko-En Huang2,6
ABSTRACT: Bone metastasis is the major cause of mortality associated with prostate cancer. Whereas activin A is known to inhibit prostate cancer cell growth and promote apoptosis, the correlation of elevated activin A with increasing serum prostate-specific antigen (PSA) levels in bone metastatic stages of prostate cancer is well documented. The molecular mechanisms explaining these paradoxical effects of activin A and how activin A influences the progression of prostate cancer with bone metastasis remain unclear. By com- paring expression profiles of primary prostate cancer biopsies, with and without bone metastasis, we dis- covered that the expression of activin A is increased in cases with bone metastatic propensity and correlates with increased androgen receptor (AR), PSA expression, and Gleason scores. Activin A promotes migration of prostate cancer cells to osteoblasts, elevates the AR gene transcription through Smads through binding to AR promoter, and induces nuclear translocation of AR to interact with Smad3. Knockdown of Smad3 by siRNA decreases activin A–promoted AR expression and cancer cell migration. Overexpression of AR reversed Smad3-siRNA suppression on activin A–mediated cell migration to osteoblasts. These data suggest that activation of the AR through Smads is required for activin A–promoted prostate cancer cell migration to bone matrix, thereby promoting the bone metastatic phenotype, and the activin A–Smad–AR axis may be considered a therapeutic target in bone metastatic diseases.
J Bone Miner Res 2009;24:1180–1193. Published online on February 16, 2009; doi: 10.1359/JBMR.090219 Key words: bone metastasis, activin A, androgen receptor, Smad, prostate cancer
Address correspondence to: Hong-Yo Kang, PhD, Graduate Institute of Clinical Medical Sciences, and Ko-Zn Huang, MD, Center for Menopause and Reproductive Research, Chang Gung Memorial Hospital-Koahsiung Medical Center,
Chang Gung University, College of Medicine, Kaohsiung 833, Taiwan, E-mail: hkang3@mail.cgu.edu.tw
INTRODUCTION
P
ROSTATE CANCER ISthe second leading cause of mor- tality in American men and the most common type of malignant tumor metastasizing to bone.(1–3)In the United States alone, ;350,000 people die of bone metastatic can- cer each year(1) and >234,000 new cases and ;27,000 deaths from prostate cancer are expected each year. Our current understanding of how primary prostate cancer cells metastasize and induce bone lesions is still unclear.The development of bone metastatic tumors consists of a series of complex sequential events. Neoplastic cells within the primary tumor mass journey through multiple steps, including intravasation into the circulation, survival in circulation, arrest, and extravasation into a new tissue,
initiation and maintenance of growth, and reactivation of angiogenesis, to successfully establish metastatic colonies in bones.(4–6)The bone metastatic process involves genetic changes that underlie alterations in a variety of cellular functions for both cancer cells and the bone environment, including the control of cancer cell proliferation, survival, motility, cell–cell adhesion, and interactions with the bone extracellular matrix.(7,8) Although it is clear that those genetic changes often lead to alterations in the expression pattern of specific genes, relatively little is known about the nature of the molecular events directly involved in the bone metastatic process. The analysis of cell signaling for bone metastasis of prostate cancer is crucial for the de- velopment of novel approaches for treatment.
Several studies have shown that a variety of the members of TGF-b superfamily secreted by cancer cells, such as TGF-b,(9)and bone morphogenetic proteins,(10)may play
1Graduate Institute of Clinical Medical Sciences, Chang Gung Memorial Hospital-Koahsiung Medical Center, Chang Gung Uni- versity, College of Medicine, Kaohsiung, Taiwan;2Center for Menopause and Reproductive Research, Chang Gung Memorial Hospital- Koahsiung Medical Center, Chang Gung University, College of Medicine, Kaohsiung, Taiwan;3Department of Pathology, Chang Gung Memorial Hospital-Koahsiung Medical Center, Chang Gung University, College of Medicine, Kaohsiung, Taiwan;4Department of Pathology, Chi-Mei Medical Center, Tainan, Taiwan; 5Department of Laboratory Medicine and Biotechnology, Tzu Chi University, Hualian, Taiwan;6Obstetrics and Gynecology, University of Rochester, Rochester, New York, USA;7Department of Pathology and Urology, University of Rochester, Rochester, New York, USA;8Department of Urology, Chang Gung Memorial Hospital-Koahsiung Medical Center, Chang Gung University, College of Medicine, Kaohsiung, Taiwan.
The authors state that they have no conflicts of interest.
1180
important roles in cancer cells causing a vicious cycle and metastasizing to bone. A common model for intracellular signaling involving activin A and other TGF-b superfamily proteins is through intracellular heterodimeric and homo- dimeric Smad (Sma genes and mothers against dpp [Mad]) proteins. Smads are downstream effectors for the TGF-b superfamily stimulation of PTH-related protein (PTHrP) and promote bone metastases in breast cancer.(11)The role of Smads in prostate cancer bone metastatic phenotypes is not clear, but it is known that the convergence of TGF-b and androgen receptor (AR) signaling pathways through Smad proteins,(12,13) which may be involved in the pro- gression of prostatic malignancy and deletion of genetic material in the region required for the production of Smads, is seen in other human adenocarcinomas, such as pancreatic and colorectal cancer.(14)
Whereas TGF-b involvement in the pathogenesis of cancer is well documented, the case for activins is less distinct. Activins have normal biological roles distinct from those of TGF-b. Activins have reproductive roles and also regulate crucial phases of growth, differentiation, and development such as wound healing, tissue repair, and regulation of branching morphogenesis.(15)These charac- teristics reasonably suggest that activin A may have an important role in the development and progression of cancer. However, activin A plays a paradoxical role in prostate tumorigenesis. Activin A inhibits prostate cancer cells growth and induces cell cycle inhibitors such as p27,(16)whereas in contrast, activin A was significantly el- evated in the serum of patients with clinically evident bone metastases and induces prostate-specific antigen (PSA) levels.(17,18)However, the molecular mechanisms of activin A that dictate a variety of cellular responses accounting for bone metastasis of prostate cancer, remains unclear. We report that activin A, through increasing AR gene tran- scription, nuclear translocation, and interaction with Smads, enhances prostate cancer cell migration to the bone matrix. Knockdown of Smad expression impairs the ability of activin A to promote cancer cell migration and decreases AR expression. In primary adenocarcinomas, activin A is preferentially overexpressed in cases developing bone metastasis and significantly correlates with Gleason scores and expression of AR and PSA. Given the key role activin A plays in the bone metastatic prostate tumor, we propose that prostate tumor–containing high activin A–expressing cells promote cancer cell migration to bone by promoting the expression and translocation of AR, which in turn in- teracts with the Smad pathway and may be part of the mechanism by which prostate cancer elicits bone meta- static behaviors.
MATERIALS AND METHODS Patient material, specimen selection, and microarray analysis
This human subject study was approved by the Institu- tional Review Board of Chang Gung Memorial Hospital.
