Copyright1998 by the Genetics Society of America
The Cloning by Complementation of the pawn-A Gene in Paramecium
W. John Haynes,* Brian Vaillant,* Robin R. Preston,
†Yoshiro Saimi* and Ching Kung*
,‡*Laboratory of Molecular Biology and‡Department of Genetics, University of Wisconsin, Madison, Wisconsin 53706 and †Department of Physiology, Allegheny University of the Health Sciences, Philadelphia, Pennsylvania 19129
Manuscript received December 11, 1997 Accepted for publication February 26, 1998
ABSTRACT
The genetic dissection of a simple avoidance reaction behavior in Paramecium tetraurelia has shown that ion channels are a critical molecular element in signal transduction. Pawn mutants, for example, were originally selected for their inability to swim backward, a trait that has since been shown to result from the loss of a voltage-dependent calcium current. The several genes defined by this phenotype were anticipated to be difficult to clone since the 800-ploid somatic macronucleus of P. tetraurelia is a formidable obstacle to cloning by complementation. Nonetheless, when the macronucleus of a pawn mutant (pwA/ pwA) was injected with total wild-type DNA or a fractional library of DNA, its clonal descendants all responded to stimuli like the wild type. By sorting a fractional library, we cloned and sequenced a 2.3-kb fragment that restores the Ca21current and excitability missing in pawn-A. Data from RNase protection assays, followed by the sequencing of mutant alleles and cDNA clones, established an open reading frame. The conceptually translated product suggests a novel protein that may be glycophosphatidylinositol anchored. We also discuss the general usefulness of this method in cloning other unknown DNA sequences from Paramecium that are functionally responsible for various mutant phenotypes.
A
variety of signal transduction mechanisms have mutations in one of several distinct complementationgroups (Kung1971a;ChangandKung1973a;Chang
been shown to provide protists with a capacity to
andKung1973b; Changet al. 1974).
sense and respond to chemical and physical changes in
The pawn behavioral phenotype defined one of the the environment. All eukaryotic cells use ion channels
first isolated and characterized mutations (Kung1971a;
to mediate rapid changes within the cell in response to
ChangandKung1973a). Pawn cells cannot swim
back-external stimuli. In protists, the activity of these
chan-ward in response to a depolarizing stimulus as a result nels often coincides with overt behavioral responses.
of the absence of an inward voltage-dependent Ca21 These behavioral responses provide both a sensitive
current (Kung andEckert1972). Normally, this
cur-assay for changes in electrical states of the membrane
rent leads to an increased concentration of Ca21within and a method for isolating mutations in genes associated
the wild-type cell, which leads to a reversal in the power with signal transduction and ion channel physiology.
stroke of the ciliary beat and consequently backward For decades Paramecium tetraurelia has been used to
swimming (KungandNaitoh1973).
study the effect of several ion currents on the cells’
While mutants like pawn allowed for a thorough de-swimming behavior (Kung1975;SaimiandKung1987;
scription of the relationship between membrane
elec-Preston et al. 1992b). There were several advantages
trophysiology and swimming behavior, several qualities for using this particular organism to study the molecular
of Paramecium make this organism challenging to inves-basis of their behavioral responses. The relatively large
tigate using standard techniques of molecular biology. size of the cells allowed for electrophysiological
tech-Because these cells have an 800–1000-ploid macronu-niques to be used which showed that mutant behavior
cleus, cloning unknown genes has been difficult. In was often the direct result of changes in particular ion
order to clone by complementation, the phenotype pro-currents (Kung and Eckert 1972). Sexually mature
duced by multiple endogenous copies must be over-cells will undergo autogamy and therefore homozygous
come by the injected DNA. Because the genomic DNA cultures can be established in one generation after
be-is extremely rich in A·T base pairs (on average 65% ing chemically mutagenized (Sonneborn 1970; Kung
within coding regions for 30 described genes) and these 1971b). Finally, clones could be examined by
transmis-cells use only one of the three standard stop codons sion genetics which showed that a variety of selectable
(TGA), researchers have often had to modify the stan-mutant behavioral phenotypes were often the result of
dard molecular biology techniques used for other or-ganisms.
One method used to circumvent these problems is to Corresponding author: Ching Kung, Laboratory of Molecular Biology
produce mass cultures, identify, purify, and eventually and Department of Genetics, University of Wisconsin-Madison, 1525
Linden Dr., Madison, WI 53706. E-mail: [email protected] microsequence the proteins of interest. Degenerate
pwA/pwA), pawn-B {d4-95} (nd6/nd6, pwB/pwB), and pawn-D
gonucleotides can be synthesized based on peptide
se-(nd6/nd6, pwD/pwD ;Kung1971a;Kung1971b;Y. Saimi, un-quences and used to clone the gene. Using this
tech-published results) were cultured at 208 or 288 in a growth nique, the abundant and heat resistant Ca21-regulatory medium of buffered wheat-grass extract inoculated with Entero-molecule, calmodulin, was found to regulate the activity bacter aerogenes (Sonneborn1970). Cells with the nd6 mutation are behaviorally normal but unable to fire their trichocysts. of at least two classes of ion channels (Kinket al. 1990;
Lacking the discharge reaction, these mutant cells survive the
SaimiandLing 1995). However, some of the mutant
trauma of macronuclear microinjection better than wild type. cell lines established in our laboratory affect proteins
Therefore all the cell lines used for microinjection were homo-that have proven to be relatively difficult to biochemi- zygous for the nd6 mutation. These cells were considered wild cally identify or purify (Adoutte et al. 1983;Haga et type for behavioral and other analyses.
Preparation of wild-type genomic samples for pawn
injec-al. 1984). A second method is to design degenerate
tions:Standard molecular biology techniques were used ( Sam-oligonucleotides based on highly conserved domains.
brook et al. 1989;Ausubel et al. 1993–97). Genomic DNA This approach has recently led to the cloning of several
was obtained as previously described (Hayneset al. 1995) and potential K1ion channel genes and a plasma membrane digested with Bcl I, Bgl II, Hind III or XbaI to completion as pump (Jegla and Salkoff 1995; Elwess and Van judged by gel electrophoresis and the constancy of small
frag-ments over time. Each total genomic DNA sample used for
Houten 1997). This method, however, requires the
injection was bound to Wizard DNA clean-up resin (Promega, gene to have been described in other organisms.
