• No results found

The Transmission of Fragmented Chromosomes in Drosophila melanogaster

N/A
N/A
Protected

Academic year: 2020

Share "The Transmission of Fragmented Chromosomes in Drosophila melanogaster"

Copied!
18
0
0

Loading.... (view fulltext now)

Full text

(1)

Copyright © 1998 by the Genetics Society of America

Genetics 148: 775–792 ( February, 1998)

The Transmission of Fragmented Chromosomes in

Drosophila melanogaster

Kami Ahmad and Kent G. Golic

Department of Biology, University of Utah, Salt Lake City, Utah 84112

Manuscript received December 22, 1996 Accepted for publication October 24, 1997

A B S T R A C T

We investigated the fate of dicentric chromosomes in the mitotic divisions of Drosophila melanogaster. We constructed chromosomes that were not required for viability and that carried P elements with inverted re-peats of the target sites (FRTs) for the FLP site-specific recombinase. FLP-mediated unequal sister-chroma-tid exchange between inverted FRTs produced dicentric chromosomes at a high rate. The fate of the dicen-tric chromosome was evaluated in the mitotic cells of the male germline. We found that dicendicen-tric chromosomes break in mitosis, and the broken fragments can be transmitted. Some of these chromosome fragments exhibit dominant semilethality. Nonlethal fragments were broken at many sites along the chro-mosome, but the semilethal fragments were all broken near the original site of sister-chromatid fusion, and retained P element sequences near their termini. We discuss the implications of the recovery and behavior of broken chromosomes for checkpoints that detect double-strand break damage and the functions of telomeres in Drosophila.

et al. 1972; Golic 1994). However, chromosome loss in mitosis after dicentric formation may also occur, and has been proposed to underlie the mitotic instability of ring chromosomes (Hinton 1955, 1959; Leigh 1976).

Whether chromosome breakage or loss occurs after dicentric formation is a key issue, because these may have different cellular consequences. Muller (1941; Muller and Herskowitz 1954) extensively character-ized chromosome rearrangements in Drosophila and deduced that the natural end of a chromosome, which he termed the telomere, was an essential structure. In ad-dition, Muller performed screens for broken chromo-somes after X-irradiation. Muller found no case in which a chromosome missing a telomere (i.e., a termi-nal deficiency) was recovered, and argued that there was no evidence that broken chromosomes could be healed by de novo addition of a telomere in Drosophila. Recently, a number of groups have recovered the broken chromosomes that Muller looked for. Mason et al. (1984) used a mutation, mu2, that permits the re-covery of broken X chromosomes after irradiation of females. The requirement for a mu2 mutation to re-cover the broken chromosomes suggests that such a chromosome may normally be lethal . Even so, the mu2 mutation is not required to propagate the broken chro-mosome. In addition, Levis (1989) produced a chro-mosome 3 missing its tip distal to a P element after de-stabilization by P transposase. The mu2 mutation was not required to recover this broken chromosome. It is not clear why these screens have recovered broken chromosomes while those Muller performed did not.

The mechanisms of broken chromosome healing have been extensively characterized in Saccharomyces cerevisiae (McCusker and Haber 1981; Dunnet al. 1984; Haber

Corresponding author: Kent Golic, 201 Biology Bldg., Department of Biology, University of Utah, Salt Lake City, UT 84112.

E-mail: golic@bioscience.utah.edu

(2)

776 K. Ahmad and K. G. Golic

and Thorburn 1984; Wang and Zakian 1990). Telomere acquisition on the end of a broken chromosome prima-rily occurs by recombination, but may also occur through de novo addition. A chromosome without a telomere cannot be propagated in yeast, but the functions of the telomere have not been fully defined; telomeric se-quences promote replication of the chromosome end by telomerase, but this function is probably only necessary for long-term survival of mitotically active cells and not for cell viability itself (Zakian 1989). One essential role of the telomere must be to distinguish the chromosome end from a double-strand break (DSB) within the chro-mosome, so that only the latter activate DNA-damage responses and checkpoints. However, broken chromo-somes in Saccharomyces show continuing instability even in strains where DNA-damage responses are defective, suggesting that the telomere has additional roles ( San-dell and Zakian 1993). The detection of physical asso-ciations between telomeres and between telomeres and the nuclear envelope has suggested that telomeres play a role in the organization of the nucleus (reviewed in Blackburn and Szostak 1984; Dernberget al. 1995).