Two pathologists (H.Y.H. and C.F.L.) reappraised the diagnostic accuracy and Gleason scores of 69 primary
prostatic adenocarcinomas (40 with and 29 without bone metastases either at presentation or within 3 yr after initial diagnosis) used in immunohistochemical analyses. Imaging studies, including bone scan, CT scan, and/or MRI, were used to diagnose metastatic prostatic cancers in the various skeletal sites. All patients from whom the bone metastasis samples were obtained met the criteria of at least one new lesion on bone scan or paraffin blocks with more than one bone metastasis lesion. In patients with bone metastases, paraffin blocks of osseous metastatic lesions were available in 11 patients for whom the histopathological diagnosis could be confirmed. Snap-frozen biopsies from 10 cases and/or transurethral resection of the prostate (TURP) specimens among 69 cases enrolled for immunostains were examined and analyzed by Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA, USA). Afterward, six cases with the highest tumor content and RNA quality from both metastatic (three cases) and nonmetastatic (three cases) groups were microdissected by Veritas laser capture mi- crodissection (LCM) machine to isolate pure carcinoma cells for downstream total RNA extraction, in vitro tran- scription, and microarray analysis for functional genomic profiling. The microarrays were performed for these six microdissected cases (three cases with and three cases without development of bone metastases after at least 5 yr of follow-up), to identify genes potentially involved in the bone metastasis of prostate cancers. Please see the sup- plemental sections for a detailed description of LCM, microarray from Affymetrix platform, and gene ontology analyses.
Quantitative real-time PCR
Reverse transcription was performed using the Super- script first-stand synthesis kit (Invitrogen). PCR was per- formed for 30 cycles. Quantitative real-time PCR analyses using the comparative CT method were performed on an ABI PRISM 7700 Sequence Detector System using the SYBR Green PCR Master Mix kit (Perkin Elmer, Applied Biosystems, Wellesley, MA, USA) according to the man- ufacturer’s instructions. After an initial incubation at 508C for 2 min and 10 min at 958C, amplification was performed for 40 cycles at 958C for 20 s, 658C for 20 s, and 728C for 30 s. Specific primer pairs were determined with the Primer- Express program (Applied Biosystems). Primer sequences are available on request.
Immunohistochemistry and statistical analysis Immunohistochemistry was performed as previously reported, using representative tissue blocks of primary or metastatic prostate cancers.(19) The primary antibodies were detected using the EnVision kit (DAKO). A semi- quantitative scheme that summed the individual scores of extent and intensity of staining was applied to evaluate expression patterns of all markers. The extent was defined as 0 for no staining, 1 for reactivity in <25%, 2 in 25–49%, 3 in 50–75%, and 4 in >75% of cancer cells. For the intensity, no staining was scored as 0, faint staining as 1, clearly positive staining as 2, and strongly positive staining as 3.
For statistical analysis, the summation of both scores was
classified as high or low expression when6 or 5, re- spectively. The associations of expression status of activin A in primary prostatic cancers with Gleason scores and expression of AR were calculated by Fisher’s exact test or x2test.
Reagents
Hydroxyflutamide (Toronto Research Chemicals), re- combinant human activin A (R&D systems), and the ALK4/5/7 inhibitor SB431542 (Tocris) were used in this study.
Cell culture, transfection, plasmids, and siRNA The human prostate cancer cell lines (PC3, DU145, and LNCaP), and human colon cancer cell line (SW480.C7) were obtained from the American Type Culture Collec- tion. The cells were cultured in RPMI 1640 medium (Invitrogen, Carlsbad, CA, USA), supplemented with 10%
FBS and antibiotics. MC3T3-E1 cells were maintained in aMEM medium (Invitrogen) with 10% FBS. pSG5-AR and pCMV-AR were used in our previous report,(20)and expression plasmids for human Smad2, Smad3, and Smad4 were provided by Dr. R. Derynck. Plasmids for dominant negative DN-Smad2, Smad3, and Smad4 were provided by Dr. M. P. de Caestecker. The predicted siRNA hairpin structure for human AR (59-GGGCCCTATCCCAGTC CCACTTGCTCGAGC AAGTGGGACTGGGATAGG GCTTTTTGAATTC-39), Smad2 (59-GTACTCCTTGCT GGATTGATTCAAGAGATCAATCCAGCAAGGAG TAC-39), and nonspecific negative control oligonucleotides were cloned as hairpin oligonucleotides into the pMSCV retroviral vector. Control vector clones and stable clones were obtained by using siPORT NeoFX (Ambion) as a transfection agent in 6-well plates after selection with pu- romycin. For transient transfection of AR siRNA, the SMARTpool AR was used (Upstate Biotechnology). For transient transfection of hSmad3 siRNA, the SMARTpool Smad3 (Dharmacon) was used.
Western and Northern blot analysis
Western and Northern blot analyses were performed as described previously.(20)The primary antibodies were ac- tivin A (R&D systems), AR (Santa Cruz), PSA (Santa Cruz), and Smad3 (Santa Cruz). Horseradish peroxidase–
conjugated secondary antibodies and Super Signal sub- strate (Pierce) were used for chemiluminescence detection and quantified by the Bio-Rad Quantity One software.
Membranes were reprobed for b-tubulin (I-19; Santa Cruz) for normalization. Total RNA was extracted from primary prostate or metastatic tumors using the TRIzol reagent (Invitrogen).
Wound healing and two-chamber migration assay An artificial ‘‘wound’’ was created in 6-well culture plates with or without activin A treatment. Quantitative analysis of the wound closure was calculated at 48 h. The two-chamber migration assay (8-mm pore size; Costar) was used according to the manufacturer’s instructions. Briefly, 105/ml LNCaP cells were seeded in serum-free medium in
the upper chamber and migrated toward medium con- taining activin A (50 ng/ml) or bone matrix produced by osteoblasts in the lower chamber. Cells were fixed, stained with Giemsa stain, and counted at 3200 magnification.
Luciferase assay
Cells transfected with AR promoter luciferase reporter plasmid were treated with or without activin A for 48 h and firefly luciferase activity measured by the Dual Luciferase Assay Kit (Promega) with Renilla luciferase as an internal control to confirm transfection efficiency as previous described.(12)
Chromatin immunoprecipitation assay
Chromatin immunoprecipitation (ChIP) assays were performed essentially as described,(21)with some modifi- cations. LNCaP cells were treated for 2 or 4 h in the presence or absence of activin A and transfected with dif- ferent plasmid vectors 3 days before harvesting for ChIP.
Cell lysates were precleared with normal rabbit IgG (sc- 2027; Santa Cruz Biotechnology) and protein A-agarose.
Immunoprecipitation was performed with specific anti- bodies (anti-AR, anti-Smad2/3, and control IgG) added to the lysates and incubated at 48C overnight. The following primer pairs, which span the region 23061 to 23262 of the AR promoter, were used for the amplification of PCR products: forward primer, 59-ATGCTTTCCTGTTTACA AGTTTATTCTATACAC-39; reverse primer, 59-AGTTA CTCTGAATAAAAAGCAGTCTGACAT-39. For re- ChIP assays, immunoprecipitations were sequentially washed with TSE I, TSE II, buffer II, and TE. Complexes were eluted by incubation with 10 mM DTT, followed by a second immunoprecipitation with the indicated antibodies.
PCR primers for androgen response element (ARE) I + II (PSA 2459 to –121) and ARE III (PSA 24288 to 23922) were described previously.(21)
Statistical analyses
All values are the means ± SD of replicate samples (n = 3–6, depending on the experiment), and experiments were repeated a minimum of three times. Differences be- tween two groups were assessed using the unpaired two- tailed Student’s t-test or among more than two groups by ANOVA. The Tukey test was used as a posthoc test in ANOVA for testing the significance of pairwise group comparisons. In all statistical comparisons, p < 0.05 was defined as a significant difference. Statistics software (version 10.0; SPSS) was used for all calculations.