Madison, WI), washed in columns, and eluted with double-Several studies have shown that plasmids injected into
distilled water. The samples were then precipitated and resus-the macronucleus could effect a transformation of resus-the pended in 10 mmTris (hydroxymethyl)-aminomethane hydro-phenotype in the clonal descendants (Godiska et al. chloride and 1 mmethylenediaminetetraacetic acid, pH 8.0
(TE) at .1mg/ml. Restriction digests were electrophoresed 1987; Gilley et al. 1988; Kanabrocki et al. 1991;
and fractionated using agarose gels (0.5% Sea Plaque GTG;
Hayneset al. 1995). This suggested to us that one might
FMC, Rockland, ME), where overloading of the gel was care-be able to clone unknown or nonconserved genes that
fully avoided. Fractions were excised from the gel and ex-complement mutant defects by simply injecting wild- tracted with Agarase (Epicentre Technologies, Madison, WI). type genomic fragments into mutant macronuclei. We This process was repeated until several micrograms of DNA chose pawn mutants as the first candidate for such a were obtained for each of the fractions. Samples were finally precipitated and resuspended in TE at 1–5mg/ml for direct strategy because they result from recessive mutations
injection. and they have a well-characterized and striking
pheno-Preparation of RNA for Paramecium:Cells were harvested type (Kung 1971a;Kung andEckert1972;Changet
and washed in Dryl’s solution (Dryl1959). Approximately
al. 1974; Satow and Kung 1980; Haga et al. 1984).
250ml aliquots of cells (23105cells) were lysed in 750ml
Previously, we showed that mutant pawn cells could of TRI-REAGENT (Molecular Research Center, Cincinnati, OH). The protocol for RNA isolation, which was provided by be transformed with gel-purified clonable fractions of
the company, included the following additional steps. Prior genomic DNA digested to completion with
endonucle-to the addition of chloroform endonucle-to separate the aqueous and ases (Hayneset al. 1996). In the present study we isolate
organic phases, the tubes were centrifuged and the superna-unique restriction fragments that complement pwA mu- tant transferred to a new tube. Isopropanol (1/10 volume) tations in Paramecium. We present our analysis of a 2.3- was added and the tubes centrifuged to precipitate some of the contaminating DNA. In addition a salt precipitation was kb fragment from a Bgl II digestion of wild-type genomic
also done to eliminate any potential contaminating proteogly-DNA that complements the pawn-A mutant phenotype.
cans. RNA was sometimes further purified using a PolyATtract This fragment complements only one of three pawn
mRNA isolation system (Promega).
complementation groups tested. Further development Microinjection:Five to 10 pl of DNA solutions at various and improvement of cloning by complementation in concentrations were injected into the macronucleus of each Paramecium and other protists should allow for the recipient cell as previously described (Kanabrockiet al. 1991; Hayneset al. 1995;Hayneset al. 1996). Recipients were in-isolation of genes that affect a variety of biological
phe-jected between two and six fissions after autogamy. Each DNA nomena (Dynes and Firtel 1989; Ryan et al. 1993;
sample was injected into at least six cells. The descendants of
Zhanget al. 1994;Vashishthaet al. 1996;Wilsonand
the individual recipients were cultured as individual clones.
Seebeck1997). By combining the ability to select for Behavioral assay:The pawn mutant cells injected with
wild-mutant phenotypes with complementation cloning and type genomic DNA or plasmids carrying genomic inserts were cultured for four to seven fissions before their behavior was the characterization of the gene products, protists
tested. Cells were incubated in adaptation solution (4 mm should provide new and fundamental information
KCl, 1 mmCaCl
2, 1 mmHEPES, 0.01 mmEDTA, pH 7.2) for
about the nature, regulation, and evolution of eukary- 10 min and then individually transferred into a K1-test solution
otic signal transduction mechanisms. (30 mmKCl, 1 mmCaCl
2, 1 mmHEPES, 0.01 mmEDTA, pH 7.2). The duration of continuous backward swimming of each cell immediately upon transfer was monitored using a stereo-microscope and recorded (Kung1975).
MATERIALS AND METHODS
Cloning of the transforming factor:A gel-purified fraction of Paramecium DNA digested with Bgl II which transformed Stocks and cultures: P. tetraurelia stock 51s (1/1) (
Sonne-born1970), nd6 (nd6/nd6) (Lefort-Tranet al. 1981), pawn- the behavior of the clonal descendants from the injected mu-tant cells was incubated with BamHI methylase and cloned A {d4-94} (both nd6/nd6, pwA/pwA and 1/1, pwA/pwA),
Jolla, CA). The ligations were sabotaged with BamHI, to elimi-nate self-ligated plasmids, before transforming electrocompe-tent Sure cells (Stratagene). Resistant bacterial clones were screened by preparing plasmid DNA from groups of bacterial colonies and microinjecting into Paramecium. Duplicate plates and nitrocellulose lifts were used to help sort the colo-nies until an individual colony was isolated (Figure 2).
Electrophysiology:The techniques used to record Ca21 cur-rents from Paramecium with a two-electrode voltage clamp have been described previously (Prestonet al. 1992a). Briefly, membrane potential was clamped using intracellular capillary microelectrodes filled with 3mCsCl. Cells were incubated in adaptation solution for 10 min before being placed into a standard solution of 10 mm tetraethylammonium chloride, 0.25 mmCa(OH)
2, 0.75 mmCaCl2, 0.01 mmEDTA, an 1 mm HEPES, pH 7.2 for electrical recording. Currents were elicited by stepwise increases in membrane potential from 240 mV and were filtered at 2 kHz. Leakage currents were estimated from the membrane response to small (3–12 mV) hyperpolar-izing steps from rest and were subtracted from active
mem-Figure1.—The duration of backward swimming of microin-brane responses prior to analysis.