Eucaryotes with linear chromosomes normally have special DNA sequences that confer the properties of a telomere. In most organisms these are short G- and T-rich sequences that are repeated many times (GT re-peats; Zakian 1989), but in Drosophila the DNA se-quences at the ends of chromosomes are not GT repeats and instead belong to two families of middle-repetitive sequences: the HeT family and the TART family (Young et al. 1983; Levis 1989; Leviset al. 1993; Biessmannet al. 1992; Karpen and Spradling 1992; Walter et al. 1995). Both elements are arranged as tandem repeats, frequently with deletions at their distal ends, and this has suggested that the sequences are acquired by ret-rotransposition to the chromosome end, alleviating the need for telomerase-mediated extension. Other higher dipterans probably have this type of telomere structure and elongation as well (Biessmann and Mason 1994).

Most broken chromosomes that have been isolated in Drosophila do not have HeT or TART sequences on their ends (Levis 1989; Biessmann et al. 1990). Be-cause Drosophila carrying these chromosomes are via-ble and the chromosomes are transmitted normally, it is not apparent whether HeT and TART sequences con-tribute to telomere functions. Despite this, occasional acquisitions of these sequences by broken chromosome ends have been observed. Traverse and Pardue (1988) examined a spontaneous linear derivative of a ring chro-mosome. HeT sequences were appended onto both new ends of the chromosome. Some chromosomes that were broken by P transposase or in mu2 females have later acquired HeT or TART sequences (Biessmannet al. 1990; Leviset al. 1993). Such observations support the model where occasional retrotranspositions of HeT or TART to the chromosome ends maintain the lengths of Drosophila chromosomes.

In this article we describe our studies of the behavior of dicentric chromosomes and broken chromosomes in Drosophila. Falcoet al. (1982) observed that the FLP site-specific recombinase can mediate unequal sister-chromatid exchange (USCE) between inverted repeats of chromosomal FLP Recombination Targets (FRTs) to gen-erate dicentric chromosomes in Saccharomyces. Golic (1994) showed that FLP-mediated USCE also produces dicentric chromosomes in Drosophila (Figure 1). Sister chromatids become fused at the site of recombination to form a dicentric chromosome and an acentric chro-mosome. The dicentric chromosome forms a bridge between the two poles of division when the cell divides, while the acentric portion of the chromosome is proba-bly lost. In Drosophila, the loss of the acentric chromo-some resulted in substantial aneuploidy in the daugh-ter cells (Golic 1994). Aneuploidy of such magnitude severely reduces the viability of cells (Ripoll and Gar-cia-Bellido 1979; Ripoll 1980), making it difficult to assess the fate of the dicentric bridge. In this study, we generated dicentric chromosomes in the male germ-line using chromosomes that are not essential for via-bility. We show that dicentric chromosomes can break in mitosis and that the chromosome fragments can be transmitted to progeny. Although the broken chromo-somes were propagated in strains where the genes that were lost have no effect on viability, we observed that some broken chromosomes had persisting lethal effects.

M AT E R I A L S A N D M E T H O D S

Mutations and chromosomes not described here are de-scribed by Lindsley and Zimm (1992). Abbreviated names for

certain chromosomes are listed in Table 1. All flies were raised at 258 on standard cornmeal medium.

P element lines: Transformation of flies with each P ele-ment construct was carried out by standard procedures (Rubin

and Spradling 1982), and additional insertion lines of these

constructs were collected by mobilization with P transposase from the insertion P[D2-3, ry1](99B) (Robertson et al.

1988). New insertions were mapped by segregation from dominant markers. P element lines are designated by num-bers or letters; these do not indicate insertion sites. The inser-tions used here are listed in Table 1.

Figure 1.—FLP-mediated unequal sister-chromatid

(3)

Broken Chromosomes in Drosophila 777

The FLP construct P[ry1, hsFLP] has been described by

Golic and Lindquist (1989). The construct P[ry1, 70FLP] is

a similar heat-inducible FLP gene but is inducible to higher levels than P[ry1, hsFLP] with the same heat-shock (Golic et al. 1997).

pP[RS5] carries two FRTs in direct relative orientation and

a whs selectable marker (K. G. Golic and M. M. Golic 1996). P[RS5]1B is a single recessive lethal insertion of this element

on chromosome 4 at 102C2-5. All other insertion lines of

P[RS5] described here were transposase-induced

mobiliza-tions from P[RS5]1B.