RESULTS
Activin A is preferentially expressed in human primary prostate adenocarcinomas developing bone metastasis
To identify genes potentially involved in the progres- sion of prostate cancers, particularly with bone metastasis, we first established the flow chart of screening proce- dures (Fig. 1A) and performed laser capture microdissection to isolate pure carcinoma cells from primary prostate
adenocarcinomas with and without bone metastasis (Fig.
1B). Prostate biopsies that did not contain cancer cells were also used in parallel to control for genes that were highly expressed in normal prostate tissue. Next, Affymetrix mi- croarrays were used to identify specific genes that were differentially expressed between the two tumor groups, and the normalized data were filtered to remove all probe sets not present in at least 50% of the samples, which resulted in 1853 probe sets showing at least a 2-fold expression differ- ence between these two groups of samples. The 1853 probe sets represented 1564 genes, because several genes were identified by multiple probe sets. Genes showing significant
differential expression were analyzed for over-representa- tion of specific gene ontology using the GOToolBox and MetaCore software.
The groups of upregulated genes were involved in pro- cesses of metastasis including cell motility, cell commu- nication, regulation of transcription, catalytic activity, protein serine/threonine kinase activity, cytokine activity, and cell surface receptor–linked signal transduction (Fig.
1C, top panel; Supplemental Tables I and II). Many upre- gulated genes in our microarray analysis, such as activin A, vascular endothelial growth factor (VEGF), WNT5A, EGF receptor, and neuropeptide Y (NPY), have previously been FIG. 1. Identification of genes differentially expressed in pri- mary prostate tumors with and without bone metastatic pro- pensity. (A) Flow chart of screening procedures. (B) Path- ological prostate tumor images of LCM. (Left) Before LCM.
(Middle) After LCM. (Right) Tissues captured on LCM caps.
(C) Ontologic evaluation of two groups of primary prostate tu- mors at the molecular level.
Gene ontology categories in the differentially expressed genes from corresponding prostate cancers. (Top) Metastasis vs.
nonmetastasis. (Bottom) Non- metastasis vs. metastasis. (D) Higher expression level of ac- tivin A mRNA found in pri- mary prostate tumors with bone metastasis (patient cases 2, 4, and 6) than those without (pa- tient cases 1, 3, and 5), as as- sessed by real-time PCR.
described as modulators in various cancer cell models and microarray data.(22–25) The groups, including genes in- volved in the extracellular matrix, cell adhesion, and cell death, as well as regulation of apoptosis, showed predom- inantly lower expression in prostate tumors with bone metastasis (Fig. 1C, bottom panel; Supplemental Table II).
Several cell adhesion and extracellular matrix molecules, such as SPARC, COL1A2, and SPOCK, which are down- regulated genes in the primary tumors with bone metas- tasis, have also been found to associate with progression of prostate cancer.(24)
In addition, we found that gene networks in the prostate tumors with bone metastasis, such as AR, KLK2, KLK3, aromatase, and the activin A/Smad signaling pathway, are over-represented after inputting differentially expressed genes from our microarray data for pathway mapping.
To examine whether the observed upregulation of ac- tivin A is a common feature of prostate cancer with bone metastasis, we performed real-time RT-PCR analysis on six prostate adenocarcinomas: three with and three without bone metastatic propensities. Activin A mRNA expression was upregulated in all primary prostate cancers developing metastasis and was at least 5-fold higher than that of pros- tate cancers without bone metastatic propensity (Fig. 1D).
Activin A promotes human prostate cancer cell migration to mineralized bone matrices
To examine the roles of activin A in human prostate cancer cell behavior, we chose activin A–responsive human prostate cancer LNCaP cells to measure directed migration into an artificial ‘‘wound’’ in the presence or absence of activin A treatment. Control cells migrated into the wound area within 48 h, cells treated with activin A had signifi- cantly enhanced migration and activin A–neutralizing an- tibody and the inhibitor of activin receptor-like kinase
FIG. 2. Characterization of activin A–promoted human prostate cancer cell behaviors. (A, top) Wound healing assay of LNCaP cells treated with control (0.1% BSA in PBS), activin A, activin A + SB, or activin A + anti-activin A antibody. Bar is 200 mm.
(Bottom) Quantification of LNCaP cells with different treatments as indicated, and migrated into the defined wound area after 48 h.
Cells in four defined areas per group per experiment were quan- tified. *Samples significantly different from vehicle treatment with p < 0.05. **Samples significantly different from activin A treat-
ment with p < 0.05. (B, top) Representative images of the two- chamber migration assay for LNCaP cells treated with control, activin A, activin A + SB, activin A + anti-activin A antibody, HF, or activin A + HF. (Bottom) Quantification of the two-chamber migration assay of LNCaP cells with different treatments as indi- cated in the presence or absence of MC3T3-E1 osteoblasts. Fixed and stained cells on the underside of the membrane (12-mm pores) were counted as migrated cells per 2 mm2. *Samples significantly different from vehicle treatment with p < 0.05. **Samples signifi- cantly different from activin A treatment with p < 0.05. ***Sam- ples from LNCaP + MC3T3-E1 cells significantly different from LNCaP cells with p < 0.05. (C, left) Quantification of the two- chamber migration assay. pCMV-control and activin A over- expressing stable clones from LNCaP cells were further transfected with siRNA-control or siRNA-activin A, and migration assays were compared in the presence or absence of MC3T3-E1 osteo- blasts. *Samples from LNCaP + MC3T3-E1 cells significantly dif- ferent from LNCaP cells with p < 0.05. **Samples significantly different from pCMV-control with p < 0.05. ***Samples signifi- cantly different from pCMV-activin A with p < 0.05. (Right) Western blot detected by anti-activin A antibody to show activin A protein level in pCMV-control and activin A overexpressing stable clones from LNCaP cells that were transfected with siRNA-control or siRNA-activin A. The optical densities obtained for activin A expression from vector only were normalized using GAPDH ex- pression levels and set as 1. All data are representative of at least three independent experiments and error bars represent ± SD.
receptors, and SB431542 abolished the migration (Fig. 2A, top panel). To rule out a bias caused by differences in proliferation, we also tracked single cells by video time- lapse microscopy and confirmed that activin A–treated cells showed significant loss of mitogenic activity (data not shown). Because treatment with activin A has been re- ported to extensively reduce cell proliferation,(26–28) its effects on migration may have a lesser degree of bias, be- cause of differences in cell growth. We also evaluated the effect of activin A on the migration of cancer cells to mineralized bone matrices produced by differentiated os- teoblasts. We used a two-chamber migration assay in which cancer cells migrated through a membrane with 8-mm pores from an upper chamber toward a lower chamber with differentiated MC3T3-E1 osteoblasts. In activin A–treated cells, the proportion of migrated LNCaP cells was signifi- cantly increased in the presence of MC3T3-E1 cells and addition of SB431542 or an activin A–neutralizing anti- body markedly blocked activin A–mediated prostate can- cer cell adhesion to extracellular matrices, produced by differentiated MC3T3-E1 osteoblasts (Fig. 2B, bottom panel). To further test the biological significance of over- expressing activin A in human prostate tumors, we exam- ined the role of activin A on migration of cancer cells with either overexpression or knocked down expression of ac- tivin A. Overexpression of activin A increased the migra- tion of LNCaP cells compared with the vector control cells.