jected cells. The descendants of wild-type (nd6/nd6) cells in-Sequencing and RT-PCR of pwA alleles:Sequencing of the
jected with the empty pBluescript II KS (2) plasmid (Ø) original complementing genomic fragment and subsequent
were compared with those of pawn-A cells injected with empty subcloned PCR products was done using a Prism sequencing
plasmid (Ø) or total Paramecium DNA digested with various kit (PE Applied Biosystems, Foster City, CA). All PCR reactions
restriction enzymes. The interval of backward swimming was were done in a Programmable Thermal Controller 100 (MJ
recorded upon transfer to a K1-test solution after 10 min in Research Inc., Watertown, MA) using Taq polymerase
(Pro-adaptation solution (mean6SD; n$60 cells;$10 cells from mega) and several oligonucleotide primers (Operon
Technol-each of six separately injected clones). ogies Inc., Alameda, CA). PCR of the 1.6-kb (1585 bp)
geno-mic fragment was for 90 sec at 948, then 60 sec at 478, followed by 120 sec at 728 using the following two oligonucleotides:
Laboratory, Heidelberg, Germany). Periodically, CD-ROM
re-A5TCATGGGAGGATCTGGTATG; B5TTCTTCGTTTAT
corded databases (DNAStar, Madison, WI) were also searched. TAAGGTACTTTA. RT-PCR of the pwA cDNA used various
A statistical analysis of the protein was performed using the cycle times and temperatures similar to the previous reaction
SAPS program (Stanford University, CA). Secondary structure with the following oligonucleotides (base pairs are in
refer-was analyzed using methods available in the programs PRO-ence to the distance from the putative starting methionine):
TEAN (DNAStar), PHD (European Molecular Biology
Labora-1 5 TAAGTATATTGTAATTTGGCATCGTGA (sense 16–42
tory), PSA (Biomolecular Engineering Research Center), bp); 25AATTACTTGCGAACAATATTATCACG (sense 267–
PSSP (Baylor College of Medicine, Houston, TX) and COILS 292 bp); 3 5 CAGAATATGATAAAAAAGCCAAAGCCAAC (Swiss Institute for Experimental Cancer Research, Epalinges, (sense 296–324); 4 5 GATCAAATGCGATTTTAAATTCAT Switzerland). Searches for potential signal sequences and do-ATTA (antisense 525–552); 55ACAGTGATCCTTAACTAT mains were done using PROSITE (University of Geneva, Swit-ATTTGTTTTTATGAT (antisense 550–582 bp); 6 5 TTT zerland), PSORT (National Institute for Basic Biology, Osaka, AAGGACATCTCCAAAACAGTG (antisense 577–600 bp; 63 Japan), and BLOCKS (Fred Hutchinson Cancer Research
bp from stop); 7 5 AAACATCCTTTTTCTATATTTTCTA Center, Seattle, WA).
TAATC (antisense 658–688; 144 bp downstream of stop codon).
RNase protection assays:Total or (oligo)dT purified RNA RESULTS was hybridized to riboprobes polymerized from various
sub-cloned fragments of the original transforming plasmid using Isolation of the pawn-A transforming fragment:Total either T7, T3, or SP6 polymerase and incorporating either DNA harvested from wild-type cells was partially di-[a32-P] CTP or UTP as described in Current Protocols (
Ausu-gested with SauIIIA and microinjected into the macro-belet al. 1993–97). Due to the A·T richness, the hybridizations
nucleus of pawn mutant cells at approximately 5mg/ were done at high temperature (60–708) in a high salt buffer
ml. Pawn mutants are characterized by an inability to (10 mm Tris-HCl, 1.2 m NaCl, and 5 mm EDTA, pH 7.5;
BrewerandRoss1990). RNase ONE (Promega) was used to swim backward, but several clonal descendants of these digest the unprotected probe. Sequencing gels with a known injected cells responded to a K1-induced depolarization DNA ladder (G, A, T, and C dideoxy sequencing reactions) by swimming backward for several seconds (Y. Saimi
were used to size the protected fragments to within several
andR. R. Preston, unpublished results). The success of
bases. The radioactive signals were digitized and analyzed with
these initial experiments suggested that pawn mutations a Phospho-Imager (Molecular Dynamics, Sunnyvale, CA).
could be complemented by the injected wild-type DNA Sequence comparison and secondary structure prediction:
The protein and nucleotide sequence from the expected open fragments. We then tested total wild-type genomic DNA reading frame (ORF) were used to search for homologues in that had been digested to completion with one of four the most recent databases employing several different algo- restriction enzymes for the ability to transform. DNA rithms (BLAST, BLASTP, BEAUTY, BLITZ, FASTA,
FASTA-digested with HindIII, XbaI, and BglII retained the abil-SWAP, FASTA-PAT, MPSRCH, PROPSEARCH). Additional
ity to transform, but DNA digested with BclI did not searches were done with the percentages of amino acids using
di-Figure3.—Fractionating the pwA-transforming activity by gel electrophoresis. The descendants of wild-type cells injected with empty plasmid (Ø), compared to pwA cells injected with empty plasmid (Ø) or fractions of DNA after the first round of fractionation by agarose gel electrophoresis as diagramed in Figure 2. The transforming activity was unambiguously found to be in fraction 3 (fraction 155–12 kb; 253–5 kb; 3 5 1.5–3 kb; 4 5 0.7–1.5 kb). The duration of backward swimming as tested in K1-test solution (see Figure 1 and mate-rials and methods) (mean 6 SD; n$60 cells; $10 cells from each of six separately injected clones).