Construction and identification of chromosomes bearing inverted-orientation FRTs: Duplications of a whs-bearing P

el-ement can be recovered by screening for darker eye colors

af-ter mobilization with P transposase (Golic 1994). An

inser-tion of the FRT-bearing P element P[RS5] on chromsome 4 was mobilized and the two-copy insertion line P[RS5]23 was identified as carrying inverted P elements. To provide an-other marker for crosses, a small duplication of the X chromo-some (Dp(1;4)193, y1) on the left arm of chromosome 4 was crossed onto the P[RS5]23 chromosome. Females heterozy-gous for P[RS5]23 and Dp(1;4)193, y1? spapol were heat-treated

to induce recombination on chromosome 4 (Grell 1971),

and a chromosome 4 carrying y1 on 4L with P[RS5]23 and

spa1 on 4R was recovered (Figure 2). This chromosome is listed as y1?DcIV in Table 1. The designation DcIV is intended

to indicate that the chromosome carries the inverted FRT-bearing elements that are required to form a dicentric

chro-TABLE 1

Abbreviations used in this work

Designation Insertion site Genotype

hsFLP2B 2 P[ry1 hsFLP]2B

70FLP3A 2 P[ry1 70FLP]3A

70FLP4A 3 P[ry1 70FLP]4A

P[RS5]1B 4 (102C1-C5) P[RS5]1B

P[RS5]23 4 (102C1-C5)a P[RS5]23

RS5W1 Dp(Y;4) (102D-E) Dp(4;Y)E ciV gvl1 ey1 P[RS5]W1 sv1 spaCat

y1?DcIV Dp(1;4) (102C1-C5)a Dp(1;4)193 y1?ci1 gvl1 ey1 P[RS5]23 sv1 spa1

DcYb Dp(Y;4) (102D-E)a Dp(4;Y)E ciV gvl1 ey1 P[RS5]ZY2 sv1 spaCat

X?DcYLb DP(1;Y;4) (102D-E)a C(1;YL)d7 ciV gvl1 ey1 P[RS5]ZY2 sv1 spaCat

C(1;Y) XYL?YS y2 su(wa) wa

C(4) C(4)RM spapol

a This chromosome carries two insertions of P[RS5].

b In many experiments we tested the presence of chromosome 4 markers on this chromosome by crossing to

flies carrying regular fourth chromosomes marked with ci gvl eyR svn. The ci marker could not be reliably scored

in these crosses and was ignored.

Figure 2.—P[RS5] and

the Dc chromosomes. (A) Structure of the inverted

P-element duplication

in-serted in a chromosome. The arrangement of inser-tions on DcY and X?DcYL is

shown; their orientation on y1?DcIV is unknown.

The line beneath the con-struct indicates the tran-script of the whs gene (open

boxes). Only the first in-tron of whs, which contains

an FRT sequence (half-arrows), is indicated. The second FRT is downstream of the gene. Triangles indi-cate the P-element inverted terminal repeats. (B) Struc-tures of the Dc chromo-somes. The sites of the

P[RS5] insertions are

(4)

mosome upon FLP induction. The y1 gene of the duplication variegates.

To construct a Y chromosome that carried inverted FRT-bearing P-element insertions, we used Dp(4;Y)E spaCat as a Y

chromosome with euchromatic sequences attached, into which P elements may insert. [This chromosome is probably the same as Dp(4;Y) in Muller and Edmundson (1957) and Lindsley and Zimm (1992). It carries most of chromosome 4

appended at the tip of YL.] The ci1 marker on this chromo-some does not complement recessive ci alleles on regular fourth chromosomes and is hereafter ignored. An insertion of P[RS5] was recovered on the chromosome Dp(4;Y)E spaCat

by crossing y w/Dp(4;Y)E spaCat; Sb P[D2-3 ry1](99B)/1; P[RS5]1B/1 males to w1118 virgins and recovering Sb1 male progeny with eye colors distinct from that of P[RS5]. These males were crossed to w1118 virgins to test for sex linkage. One

line (P[RS5]W1) out of 98 tested was identified as an inser-tion on Dp(4;Y)E, spaCat. This insertion exhibits variegated

ex-pression of whs.

The insertion P[RS5]W1 was mobilized by P[D2-3, ry1] (99B) and flies with darker eyes were recovered. Genomic DNA from each line was screened by PCR with the Pfoot primer (Table 2) to identify lines with two close insertions, and rescreened with either the primer Pout59 or the primer Pout39 to identify insertions in inverted relative orientation. The line P[RS5]ZY2 had two P elements 0.7 kb apart with ad-jacent 39 ends, and is referred to as DcY (Figure 2).