In contrast, the basal migration rate was decreased in LNCaP cells stably transfected with siRNA of activin A (Fig. 2C). Similarly, overexpressing activin A significantly increased the migration of prostate cancer cells to miner- alized extracellular matrices produced by differentiated osteoblasts. However, this enhancing effect of activin A was markedly blocked in LNCaP cells in which the activin A was knockdown by siRNA (Fig. 2C). These results were also confirmed by wound healing assays (data not shown).
Activin A potently increases AR gene transcription in prostate cancer cells
Anti-androgen therapies in men with locally advanced disease remain the cornerstones of treatments for ad- vanced prostate cancer. Hydroxyflutamide (HF), an AR antagonist, markedly decreased activin A–mediated wound healing and prostate cancer cell migration, indi- cating that the AR may play an important role in activin A–mediated prostate cancer actions (Figs. 2A and 2B, bottom panels).
Given the major role of the AR in promoting PSA levels and the progression of androgen-independent prostate cancer, we further studied whether activin A influenced AR expression by Western blot, Northern blot, and real- time RT-PCR analysis. Expression levels of both AR protein (top) and mRNA (middle) increased in time- and dose-dependent manners in LNCaP prostate cancer cells (Figs. 3A and 3B) after activin A treatment. SB431542 or an activin A–neutralizing antibody could abolish the effect, as well as treatment with the mRNA synthesis inhibitor, actinomycin D (data not shown). Activin A–induced PSA expression was also observed (Figs. 3A and 3B), as previ- ously reported.(26,29)Activin A induced the highest level of
AR mRNA at ;50 ng/ml (Fig. 3A). In addition, treatment with activin A had a stimulating effect of up to 6-fold on the level of AR mRNA at day 3 (Fig. 3B, bottom panel).
To probe which Smads were involved in activin A–
mediated AR expression, we transfected LNCaP cells with Smad2, Smad3, Smad4, or Smad6 and measured the AR promoter activity in the presence or absence of activin A.
The results show that activin A can increase AR promoter activity that is further enhanced primarily through Smad3 or Smad2, but Smad4 or Smad6 has no effect on AR pro- moter activity (Fig. 3C). We further examined whether Smad2 and Smad3 activated the activin A–induced AR mRNA transcription. Real-time RT-PCR analysis showed that the Smads effects on AR transcription are marginal in the absence of activin A. However, overexpression of Smad2 or Smad3 could further enhance expression of AR mRNA induced by activin A (Fig. 3D), and both siRNA and dominant negative mutants of Smad2 or Smad3 suppressed activin A–mediated AR mRNA expression (Fig. 3D). To further verify this observation, we performed a computer-based analysis of the predicted promoters of AR gene. We found that human AR promoters have multiple common Smad binding sites. Significantly, such Smad-binding motifs are conserved in both the mouse and human genes, thus implying that they are physiologically relevant (data not shown). We performed ChIP assays to assess whether Smad proteins can bind to AR promoter regions in vivo and within a chromatin environment in the presence of activin A treatment. As shown in Fig. 3E, Smad2 and Smad3 are bound to the predicted binding sites of endogenous AR promoter in response to activin A in vivo. These results indicate that, at the mechanistic level, the binding activity of Smad induced by activin A binding to its DNA-response element in the AR promoter leads to increased AR gene transcription in prostate cancer cells.
Activin A activates AR function through promoting nuclear translocation and interaction of AR
with Smads
It is commonly thought that AR is activated by andro- gens after its recruitment to the nucleus, and the direct binding of the androgen to the ligand-binding domain of AR stimulates AR translocation to the nucleus. However, several growth factors recently have been shown to be capable of inducing nuclear translocation of AR, such as IGF-1.(30) Therefore, we decided to study whether AR translocates into the nucleus of LNCaP cells in response to activin A and if this event is associated with Smad proteins.
Immunofluorescence studies using anti-AR and anti-Smad antibodies showed that the majority of cells have a diffuse cytosolic and nucleus distribution of AR and Smad3 in unstimulated cells (Fig. 4A, top panel). After treatment with activin A, a major portion of both AR and Smad3 co- localized into the cell nucleus, as indicated by reinforce- ment of the fluorescence signal (Fig. 4A, bottom panel).
Results obtained by fluorescence microscopy were also confirmed by subcellular fractionation experiments to show that the accumulation of both AR and Smad3
FIG. 3. Activin A promotes AR expression through Smads. (A) Dose effect and (B) time course of activin A on AR and PSA expression, as assessed by Western blot (top), Northern blot (middle), and real-time PCR (bottom). The optical densities obtained for AR and PSA expression from vehicle treatment were normalized using b-tubulin expression levels and set as 1. *Samples significantly different from vehicle treatment with p < 0.05. (C) Comparative AR promoter activity in LNCaP cells transfected with the different Smad expression plasmids indicated with or without activin A were measured by luciferase reporter gene assay (top). *Samples significantly different from vector-control with activin A treatment, p < 0.05. Northern blot of AR mRNA expression in LNCaP cell transfected with vector control, DN-Smad2, and DN-Smad3 with or without activin A (bottom). The optical densities obtained for AR expression from vector control with vehicle treatment were normalized using b-actin expression levels and set as 1. (D) Real-time PCR assay of AR
proteins are significantly increased in the nuclear fraction in response to activin A treatment (Fig. 4B, left panel).
Next, we examined the possibility of activin A inducing the interaction between AR and Smad3 in prostate cancer cells. AR-expressing plasmids were transfected into LNCaP cells with or without activin A treatment. Cell extracts were prepared for co-immunoprecipitations by using anti-AR, anti-IgG, and anti-Smad3 antibodies. As shown in Fig. 4B (right), in the presence of activin A, the endogenous AR-Smad3–associated protein complex was immunoprecipitated both by anti-AR or anti-Smad3 anti- body, but not anti-IgG control antibody. A similar result was also obtained when we transfected AR-expressing plasmids into LNCaP cells to further show that the over- expressing AR is capable of interacting with Smad3 (Fig.
4B, right). To show that AR and Smad3 form a complex on the endogenous AR-targeted gene promoter, activin A–
treated LNCaP cells were subjected to ChIP and reChIP experiments. The ChIP results showed that AR and Smad3 associated with the ARE I + II and ARE III located in the promoter and enhancer of the PSA gene in an activin A–
dependent manner (Fig. 4C, left). Importantly, ReChIP experiments showed that AR and Smad3 assembled to- gether on the ARE regions of the PSA promoter in the presence of activin A (Fig. 4C, right).
AR is required for the activin A/Smad pathway to promote prostate cancer cell migration to bone matrix
Activation of AR is believed to contribute to the rear- rangement of the actin cytoskeleton and is required for the expression of a number of cell surface and other proteins involved in the control of cell migration.(31–33)To test the biological significance of the activin A–induced activation of AR, we examined the influence of activin A on cell migration of AR-positive and AR-negative cancer cells.
Addition of activin A significantly increased the cell mi- gration in AR-positive human prostate cancer LNCaP cells but not in AR-negative DU145 and PC-3 cells or Smad4- deficent SW480.C7 cells (Fig. 5A). In addition, the effect of activin A on the migration rate was significantly decreased in LNCaP cells transfected with siRNA-AR but increased in DU145 and SW480.C7 cells transfected with AR- expressing plasmids (pSG5-AR) (Fig. 5B). These results were confirmed by wound healing assays (data not shown).
To study whether activin A activates the AR to promote cellular migration through Smads, we added activin A to LNCaP cells with or without suppression of Smad3 by
siRNA and measured by two-chamber migration assay.