Figure2.—A procedure for cloning the
pwA-complement-plate were lifted onto nitrocellulose and grown in Luria-ing DNA. After two rounds of gels fractionation (upper left),
a complete Bgl II digestion of total DNA from Paramecium Bertani broth for one hour before the plasmid DNA was cloned into BamHI-digested pBluescript II KS (2) (pB). was isolated by alkaline lysis. In our serial test, the plas-Using nitrocellulose lifts (bottom left) a transforming sector mid DNA prepared from one of the first eight plates (center right) was isolated and, after subdividing groups of
contained the pawn-A transforming activity. Colonies colonies, a single transforming plasmid was isolated (bottom
from the transforming plate were again lifted onto a right). The transforming activity was followed by
microinject-ing cells with DNA purified from each step and testmicroinject-ing for a nitrocellulose filter. The nitrocellulose filter was cut into behavioral transformation in the clonal descendants (as in eight sectors. Plasmid DNA was isolated from a liquid
Figure 1). culture of each individual sector and separately injected
(see Figure 2, middle right). All 48 colonies from the only transforming sector were individually handpicked gest in Figure 1) was next separated into four size
frac-onto fresh plates. Plasmids to be used in injections were tions by agarose gel electrophoresis (Figure 2, upper
prepared from liquid cultures each inoculated with 10 left). When these fractions were microinjected, one
frac-individual colonies. Separate plasmid preparations were tion alone contained the transforming activity (Figure
finally made from the only group that transformed and 3). This 1.5–3-kb fraction was further separated into
a single transforming plasmid with a 2.3-kb insert was three fractions and the activity was followed to a
subfrac-isolated and sequenced. The plasmids subfrac-isolated from this tion containing 2–2.5-kb fragments. This fraction was
colony, called pPwnA, were further tested in a dilution then methylated with BamHI methylase and ligated into
series (Figure 4). The number of copies needed to trans-plasmids linearized with BamHI endonuclease (Figure
form, as anticipated from the crude fractions, appeared 2, center left). Bacteria were then transformed with
to conform to the assumed number of copies in the the remaining intact plasmids and incubated at 378for
genomic digests that we were originally injecting (Figure approximately 40 min before being frozen at2808in
4; seePreer 1986). We also injected the plasmid into
15% glycerol. Small aliquots of the frozen stocks were
mutant cells from two additional separate complemen-plated out and the number of colony-forming units per
tation groups, pwB and pwD (pwC is temperature sensi-microliter was determined. Aliquots containing 500
col-tive and was not tested). The insert had no effect on onies of the transformed bacteria were grown on
individ-the behavioral phenotype of individ-these mutants (Figure 4). ual plates under selective conditions. A large reaction
Restoration of the voltage-dependent Ca21 current
(.60%) of the bacterial colonies appeared to contain
by pPwnA: As mentioned earlier, the inability of pawn plasmids with inserts as determined by blue-white
tion of a fragment too small to be detected by the assay (#80 bases). However, all of the potential introns based on the consensus sequence and length would have ei-ther shifted the frame to ones with premature stop co-dons or would have resulted in substantially longer frag-ments than those detected by our probes.
RT-PCR products from (oligo)dT purified RNA were cloned and sequenced. All the cDNAs cloned and se-quenced confirmed the lack of the intron sequence. The two longest cDNAs had a stop codon in frame with the putative start codon (primer pairs 1 and 4 or 1 and
5; see materials and methods and Figure 7). Two
additional oligonucleotides based on the genomic se-quence further downstream from the putative stop co-Figure4.—The cloned pwA-transforming fragment is
spe-don consistently failed to produce RT-PCR products cific and does not transform pwB or pwD. The descendants of
three complementation groups of pawn mutations compared (see Figure 7 for primer 6 andmaterials and methods
to wild-type cells after injection with the transforming plasmid for primer 7). However, they did polymerize products at various concentrations. Plasmid DNA (5–10 pl) injected at
when plasmids containing the 1.6-kb genomic sequence 5300 copies/pl effected a full rescue of pwA but not pwB or
were introduced into the RT-PCR reactions at low
con-pwD. Even at 50 copies/pl transformation is evident for pwA
by the duration of backward swimming. centrations (data not shown). The RT-PCR products
combined with the RNase protection data allow for only one interpretable ORF and conceptually translated transient Ca21 current. Electrophysiological examina- product (Figure 7). Computer searches for similarity to tion of the clonal descendants of pawn-A cells injected other proteins and hypothetical translations as sug-with the plasmid, pPwnA, clearly shows that the inward gested by the pwA ORF failed to reveal any definitive Ca21current had been restored (Figure 5A). The
magni-homology with any other known protein (seematerials
tude of the peak current is plotted against membrane and methods
). potential in Figure 5B. While the transformed cells
ex-Sequencing of mutant alleles: Total DNA was pre-press a significantly smaller peak current than the wild
pared from three separate pwA mutant cell lines (d4-type, the voltage dependence of the inward peak is
sim-94, d4-132 and d4-513). These allelic variants were kept ilar.
in homozygous cell lines in our laboratory since they
Identification the ORF and putative product:pPwnA
were produced in three independent N-methyl-N9-nitro-was digested with restriction enzymes and smaller
frag-N-nitrosoguanidine mutagenesis experiments (Chang
ments were subcloned. We found that a subcloned
1.6-and Kung 1973a). The products from at least three
kb HindIII fragment still transformed the pwA cells but
independent PCR reactions using oligonucleotides not when digested with PstI or BclI (Figure 6). The
matching the ends of the 1.6-kb HindIII fragment were presence of a BclI site in the pwA coding sequence
cloned from each cell line. A minimum of three clones correlates with our observation that Bcl I destroys the
from each of the PCR reactions were sequenced. All transforming factor in total DNA (see Figure 1). A
the clones consistently showed that each allele had only Northern blot of total RNA showed a weak signal that
a single point mutation in the region of the ORF. The was approximately 700–1000 bp long using a 432-bp
fact that each of the three pawn-A isolates has a substitu-probe (data not shown; see Figure 6). The location of
tion in this ORF strongly suggests that the complementa-the ORF and complementa-the direction of transcription was
deter-tions observed are not extragenic (G383A in d4-94; mined by RNase protection assays. Riboprobes
polymer-C365T in d4-132; A287G in d4-513). The location and ized from several plasmids containing smaller subcloned
amino acid substitution predicted by the mutations fragments of the 1.6-kb HindIII fragment showed that
(G128D in d4-94; P122L in d4-132; Y94C in d4-513) are a species of RNA molecule in both total and oligo dT
indicated on a Kyte-Doolittle hydropathy plot averaged purified RNA was protected when probes were
polymer-over a window of seven amino acids (Figure 8). The ized in one direction but not the other (Figure 6).
significance of particular secondary structures predicted The sequence protected from RNase digestion began
by various algorithms is difficult to evaluate given the approximately 16 bp upstream of a potential starting
lack of similarity to other known proteins. However, the methionine (Figure 6; filled arrows) and the assay
hydrophilic region preceding two of the mutations is a showed that an intron, similar in size and sequence to
highly charged stretch of amino acids (11 out of 21 other known Paramecium introns, was spliced out of
from H 97 to K 117; see Figures 7 and 8). The fact that the middle of the mRNA (Figure 6, gap in middle arrow;
the two clustered mutations are of amino acids that
Russellet al. 1994). It is possible that an intron located
Figure 5.—Ca21currents in wild-type and mutant paramecia examined under a two-electrode voltage clamp. (A) Currents elicited from pawn-A, transformed pawn-A, and wild-type cells in Ca21-TEA solution. Currents were elicited by 20-msec voltage steps to210 mV from240 mV. The voltage-activated Ca21current is apparent as an inward peak during step depolarization in the wild type and in transformants, but not in pawn-A mutant cells. The capacitive transients have been suppressed. (B) Peak inward Ca21currents (ICapeak) are plotted against the membrane potential at which they were elicited (Vm). Points are means 6SD determinations from three wild-type (m), three pwA mutants (r) or eight cells descended (≈10 to 15 fissions after injection) from plasmid-injected pwA (d). The injected plasmid was at a concentration of 530 copies/pl.
suggests that this region may be important for the func- variants, the transformation is unlikely to be the result of extragenic complementation. The electrophysiology tion of this protein.
confirms that the behavioral transformation is associ-ated with the return of an inward Ca21current (Figure
DISCUSSION 5A). The voltage-sensitivity of the restored current is
almost identical to that of the wild-type current (Figure This paper presents the first successful cloning of
5B). This argues against the possibility that backward an ion-channel regulatory gene by complementation in
swimming is regained in pawn-A transformants through Paramecium. It is a result of a number of preliminary
expression of a novel Ca21 current of over-expression investigations that indicated this method might work
of another Ca21-permeable conductance. While the (Godiska et al. 1987;Gilleyet al. 1988; Kanabrocki
transformed pawn-A cells show a reduction in current
et al. 1991;Endohet al. 1995;Hayneset al. 1995). The
compared with wild-type values, a full investigation of technique developed in our laboratory had also been
this reduction is beyond the scope of this article. The used successfully to clone an unrelated gene (Skouri
possible reduction in the transformed current does not andCohen1997). We have shown that by
microinject-conflict with behavioral observations (Figure 1). Previ-ing cloned fragments of wild-type Paramecium DNA,
ous observations of wild-type cells indicates that back-a genomic frback-agment cback-an be isolback-ated thback-at functionback-ally
ward swimming duration is not strictly correlated with complements the pawn mutation (Hayneset al. 1996).
Ca21-current magnitude (R. R. Preston, unpublished
Because the cloned fragment in pPwnA complements
observations), although this had not been investigated
pwA and not pwB or pwD and since there are base
Figure6.—A diagram of the pwA locus. The hatched bar marks the location of the northern probe relative to the smallest transforming fragment tested. Two endonuclease cutting sites that eliminated the ability to transform are also represented (Bcl I and Pst I). The arrows represent the location and direction of polymerization of the riboprobes used in RNase protection assays. The position of the intron is indicated by an unprotected gap in one of these riboprobes. Several additional probes not shown were also tested to help verify the protected region. The lower gray bar corresponds to the deduced ORF of the pwA gene; its sequence is shown in Figure 7.
results from several repeated RNase protection assays, sequence predicted to be alpha helical by several
differ-ent algorithms (see materials and methods). The
as well as the sequences of several cDNA clones are all
consistent with the ORF and putative translation prod- other allele substitutes a cysteine for a tyrosine (Y94C in d4-513) suggesting that the substitution might affect uct shown in Figure 7. While it is possible that the
transcript was not fully protected at the very end of the secondary or tertiary structure, perhaps involving disul-fide bridges or beta structures.
molecule in the RNase protection assay, it is unlikely
that there would be a substantial change in the ORF Speculation on the biological role of this protein can be guided by a summary of the empirical data from and most of the translated amino acid sequence of the
putative product would remain unchanged. earlier studies on various pawn-A mutant cell lines.
Elec-trophysiology of leaky pawn-A mutants suggested that The analysis of the pawn-A product is limited by the
fact that there is no significant primary sequence homol- these mutations influenced the number of functional voltage-dependent Ca21channels present in the mem-ogy with any currently described or hypothetically
trans-lated protein. The amino acid sequence has a predicted brane (SatowandKung1974;SatowandKung1980).
Transfer of cytoplasm by microinjection from a wild-type molecular weight of 23.5 kD; a pI of≈4.36; and a
rela-tively high percentage of cysteines (5.9%) and tyrosines cell to a pawn-A mutant cell resulted in the temporary restoration of a voltage-dependent Ca21current (Haga
(9.8%) (95% and 99% quantile, respectively, by the
SAPS algorithm;Brendelet al. 1992). The hydropathy et al. 1982). It was later shown that the transferred curing
agent was likely a protein (not DNA or RNA) and that plot suggests a possible association with membrane
(KyteandDoolittle1982). While the disulfide brid- the injected protein could effect a transformation
with-out further protein synthesis (Haga et al. 1982).
Bio-ges alone could link this molecule to another
mem-brane-bound molecule, the amino- and carboxy-termi- chemical fractionation of protein from the soma of Para-mecium suggested that the transforming element was nal hydrophobic domains are also long enough for some
types of membrane spanning structures. Additional em- abundant in a microsomal fraction, while protein frac-tions prepared from cilia and ciliary membrane vesicles pirical information of this protein is provided by the
mutations found in the three pawn-A allelic variants. could not transform cells (Haga et al. 1984). These
results do not rule out the possibility that a fraction Two of the mutations indicate that flexibility and
sec-ondary structure may be important in the middle of the of the transforming protein was targeted to the ciliary membrane and that post-translational modifications protein (G128D in d4-94; P122L in d4-132). This is in
Figure 7.—The sequence and translation of the putative ORF of the pawn-A gene (GenBank accession no. AF050753). The intron sequence is presented along with the location of several oligonucleotides used to generate cDNA. The primer pairs 1 and 4, or 1 and 5 generated cDNA with the intron removed along with the putative stop codon. Primer 6 along with another oligonucleotide (seematerials and methods) further downstream generated only genomic clones. The location of a central highly charged hydrophilic region (h) and the terminal hydrophobic domains ( ) are marked by bars. The base farthest 59of the putative start codon preserved in the RNase protection assay is indicated by an arrow (→). A fortuitous SwaI site located in the intron, used to distinguish genomic from cDNA PCR products is noted. Two additional restriction sites marked correspond to endonucleases which eliminated the ability of the injected DNA to transform (Bcl I and Pst I).