LNCaP cells with knocked down Smad3 showed signifi- cantly lower migratory cell numbers and AR protein levels than control cells, indicating that Smad3 signaling is re- quired for the activin A–mediated cell migration and ex- pression of the AR (Fig. 5C). In addition, overexpressing the AR in LNCaP cells in which the expression of Smad3 had been suppressed by siRNA reversed the Smad3- siRNA suppressive effect on activin A–mediated cell mi- gration, indicating that AR signaling may be a downstream effecter of the activin A/Smad3-dependent pathway to mediate cell migration.
To further examine whether the AR mediated the ac- tivin A–induced cancer cell migration to differentiated osteoblasts, thereby enhancing bone metastasis, we exam- ined whether the expression of AR, induced by activin A/Smads, can affect the migration of LNCaP cancer cells to differentiated or undifferentiated MC3T3-E1 osteoblastic cells. LNCaP cells with activin A significantly increased the migration of cancer cells to mineralized extracellular ma- trices, produced by differentiated osteoblasts. However, this enhancing effect of activin A was markedly blocked in LNCaP cells in which the AR expression was suppressed by siRNA Smad3, which could be reversed in LNCaP cells by overexpressing the AR (Fig. 5C).
Overexpression of activin A in primary prostatic adenocarcinomas correlates with bone metastases and increased expression of AR
To substantiate whether the upregulation of activin A is responsible for disease progression and bone metastasis, we used immunohistochemistry in clinical cancer biopsies to compare expression patterns of activin A in primary cancers between cases developing bone metastases (n = 40;
Figs. 6A and 6B) and those without bone metastatic pro- pensity after at least 5 yr of follow-up (n = 29; Fig. 6C).
Consistent with the in vitro observations, activin A over- expression in the primary prostatic adenocarcinomas was significantly more frequent in the metastatic group com- pared with the nonmetastatic propensity group (p < 0.001;
Fig. 6D versus 6F). The expression level of activin A was also generally higher in the osseous metastatic lesion than in the primary counterpart in 11 cases with matched spec- imens (Fig. 6E versus 6D).
As two important regulatory mechanisms in the evolution of androgen-refractory prostate cancers, we further exam- ined whether the association of AR and PSA overexpression with activin A–treated LNCaP cells could also be seen in
mRNA expression in LNCaP cells transfected with indicated expression plasmids with or without activin A (top). *Samples significantly different from Smad2-transfected cells with activin A treatment, p < 0.05. **Samples significantly different from Smad3-transfected cells with activin A treatment, p < 0.05. Real-time PCR assay of AR mRNA expression in LNCaP cells transfected with siRNA-control, siRNA-Smad2, and siRNA-Smad3 in the presence or absence of activin A (middle). *Samples significantly different from activin A treatment with p < 0.05. Real-time PCR analysis verified the specific siRNA-mediated knockdown of Smad2 and Smad3 (bottom).
*Samples significantly different from siRNA-control with p < 0.05. (E) ChIP assays show in vivo interaction of Smad2/3 with DNA- binding elements derived from the human AR promoters. LNCaP cells transfected with vector control, Smad2, and Smad3 expression plasmids were untreated (2) or treated with activin A (+) to induce the Smad2/3 binding activity. Cells were cross-linked with for- maldehyde and immunoprecipitated with a polyclonal antibody recognizing Smad2/3. The ‘‘input’’ samples represent equal fractions of extract collected before precipitation from which DNA was extracted and used as a control. All the results are representative of at least three independent experiments.
human prostate cancer tissues. Indeed, primary prostate cancers with high activin A expression also had a significantly higher rate of AR overexpression (p < 0.001; Fig. 6I versus 6G). For PSA expression, we found that primary prostate cancers with overexpressing activin A showed stronger PSA expression (Fig. 6L versus 6J). Furthermore, elevated
expression of AR (Fig. 6H) and PSA (Fig. 6K) was also seen in bone metastatic lesions. The increased expression of ac- tivin A also showed a trend toward an association with higher Gleason score in primary cancers (p = 0.080).
Taken together, these findings indicate that activin A, in addition to its effects on cell growth and FIG. 4. Activin A induces AR to translocate into the nucleus and interact with Smad proteins. (A) Representative immunofluorescent stainings of AR and Smad3 are predominantly localized in the nucleus of LNCaP cells treated with activin A. Cells were stained with anti- AR antibody (left) and with anti-Smad antibody and DAPI (middle), and the right panel shows merged images. (B) Subcellular fractionation followed by Western blot analysis showed that the accumulation of both AR and Smad3 proteins are significantly increased in the nuclear fraction in response to activin A treatment (left). PARP was detected exclusively in the nuclear fraction and served as a control for nuclear proteins. b-tubulin was detected exclusively in the cytoplasmic fraction and served as a control for cytoplasmic proteins. GAPDH was used to serve as loading control. For co-immunoprecipitation of AR and Smad3, LNCaP cells were transfected with control vector (pSG5) or AR expressing plasmid (pSG5 AR) were treated with or without activin A. Cell extracts were prepared and immunoprecipitations were performed using anti-AR, control IgG, and anti-Smad3 antibodies followed by immunoblotting using anti- AR or Smad3 antibodies as indicated (right). The optical densities obtained for AR and Smad expression from vehicle treatment were normalized and set as 1. (C) LNCaP cells were treated in the presence or absence of activin A. ChIP or reChIP was performed with the indicated antibodies. The precipitated chromatin was amplified by PCR using a primer flanking the promoter region (ARE I + II) and the enhancer region (ARE III) of the PSA gene, or the promoter region of the unrelated b-actin gene. All data are representative of at least three independent experiments.
apoptosis, may facilitate the migration of prostate cancers into bone matrix through the Smads pathway to promote AR gene transcription and nuclear transloca- tion, as well as by promoting the interaction between
AR and Smads. As a result, the activin A–Smad–AR pathway may be considered a potential target for therapeutic intervention in bone metastatic prostate cancers.
FIG. 5. AR is required for activin A–promoted human prostate cancer cell migration through Smad signaling. (A) The effects of activin A on cell migration in AR-positive, AR-negative, and Smad4-deficient cells. LNCaP, DU145, PC-3, and SW480.C7 cells were treated with or without activin A in the presence of MC3T3-E1 cells, and two-chamber migration assays were measured by counting the stained cells on the underside of a membrane (12-mm pore) as migrated cells per 2 mm2. *Samples significantly different from vehicle treatment with p < 0.05. (B) Quantification of the two-chamber migration assays. LNCaP cells transfected with siRNA-AR (left), DU145 cells transfected with overexpressing AR plasmid (pSG5-AR) (middle), and SW480.C7 cells transfected with pSG5-AR (right), were stim- ulated with or without activin A in the presence of MC3T3-E1 cells. Migration assays were measured as in A. *Samples significantly different from vehicle treatment with p < 0.05. **Samples significantly different from vector control with p < 0.05. Western blot analysis verified the specific siRNA-mediated knockdown of AR or overexpression of AR. The optical densities obtained for AR expression from vehicle treatment were normalized using b-tubulin expression levels and set as 1. (C, top) Quantification of the two-chamber migration assay. siRNA-control and siRNA-Smad3 stable LNCaP cell clones with transfection of control vector or AR expressing plasmid, were incubated with or without activin A and migration assays were compared in the presence or absence of MC3T3-E1 osteoblasts. Fixed and stained cells on the underside of a membrane (12-mm pore) were counted as migrated cells per 2 mm2. *Samples significantly different from siRNA-control with activin A treatment (group 2 vs. group 4), p < 0.05. **Samples significantly different from siRNA-Smad3 with activin A treatment (group 2 vs. group 6), p < 0.05. (Bottom) Western blot with anti-AR, anti-Smad3, and anti-b tubulin antibodies was used to detect the AR and Smad3 expression in LNCaP cells with different transfected conditions compared with the control (vector with scrambled siRNA) cells. The optical densities obtained for AR and Smad3 expression from vector with vehicle treatment were nor- malized using b-tubulin expression levels and set as 1. All data are representative of at least three independent experiments and error bars represent ± SD.