that the transforming pawn-A factor was inactivated by and Na1 channel auxiliary membrane-bound subunits have been shown to be sensitive to the modification of both elevated temperatures and by treatment with
N-ethyl maleimide which suggested the presence of thiol groups with N-ethyl maleimide, and they are also involved with the expression levels of these channels in modifiable thiol groups (Hagaet al. 1984). Their
con-clusion from these studies was that the transforming the plasma membrane. However, unlike the pwA gene product, all of these membrane-bound subunits have protein was membrane bound and involved in the
as-sembly, transport, or functional expression levels of an long hydrophobic regions bounded by hydrophilic do-mains. Other genetic based investigations using Dro-ion channel required for the described
voltage-depen-dent Ca21current. sophila and Caenorhabditis have yielded subunits
simi-lar to those already found by homology or biochemical Auxiliary membrane-bound subunits currently known
to be associated with the pore-forming subunit of volt- means (Schafer and Kenyon 1995; Maryon et al.
1996), as well as additional molecules that do not have age-dependent ion channels in other organisms have
some of these same characteristics (Catterall 1996; strong homology to previously cloned subunits (e.g.,
Figure 8.—A Kyte-Doo-little hydrophilicity plot (av-eraged over seven amino acids). The position and the deduced amino acid substi-tutions found in the three independently isolated pawn mutant alleles are indica-ted. The highly charged re-gion 59of two of the pawn mutant alleles is also repre-sented (h).
had predicted alpha helical transmembrane domains. mately 19 kD was also immunoprecipitated with the
same antisera and this closely corresponds to the ex-The product from the pwA gene has hydrophobic domains
but does not have the flanking hydrophilic regions gener- pected 18.8-kD size of a processed pwA GPI-anchored protein (Eisenbach et al. 1983). A recent report of
ally associated with transmembrane domains. Instead, the
locations of the hydrophobic domains of the pwA pro- another potential GPI-anchored protein, a serine prote-ase, influencing the function of an amiloride-sensitive tein are indicative of a class of proteins found in the
secretory pathway known as glycophosphatidylinositol Na1channel now establishes a precedent for the possi-bility that there is a group of uncharacterized GPI pro-(GPI)-anchored proteins.
The PSORT algorithm (National Institute for Basic teins that modify or influence ion channel expression and function (Vallet et al. 1997). We are now
at-Biology, Osaka, Japan) predicts that the hydrophobic
domains of the pwA protein may be amino- and carboxy- tempting to biochemically characterize the protein with both antibodies and fusion constructs.
terminal sequences of GPI-anchored proteins including
characteristic amino acids at the putative cleavage sites Although the conceptual translation does not match the primary sequence of any other protein, it is possible (Nakai and Kanehisa 1992; Udenfriend and
Kodu-kula1995). This possible interpretation correlates well that the pwA product is a member of a known group of
proteins that have secondary structural requirements with the fact that a search of protein databases using
simply the percentage of amino acids found in this trans- that do not involve the conservation of primary se-quence. After assuming that this protein could be GPI lation generally matches proteins that are either
se-creted or expressed in the plasma membrane (PROP- anchored, a close inspection of most of the known GPI proteins revealed a group of
mono(ADP-ribosyl)trans-SEARCH; EMBL;HobohmandSander1995). A similar
search with the only extensively studied surface mem- ferases (mADPRTs) that do not require extensive pri-mary sequence conservation (BazanandKoch-Nolte
brane protein in Paramecium, the GPI-anchored
immo-bilization surface antigen, yields a similar list of plasma 1997). Many of the secondary structural requirements described among mADPRTs are predicted to be present membrane proteins or proteins in the secretory pathway
(W. J. Haynes, unpublished results). The existence of in the pwA product by the Garnier algorithm including
a very conserved catalytic glutamic acid residue (see a GPI anchor on the pawn-A protein would likely mean
that it is eventually expressed on the surface of the cell. Figure 7; E 152;Garnier et al. 1978). This glutamate
is predicted to be at the amino-terminal end of a second This is appealing given the fact that all of the major
ciliary proteins in Paramecium are apparently GPI an- pair of beta structures in the carboxy-terminal half of the molecule exactly as in all other known mADPRTs chored (CapdevilleandBenwakrim1996) and since
the channels responsible for the voltage-dependent (Bazan and Koch-Nolte 1997). Furthermore these
mADPRT proteins have been implicated in calcium-Ca21 current are apparently localized on the cilia
(MachemerandEckert1973;MachemerandOgura mediated signal transduction (Robinson 1997).
Besides the pwA mutation, there are three other
1979; OguraandTakahashi1976; Dunlap1977).
It is interesting that a previous study showed that known pawn loci. We have already started to isolate two of these additional genes by complementation cloning. a polyclonal antisera against a GPI-anchored surface
immobilization antigen had a significant effect on the A similar group of mutations exists in Paramecium
cauda-tum (CNR loci) which can probably be cloned, since
voltage-dependent Ca21 current (Ramanathan et al.
1983). It is possible that the polyclonal antibodies used microinjection of digested genomic DNA can cure the CNR mutants (Endoh et al. 1995). Injection of
cyto-in their study were cross-reactive with other
GPI-anchored proteins since several 40-kD proteins now plasm between these mutants has shown that all inter-species and intrainter-species cytoplasms complement (Haga
thought to be GPI anchored were also
immunoprecipi-tated by the same antisera (Eisenbachet al. 1983;Cap- et al. 1983). This suggests that there may be as many as
eight separate genes that can be cloned by this method.
approxi-of total genomic DNA and restoration approxi-of wild type phenotype in The technique presented here has allowed us to clone
trichocyst non-discharge mutant TND of Paramecium caudatum. a novel gene, which when mutated greatly reduces or Jpn. J. Genet. 70: 633–642.
prevents the expression of a voltage-dependent Ca21 Garnier, J., D. J. Osguthorpe andB. Robson,1978 Analysis of
the accuracy and implications of simple methods for predicting current in a unicellular organism. The most important
the secondary structure of globular proteins. J. Mol. Biol. 120: finding is that at least some of the genes responsible 97–120.
for the many known and well-characterized Paramecium Gilley, D., J. R. Preer, Jr., K. J. AufderheideandB. Polisky,1988
Autonomous replication and addition of telomerelike sequences behavioral mutants can be cloned by this method. While
to DNA microinjected into Paramecium tetraurelia macronuclei. there are many reasons why a particular gene might not Mol. Cell. Biol. 8: 4765–4772.
be cloned by this technique and would require other Godiska, R., K. J. Aufderheide, D. Gilley, P. Hendrie, T. Fitzwater
et al., 1987 Transformation of Paramecium by microinjection of established strategies, e.g., cloning by protein
purifica-a cloned serotype gene. Proc. Npurifica-atl. Acpurifica-ad. Sci. USA 84: 7590–7594. tion and microsequencing, or cloning by homology, Gurnett, C. A.,andK. P. Campbell,1996 Transmembrane auxil-we believe that effective cloning by complementation iary subunits of voltage-dependent ion channels. J. Biol. Chem.
271:27975–27978. combined with the sensitivity of the behavioral assay
Haga, N., M. Forte, Y. SaimiandC. Kung,1982 Microinjection of
and the power of genetics will allow us to discover novel cytoplasm as a test of complementation in Paramecium. J. Cell elements involved with ion channel signal transduction Biol. 92: 559–564.
Haga, N., Y. Saimi, M. TakahashiandC. Kung,1983 Intra- and
and a variety of other biological phenomena in
Parame-interspecific complementation of membrane-inexcitable mutants
cium. of Paramecium. J. Cell Biol. 97: 378–382.
Haga, N., M. Forte, Y. SaimiandC. Kung,1984 Characterization
We thankKit-Yin LingandLynn Haynesfor their comments on
of cytoplasmic factors which complement Ca21channel muta-the manuscript. We also thank muta-the omuta-ther members of our lab who
tions in Paramecium tetraurelia. J. Neurogenet. 1: 259–274. indirectly contributed to this work. This research was founded by
Haynes, W. J., K.-Y. Ling, Y. SaimiandC. Kung,1995 Induction
National Institutes of Health grants 22714, 36386, and
GM-of antibiotic resistance in Paramecium tetraurelia by the bacterial 51498 to R.R.P.
gene APH-39-II. J. Eukaryot. Microbiol. 42: 83–91.
Haynes, W. J., K.-Y. Ling, Y. Saimi andC. Kung, 1996 Toward
cloning genes by complementation in Paramecium. J. Neuro-genet. 11: 81–98.
LITERATURE CITED Hobohm, U.,andC. Sander,1995 A sequence property approach
to searching protein databases. J. Mol. Biol. 251: 390–399.
Adoutte, A., K.-Y. Ling, S. Chang, F. HuangandC. Kung,1983
Jegla, T.,andL. Salkoff,1995 A multigene family of novel K1
Physiological and mutational protein variations in the ciliary channels from Paramecium tetraurelia. Recept. Channels 3: 51–60. membrane of Paramecium. Exp. Cell Res. 148: 387–404. Kanabrocki, J. A., Y. Saimi, R. R. Preston, W. J. HaynesandC. Kung, Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman
1991 Efficient transformation of cam2, a behavioral mutant of et al., 1993–97 Current Protocols in Molecular Biology. John Wiley & Paramecium tetraurelia, with the calmodulin gene. Proc. Natl. Acad.
Sons, New York. Sci. USA 88: 10845–10849.
Bazan, J. F.,and F. Koch-Nolte,1997 Sequence and structural
Kink, J. A., M. E. Maley, R. R. Preston, K.-Y. Ling, M. A.
Wallen-links between distant ADP-ribosyltransferase families. Adv. Exp.
Friedman et al., 1990 Mutations in Paramecium calmodulin
Med. Biol. 419: 99–107.
indicate functional differences between the C-terminal and
Brendel, V., P.Bucher, I. Nourbakhsh, B. E. BlaisdellandS.
N-terminal lobes in vivo. Cell 62: 165–174.
Karlin,1992 Methods and algorithms for statistical analysis of
Kung, C.,1971a Genic mutants with altered system of excitation in
protein sequences. Proc. Natl. Acad. Sci. USA 89: 2002–2006.
Paramecium aurelia. II. Mutagenesis, screening and genetic
analy-Brewer, G.,andJ. Ross,1990 Messenger RNA turnover in cell-free
sis of the mutants. Genetics 69: 29–45. extracts. Methods Enzymol. 181: 202–209.
Kung, C.,1971b Genic mutations with altered system of excitation Capdeville, Y.,andA. Benwakrim,1996 The major ciliary
mem-in Paramecium aurelia. I. Phenotypes of the behavioral mutants. brane proteins in Paramecium primaurelia are all
glycosylphosphati-Z. Vgl. Physiol. 71: 142–164. dylinositol-anchored proteins. Eur. J. Cell Biol. 70: 339–346.
Kung, C.,1975 Genetic dissection of the excitable membrane of Catterall, W. A.,1996 Molecular properties of sodium and calcium
Paramecium. Genetics 79: 423–431. channels. Bioenerg. Biomembr. 28: 219–230.
Kung, C., andR. Eckert,1972 Genetic modification of electric Chang, S.,andC. Kung,1973a Genetic analysis of heat sensitive
properties in an excitable membrane (Paramecium-calcium pawn mutants of Paramecium aurelia. Genetics 75: 49–59.
conductance-electrophysiological measurements-membrane
mu-Chang, S.Y., andC. Kung, 1973b Temperature-sensitive pawns:
tant). Proc. Natl. Acad. Sci. USA 69: 93–97. conditional behavioral mutants of Paramecium aurelia. Science
Kung, C.,andY. Naitoh,1973 Calcium-induced ciliary reversal in
180:1197–1199.
the extracted models of “Pawn”, a behavioral mutant of
Parame-Chang, S. Y., J. Van Houten, L. J. Robles, S. S. LuiandC. Kung,
cium. Science 179: 195–196. 1974 An extensive behavioral and genetic analysis of the pawn
Kyte, J.,andR. F. Doolittle,1982 A simple method for displaying
mutants in Paramecium aurelia. Genet. Res. 23: 165–173.
the hydropathic character of a protein. J. Mol. Biol. 157: 105–132.