DISCUSSION
In this study, we identified activin A as a potential modulator of bone metastatic behaviors in prostate cancer cells and showed that AR is required for the effects of activin A on cancer cell motility. Does this activin A–
Smads–AR signaling also play a role in recruitment of cancer cells to bone lesions in vivo? We tried to extend this finding beyond LNCaP cells and created a xenograft model to show activin A can stimulate metastasis in vivo. How- ever, mutations in the activin type II receptor gene, ACVR2, were recently identified in prostate cancer cell lines,(34)and LNCaP and CWR22Rv1 also did not metas- tasize well in our study (data not shown). Therefore, we tried to establish direct injection of LNCaP cells into the left tibia of SCID mice for studying the effects of activin A on prostate cancer bone metastasis. The preliminary results as examined by X-rays showed that osteoblastic lesions were more notable in the LNCaP cell–injected animals compared with the sham operation animals, and the activin A–treated group had more bone lesions after LNCaP cell
implantation into the tibias compared with vehicle-control groups (Supplemental Fig. 1). However, we will need to further exam pathological sections, perform histomorpho- metric analysis, and collect enough sets of animal results to test whether activin A is capable of enhancing the bone metastatic ability of prostate cancer in vivo. Another clinically related important question will be to examine the effects of activin A on primary cells cultured from prostate tumors. Preliminary studies on subcultured epithelial components from explanted primary cancer cells have confirmed that the migration of these cells respond to ac- tivin A similarly to the cell line used in this study (un- published data).(35). Does activin A secreted by prostate cancer impact osteoblasts/osteoclasts near the tumor re- gion? Indeed, there is abundant evidence that activin A can stimulate the formation of osteoclasts in bone marrow–
derived cultures and that the inhibition of activin in these cultures restores osteoclastogenesis(36,37); there are also studies showing a positive effect of activin A on osteo- blastogenesis.(36) Direct administration of activin into fracture sites increased callus formation, leading to FIG. 6. Immunohistochemical features and correlations of ac- tivin A, AR, and PSA in ade- nocarcinomas of the primary prostatic lesions with vs. with- out bone metastastic propen- sity. (Top) H&E staining of (A) a representative human pri- mary bone-metastasizing pros- tatic adenocarcinoma, (B) the corresponding osseous meta- static lesion of Fig. 5A, and (C) a nonmetastatic primary pros- tatic cancer. (Top middle) Im- munohistochemical staining.
(D) activin A is diffusely ex- pressed in the metastasizing pri- mary cancer, (E) even stronger staining for activin A is ob- served in the osseous metasta- sis, and (F) compared with D and E, no or weak expression of activin A is seen in the primary lesion of the nonmetastatic case. (Bottom middle) AR is significantly stronger in the ac- tivin A–overexpressing pros- tatic carcinoma (G, primary; H, metastatic), but weak or absent in those without activin A ex- pression (I). (Bottom) PSA is significantly stronger in the ac- tivin A–overexpressing pros- tatic carcinoma (J, primary; K, metastatic), but weak or ab- sent in those with weak activin A expression (L). Table: corre- lation of activin A status in primary prostatic adenocarci- nomas with bone metastases, Gleason score, AR, and PSA expression.
increased healing and bone strength,(38)and systemic ad- ministration of activin A to aged ovariectomized rats has been reported to increase vertebral BMD and strength.(39) These findings suggest that activin A is involved in both bone formation and bone resorption.(40,41)A recent study also showed that the topical infusion of activin A can en- hance bone turnover by increasing both newly bone for- mation within 1 wk of bone grafting and bone resorption after 2 wk of bone grafting and results in an increase in the bone mass of grated bone using inbred mice in which iso- grafting of bone can be performed, similar to clinical au- tografting.(42)Together, these results indicate that unique property of activin A may play an important role to pro- mote prostate cancer cells to metastasize into bone.
In addition to previous results of the roles of activin A on prostate cell growth inhibition and apoptosis, our results showed that activin A increased the migration of LNCaP cells through Smad signaling, paralleled with an increase in AR levels. LNCaP cells with siRNA-Smads showed sig- nificantly lower migratory cell numbers and AR protein levels than control cells (Fig. 5C), and overexpressing the AR in LNCaP cells with siRNA-Smad3 partially reversed the decrease on cell migration affected by siRNA-Smad3 (Fig. 5C). Previous studies showed that activation of the AR results in cytoskeletal rearrangement, through the Src- FAK-PI3 kinase-Cdc42/Rac1 cascade, which is required for androgen signaling for cell motility.(43,44)Together, our previous reports and those of others(12,13,16) suggest that the activin-activated AR may cooperate with Smad pro- teins or form a Smad/CDC42/Rac1-PAR6 complex o pro- mote cancer cell migration by which activin A exerts its modulating effects on the coordination of different gene expression programs associated with the metastatic pro- pensity of prostate cancer cells. However, we cannot ex- clude the possibility that AR regulated by different signal transduction other than activin A may play different roles in prostate cancer cell motility.
Recent studies showed that activin A and androgen co- induce the expression of PSA through a Smad3-mediated mechanism but were mutually antagonistic in regulating prostate cancer cell growth.(16)This indicates the existence of a complex cross-talk between activin A and androgen signaling in regulation of gene expression and growth of the prostate. Our previous studies also proved that Smad3 and Smad4 are essential co-regulators of AR in the presence of androgen.(13)Together with our data showing that activin A significantly induces nuclear translocation of AR for inter- action with Smad3, it is conceivable to hypothesize that activin A and androgen may both require AR–Smad3 complex formation to regulate PSA expression. However, the cancer cell behaviors will depend on competing for the limited amount of AR–Smad3 protein complex within prostate cancer cells and recruiting into individual signaling pathways. Activin A may also play a role in conferring re- sistance to hormone therapy by amplifying AR signaling output in the presence of limited androgen, thereby con- verting prostate cancer growth from a hormone-sensitive to a hormone-refractory state. However, whether this activin A–Smad–AR pathway confers androgen-independent can- cer cell resistance to hormone therapy remains to be studied.
The progression to hormone-refractory prostate cancer is partly caused by the clonal evolution into neuroendo- crine (NE) cell tumors. Receptors for certain NE secretory products, including serotonin, bombesin, and calcitonin, present in prostate cancers, have been suggested to play roles in regulating prostate cell growth and bone metasta- ses.(45)Noticeably, our array data also showed that NPY, a molecule that widely modulates NE functions and prostate cancer cell migration,(46,47)has considerably stronger ex- pression in the androgen-independent stage of prostate cancer with bone metastasis (Supplemental Table I). Ab- errant NPY expression is also significantly predictive of prostate cancer progression and poor prognosis.(25) In a paracrine fashion, these NE peptides may consequently contribute to the emergence of the androgen-independent status by binding to the receptors present in cancer cells, thereby driving a vicious cycle of cancer progression. Our expression profile looks similar to IL-6 induction, which gives rise to NE differentiation,(48,49) and genes such as Wnt5A, JunB, etc., are also induced (Supplemental Table I). Wnt5A can go through either canonical or noncanonical pathways, and it would be interesting to in study whether activin A has impacts on NE similar to IL-6.