Dryl, S.,1959 Effect of adaptation to the environment on
chemo-Lefort-Tran, M., K. Aufderheide, M. Pouphile, M. Rossignoland
taxis of Paramecium caudatum. Acta. Biol. Exp. 19: 83–93.
J. Beisson,1981 Control of exocytotic processes: cytological Dunlap, K.,1977 Localization of calcium channels in Paramecium
and physiological studies of trichocyst mutants in Paramecium caudatum. J. Physiol. 271: 119–133.
tetraurelia. J. Cell Biol. 88: 301–311.
Dynes, J. L.,andR. A. Firtel,1989 Molecular complementation
Machemer, H.,andR. Eckert,1973 Electrophysiological control
of a genetic marker in Dictyostelium using a genomic DNA library.
of reverse ciliary beating in Paramecium. J. Gen. Physiol. 61: Proc. Natl. Acad. Sci. USA 86: 7966–7970.
572–587.
Eisenbach, L., R. RamanathanandD. L. Nelson,1983
Biochemi-Machemer, H.,andA. Ogura,1979 Ionic conductances of
mem-cal studies of the excitable membrane of Paramecium tetraurelia.
branes in ciliated and deciliated Paramecium. J. Physiol. 296: IX. Antibodies against ciliary membrane proteins. J. Cell Biol.
49–60. 97:1412–1420.
Maryon, E. B., R. Coronado andP. Anderson,1996 unc-68 en-Elwess, N. L.,andJ. L. Van Houten,1997 Cloning and molecular
codes a ryanodine receptor involved in regulating C. elegans body-analysis of the plasma membrane Ca21-Atpase gene in
Parame-wall muscle contraction. J. Cell Biol. 134: 885–893. cium tetraurelia. J. Eukaryot. Microbiol. 44: 250–257.
protein localization sites in eukaryotic cell. Genomics 14: 897– Satow, Y.,andC. Kung,1974 Genetic dissection of active
electro-genesis in Paramecium aurelia. Nature 247: 69–71. 911.
Satow, Y.,andC. Kung,1980 Membrane currents of pawn mutants Ogura, A.,andK. Takahashi,1976 Artificial deciliation causes loss
of the pwA group in Paramecium tetraurelia. J. Exp. Biol. 84: 57–71. of calcium-dependent responses in Paramecium. Nature 264:
Schafer, W. R.,andC. J. Kenyon,1995 A calcium-channel
homo-170–172.
logue required for adaptation to dopamine and serotonin in
Preer, J. R.,1986 Surface antigens of Paramecium, pp. 301–339 in
Caenorhabditis elegans. Nature 375: 73–78. The Molecular Biology of Ciliated Protozoa, edited by J. G. Gall.
Skouri, F.,andJ. Cohen,1997 Genetic approach to regulated
exo-Academic Press, Orlando, FL.
cytosis using functional complementation in Paramecium—
Preston, R. R., Y. SaimiandC. Kung,1992a Calcium current
acti-identification of the Nd7 gene required for membrane fusion. vated upon hyperpolarization of Paramecium tetraurelia. J. Gen.
Mol. Biol. Cell 8: 1063–1071. Physiol. 100: 233–251.
Sonneborn, T. M.,1970 Methods in Paramecium research, pp. 241– Preston, R. R., Y. Saimi, B. MartinacandC. Kung,1992b Genetic
339 in Methods in Cell Physiology, edited byD. M. Prescott.
Aca-analysis of ion channels of prokaryotes and lower eukaryotes.
demic Press, New York. Curr. Opin. Genet. Dev. 2: 780–784.
Udenfriend, S.,andK. Kodukula,1995 How glycosylphosphatidyli-Ramanathan, R., Y. Saimi, J. B. Peterson, D. L.Nelsonand C.
nositol-anchored membrane proteins are made. Annu. Rev.
Bio-Kung,1983 Antibodies to the ciliary membrane of Paramecium
chem. 64: 563–591. tetraurelia alter membrane excitability. J. Cell Biol. 97: 1421–1428.
Vallet, V., A. Chraibi, H. P. Gaeggeler, J. D. Horisbergerand Robinson, P. J.,1997 Signal transduction via GPI-anchored
mem-B. C. Rossier,1997 An epithelial serine protease activates the
brane proteins. Adv. Exp. Med. Biol. 419: 365–370.
amiloride-sensitive sodium channel. Nature 389: 607–610.
Russell, C. B., D. FragaandR. D. Hinrichsen,1994 Extremely
Vashishtha, M., G. SegilandJ. L. Hall,1996 Direct
complementa-short 20–33 nucleotide introns are the standard length in
Parame-tion of Chlamydomonas mutants with amplified YAC DNA. Geno-cium tetraurelia. Nucl. Acids Res. 22: 1221–1225.
mics 36: 459–467.
Ryan, K. A., L. A. Garraway, A. Descoteaux, S. J. TurcoandS. M.
Warmke, J. W., R. A. Reenan, P. Wang, S. Qian, J. P. Arenaet al., Beverley,1993 Isolation of virulence genes directing surface
1997 Functional expression of Drosophila para sodium chan-glycosyl-phosphatidylinositol synthesis by functional complemen- nels. Modulation by the membrane protein TipE and toxin phar-tation of Leishmania. Proc. Natl. Acad. Sci. USA 90: 8609–8613. macology. J. Gen. Physiol. 110: 119–133.
Saimi, Y.,andC. Kung,1987 Behavioral genetics of Paramecium.
Wilson, W.,andT. Seebeck,1997 Identification of a profilin
homo-Ann. Rev. Genet. 21: 47–65. logue in Trypanosoma brucei by complementation screening. Gene
Saimi, Y.,andK.-Y. Ling,1995 Paramecium Na1channels activated
187:201–209.
by Ca(21)-calmodulin: calmodulin is the Ca21sensor in the Zhang, H., P. L. HermanandD. P. Weeks, 1994 Gene isolation
channel gating mechanism. J. Membr. Biol. 144: 257–265. through genomic complementation using an indexed library of
Sambrook, J., E. F. FritschandT. Maniatis,1989 Molecular Clon- Chlamydomonas reinhardtii DNA. Plant Mol. Biol. 24: 663–672.
ing: A Laboratory Manual. Cold Spring Harbor Press, Cold Spring