Prostate cancer cells are also major producers of VEGF.(23) In radical prostatectomy specimens, VEGF expression was not only found to significantly correlate with neovascularization, but also with tumor grade, tumor stage, and shortened disease-free survival.(23) Similar to VEGF, whereas there is no or low activin A expression in benign prostatic tissue, our results and others showed that activin A is strongly expressed in a subset of prostate cancers and correlated with increasing Gleason scores (Fig.
6).(50) Moreover, circulating activin A levels in patients with bone-metastasizing prostate cancers were recently found to strongly correlate with PSA levels, and, to a lesser extent, with the number of bone metastases.(17,18) In agreement with these reports, our study on prostate cancer biopsies also showed that activin A expression shows a positive correlation with bone metastatic propensity and a trend toward an association with AR expression. Taken together, our findings further indicate that activin A, in addition to its effects on cell growth inhibition and apo- ptosis, may promote AR function to facilitate the migra- tion behaviors of prostate cancer cells through the Smads pathway, thereby promoting bone metastasis. Therefore, the activin A–Smads–AR axis may be considered as a novel molecular targeting pathway for a more selective therapeutic intervention in the treatment of bone meta- static prostate cancers.
ACKNOWLEDGMENTS
This work was supported by Grants CMRPD 87041, CMRPG 83021, and CMRPD 83038 from Chang Gung Memorial Hospital and NMRPD 140543 (NSC 94-2312-B- 182-054) from the National Science Council to H.-Y.K.
The authors thank Dr. Chawnshang Chang for the AR- related reagents, Drs. Hsien-Jien Kung and Hui-Kuan Lin for helpful discussions during the preparation of this manuscript, the Division of Urology, Chang Gung
Memorial Hospital at Kaohsiung, and the tumor bank at Chi-Mei Medical Center for tumor sample collection.
REFERENCES
1. Mundy GR 2002 Metastasis to bone: Causes, consequences and therapeutic opportunities. Nat Rev Cancer 2:584–593.
2. Roodman GD 2004 Mechanisms of bone metastasis. N Engl J Med 350:1655–1664.
3. Nelson WG, De Marzo AM, Isaacs WB 2003 Prostate cancer.
N Engl J Med 349:366–381.
4. Chambers AF, Groom AC, MacDonald IC 2002 Dissemina- tion and growth of cancer cells in metastatic sites. Nat Rev Cancer 2:563–572.
5. Kingsley LA, Fournier PG, Chirgwin JM, Guise TA 2007 Molecular biology of bone metastasis. Mol Cancer Ther 6:2609–2617.
6. Clines GA, Guise TA 2008 Molecular mechanisms and treat- ment of bone metastasis. Expert Rev Mol Med 10:e7.
7. Jacks T, Weinberg RA 2002 Taking the study of cancer cell survival to a new dimension. Cell 111:923–925.
8. Guise TA, Chirgwin JM 2003 Transforming growth factor-beta in osteolytic breast cancer bone metastases. Clin Orthop Relat Res 415(Suppl):S32–S38.
9. Yin JJ, Selander K, Chirgwin JM, Dallas M, Grubbs BG, Wieser R, Massague J, Mundy GR, Guise TA 1999 TGF-beta signaling blockade inhibits PTHrP secretion by breast cancer cells and bone metastases development. J Clin Invest 103:
197–206.
10. Feeley BT, Gamradt SC, Hsu WK, Liu N, Krenek L, Robbins P, Huard J, Lieberman JR 2005 Influence of BMPs on the formation of osteoblastic lesions in metastatic prostate cancer.
J Bone Miner Res 20:2189–2199.
11. Kakonen SM, Selander KS, Chirgwin JM, Yin JJ, Burns S, Rankin WA, Grubbs BG, Dallas M, Cui Y, Guise TA 2002 Transforming growth factor-beta stimulates parathyroid hor- mone-related protein and osteolytic metastases via Smad and mitogen-activated protein kinase signaling pathways. J Biol Chem 277:24571–24578.
12. Kang HY, Lin HK, Hu YC, Yeh S, Huang KE, Chang C 2001 From transforming growth factor-beta signaling to androgen action: Identification of Smad3 as an androgen receptor cor- egulator in prostate cancer cells. Proc Natl Acad Sci USA 98:3018–3023.
13. Kang HY, Huang KE, Chang SY, Ma WL, Lin WJ, Chang C 2002 Differential modulation of androgen receptor-mediated transactivation by Smad3 and tumor suppressor Smad4. J Biol Chem 277:43749–43756.
14. Miyaki M, Kuroki T 2003 Role of Smad4 (DPC4) inactivation in human cancer. Biochem Biophys Res Commun 306:799–
804.
15. Ball EM, Risbridger GP 2001 Activins as regulators of branching morphogenesis. Dev Biol 238:1–12.
16. Carey JL, Sasur LM, Kawakubo H, Gupta V, Christian B, Bailey PM, Maheswaran S 2004 Mutually antagonistic effects of androgen and activin in the regulation of prostate cancer cell growth. Mol Endocrinol 18:696–707.
17. Incorvaia L, Badalamenti G, Rini G, Arcara C, Fricano S, Sferrazza C, Di Trapani D, Gebbia N, Leto G 2007 MMP-2, MMP-9 and activin A blood levels in patients with breast cancer or prostate cancer metastatic to the bone. Anticancer Res 27:1519–1525.
18. Leto G, Incorvaia L, Badalamenti G, Tumminello FM, Gebbia N, Flandina C, Crescimanno M, Rini G 2006 Activin A cir- culating levels in patients with bone metastasis from breast or prostate cancer. Clin Exp Metastasis 23:117–122.
19. Huang HY, Kang HY, Li CF, Eng HL, Chou SC, Lin CN, Hsiung CY 2006 Skp2 overexpression is highly representative of intrinsic biological aggressiveness and independently asso- ciated with poor prognosis in primary localized myxofibro- sarcomas. Clin Cancer Res 12:487–498.
20. Kang HY, Yeh S, Fujimoto N, Chang C 1999 Cloning and characterization of human prostate coactivator ARA54, a novel protein that associates with the androgen receptor. J Biol Chem 274:8570–8576.
21. Metzger E, Wissmann M, Yin N, Muller JM, Schneider R, Peters AH, Gunther T, Buettner R, Schule R 2005 LSD1 de- methylates repressive histone marks to promote androgen- receptor-dependent transcription. Nature 437:436–439.
22. Best CJ, Gillespie JW, Yi Y, Chandramouli GV, Perlmutter MA, Gathright Y, Erickson HS, Georgevich L, Tangrea MA, Duray PH, Gonzalez S, Velasco A, Linehan WM, Matusik RJ, Price DK, Figg WD, Emmert-Buck MR, Chuaqui RF 2005 Molecular alterations in primary prostate cancer after andro- gen ablation therapy. Clin Cancer Res 11:6823–6834.
23. Borre M, Nerstrom B, Overgaard J 2000 Association between immunohistochemical expression of vascular endothelial growth factor (VEGF), VEGF-expressing neuroendocrine- differentiated tumor cells, and outcome in prostate cancer patients subjected to watchful waiting. Clin Cancer Res 6:1882–1890.
24. Stanbrough M, Bubley GJ, Ross K, Golub TR, Rubin MA, Penning TM, Febbo PG, Balk SP 2006 Increased expression of genes converting adrenal androgens to testosterone in andro- gen-independent prostate cancer. Cancer Res 66:2815–2825.
25. Rasiah KK, Kench JG, Gardiner-Garden M, Biankin AV, Golovsky D, Brenner PC, Kooner R, O’Neill GF, Turner JJ, Delprado W, Lee CS, Brown DA, Breit SN, Grygiel JJ, Horvath LG, Stricker PD, Sutherland RL, Henshall SM 2006 Aberrant neuropeptide Y and macrophage inhibitory cyto- kine-1 expression are early events in prostate cancer devel- opment and are associated with poor prognosis. Cancer Epidemiol Biomarkers Prev 15:711–716.
26. Zhang Z, Zhao Y, Batres Y, Lin MF, Ying SY 1997 Regulation of growth and prostatic marker expression by activin A in an androgen-sensitive prostate cancer cell line LNCAP. Biochem Biophys Res Commun 234:362–365.
27. Wang QF, Tilly KI, Tilly JL, Preffer F, Schneyer AL, Crowley WF Jr, Sluss PM 1996 Activin inhibits basal and androgen- stimulated proliferation and induces apoptosis in the human prostatic cancer cell line, LNCaP. Endocrinology 137:5476–5483.
28. McPherson SJ, Thomas TZ, Wang H, Gurusinghe CJ, Risbridger GP 1997 Growth inhibitory response to activin A and B by human prostate tumour cell lines, LNCaP and DU145. J Endocrinol 154:535–545.
29. Fujii Y, Kawakami S, Okada Y, Kageyama Y, Kihara K 2004 Regulation of prostate-specific antigen by activin A in pros- tate cancer LNCaP cells. Am J Physiol Endocrinol Metab 286:E927–E931.
30. Wu JD, Haugk K, Woodke L, Nelson P, Coleman I, Plymate SR 2006 Interaction of IGF signaling and the androgen receptor in prostate cancer progression. J Cell Biochem 99:392–401.
31. Chuan YC, Pang ST, Cedazo-Minguez A, Norstedt G, Pousette A, Flores-Morales A 2006 Androgen induction of prostate cancer cell invasion is mediated by ezrin. J Biol Chem 281:29938–29948.
32. Nagakawa O, Akashi T, Hayakawa Y, Junicho A, Koizumi K, Fujiuchi Y, Furuya Y, Matsuda T, Fuse H, Saiki I 2004 Dif- ferential expression of integrin subunits in DU-145/AR pros- tate cancer cells. Oncol Rep 12:837–841.
33. Liao X, Thrasher JB, Pelling J, Holzbeierlein J, Sang QX, Li B 2003 Androgen stimulates matrix metalloproteinase-2 ex- pression in human prostate cancer. Endocrinology 144:1656–
1663.
34. Rossi MR, Ionov Y, Bakin AV, Cowell JK 2005 Truncating mutations in the ACVR2 gene attenuates activin signaling in prostate cancer cells. Cancer Genet Cytogenet 163:123–129.
35. Wang Q, Tabatabaei S, Planz B, Lin CW, Sluss PM 1999 Identification of an activin-follistatin growth modulatory sys- tem in the human prostate: Secretion and biological activity in primary cultures of prostatic epithelial cells. J Urol 161:1378–
1384.
36. Gaddy-Kurten D, Coker JK, Abe E, Jilka RL, Manolagas SC 2002 Inhibin suppresses and activin stimulates osteoblastogenesis
and osteoclastogenesis in murine bone marrow cultures. En- docrinology 143:74–83.
37. Fuller K, Bayley KE, Chambers TJ 2000 Activin A is an es- sential cofactor for osteoclast induction. Biochem Biophys Res Commun 268:2–7.
38. Sakai R, Miwa K, Eto Y 1999 Local administration of activin promotes fracture healing in the rat fibula fracture model.
Bone 25:191–196.
39. Sakai R, Fujita S, Horie T, Ohyama T, Miwa K, Maki T, Okimoto N, Nakamura T, Eto Y 2000 Activin increases bone mass and mechanical strength of lumbar vertebrae in aged ovariectomized rats. Bone 27:91–96.
40. Sakai R, Eto Y 2001 Involvement of activin in the regulation of bone metabolism. Mol Cell Endocrinol 180:183–188.
41. Pearsall RS, Canalis E, Cornwall-Brady M, Underwood KW, Haigis B, Ucran J, Kumar R, Pobre E, Grinberg A, Werner ED, Glatt V, Stadmeyer L, Smith D, Seehra J, Bouxsein ML 2008 A soluble activin type IIA receptor induces bone for- mation and improves skeletal integrity. Proc Natl Acad Sci USA 105:7082–7087.
42. Hirotani H, Ohtsuka-Isoya M, Mori S, Sakai R, Eto Y, Echigo S, Shinoda H 2002 Activin A increases the bone mass of grafted bone in C3H/HeJ mice. Calcif Tissue Int 70:330–338.
43. Papakonstanti EA, Kampa M, Castanas E, Stournaras C 2003 A rapid, nongenomic, signaling pathway regulates the actin reorganization induced by activation of membrane testoster- one receptors. Mol Endocrinol 17:870–881.
44. Castoria G, Lombardi M, Barone MV, Bilancio A, Di Domenico M, Bottero D, Vitale F, Migliaccio A, Auricchio F 2003 Androgen-stimulated DNA synthesis and cytoskeletal
changes in fibroblasts by a nontranscriptional receptor action.
J Cell Biol 161:547–556.
45. Amorino GP, Parsons SJ 2004 Neuroendocrine cells in pros- tate cancer. Crit Rev Eukaryot Gene Expr 14:287–300.
46. Ruscica M, Dozio E, Boghossian S, Bovo G, Martos Riano V, Motta M, Magni P 2006 Activation of the Y1 receptor by neuropeptide Y regulates the growth of prostate cancer cells.
Endocrinology 147:1466–1473.
47. Nagakawa O, Ogasawara M, Fujii H, Murakami K, Murata J, Fuse H, Saiki I 1998 Effect of prostatic neuropeptides on in- vasion and migration of PC-3 prostate cancer cells. Cancer Lett 133:27–33.
48. Qiu Y, Robinson D, Pretlow TG, Kung HJ 1998 Etk/Bmx, a tyrosine kinase with a pleckstrin-homology domain, is an ef- fector of phosphatidylinositol 39-kinase and is involved in in- terleukin 6-induced neuroendocrine differentiation of prostate cancer cells. Proc Natl Acad Sci USA 95:3644–3649.
49. Deeble PD, Murphy DJ, Parsons SJ, Cox ME 2001 Inter- leukin-6- and cyclic AMP-mediated signaling potentiates neuroendocrine differentiation of LNCaP prostate tumor cells. Mol Cell Biol 21:8471–8482.
50. Thomas TZ, Wang H, Niclasen P, O’Bryan MK, Evans LW, Groome NP, Pedersen J, Risbridger GP 1997 Expression and localization of activin subunits and follistatins in tissues from men with high grade prostate cancer. J Clin Endocrinol Metab 82:3851–3858.
Received in original form May 16, 2008; revised form December 2, 2008; accepted February 11, 2009.