DcY was used to generate an X-Y rearrangement that

placed the P[RS5]ZY2 double insertion on the right arm of the X chromosome. w1118/DcY males were X-irradiated with

800 rads in a Torrex 120D machine and brooded with w1118

virgins daily. Progeny from the broods of days six through nine were screened for w1 females and seven such females were retested for linkage of whs to the X chromosome. The

line d7 was identified as an X-Y exchange that placed YL (and the chromosome 4 duplication) as a right arm of the X. The structure of this chromosome was confirmed by mitotic cytol-ogy. We refer to this chromosome as X?DcYL. The y1?DcIV, DcY

and X?DcYL chromosomes are diagrammed in Figure 2.

Broken chromosome lines: We established lines from nu-merous male progeny carrying derivatives of the DcY, X?DcYL,

and y1?DcIV chromosomes. Only those derivatives of DcY that

carried all the Y fertility factors were propagated, because they were maintained in males as the only Y chromosome. Chromosomes derived from X?DcYL were recovered in males

that also had a Y chromosome (alleviating the requirement

for the Y fertility factors of the fragment chromosome) and were balanced with C(1)DX.

Chromosomes derived from y1?DcIV could not be

bal-anced by standard procedures. These chromosomes were re-covered in males that also carried a C(4)RM, spapol

chromo-some and were crossed to females carrying this compound chromosome to expand lines. We attempted to balance the derivative chromosomes by crossing in a chromosome 4 marked with ciD. However, progeny that carried the derivative

chromosome and ciD proved to also carry C(4), and a balanced

stock could not be established. These crosses indicated that the lines were accumulating additional copies of chromo-some 4, which is not uncommon in stocks that carry muta-tions on chromosome 4. Because of the multiple fourth chro-mosomes segregating in these lines, we used the pch1 marker on Dp(1;4)193 to select for the chromosome. pch2 males do

not survive unless they carry Dp(1;4)193 (on the chromosome derived from y1?DcIV). The duplication does not rescue

via-bility in pch2 females, presumably because the pch1 gene on the duplication variegates.

PCR amplification from Drosophila genomic DNA: Ge-nomic DNA was prepared from adults as described by H. Steller (personal communication) or by W. R. Engels

(per-sonal communication) for PCR tests. The primers used in these tests are listed in Table 2 and were used in the following combinations: PE5 1 BSF1; BSF2 1 w7703D; w7926U 1 PE3; and Pout391 Pout39. The four amplified products span the FLP-excised derivative of P[RS5] and the interval between them in DcY. The distance between P elements in the y1?DcIV

chromosome was too great for PCR amplification; thus the test between the P elements could not be performed. All samples of genomic DNA were tested with the primer pair w11678U/w10683D, which amplifies a 1-kb product from the endogenous white gene, to confirm that they contained ampli-fiable DNA.

P transposase-induced terminal deficiencies: To generate a terminal deficiency on chromosome 4, we crossed Sb P[D2-3,

ry1](99B)/1; P[RS5]1B/1 males to y w; Dp(1;4)193, y1?spapol

virgins and screened the progeny for Sb1 spa flies. To gener-ate a terminal deficiency on the Dp(4;Y)E, spaCat chromosome,

males of genotype w1118/DcY; TMS, Sb P[D2-3,ry1](99B)/1; ci gvl eyR svn were individually crossed to w1118; ci gvl eyR svn virgins

and Sb1 sv males were recovered.

Cytology: Larvae carrying DcY, X?DcYL or their derivative

chromosomes were identified by their sex. Larvae carrying

y1?DcIV or its derivative chromosomes were identified by

scor-TABLE 2

Primers used for PCR amplification

Name Sequence (59–39)

Pfoot CGACGGACCACCTTATGTTA

Pout59 ACGTGCACTGAATTTAAGTGTATA

Pout39 TCGCACTTATTGCAAGCATACGT

PE5 GATAGCCGAAGCTTACCGAAGT

PE3 AGACATCCACTTAACGTATGCT

BSF1 GAGAAAGGATCCAAGCATGCTGCGACGTGAACAGTGAGCTGTA

BSF2 GTTAGAGGATCCCCGCATGCAGCTCGTTACAGTCCGGTGCGTTTTTGGT

w7703D GGAGCTATTAATTCGCGGAGGCA

w7926U ATAGCGAGCACAGCTACCAG

w10683D GGGCTAGATTTATGCACAGAC

(5)

ing the yellow phenotype of the ventral cuticle belts. Salivary gland polytene chromosomes were prepared as described by

Lefevre (1976). Polytene chromosome in situ hybridization

(Pardue 1986) was performed using the GENIUS system

(Boehringer Mannheim, Indianapolis, IN). We used the chro-mosome 4 maps of Sorsa (1988) to identify bands on the

chromosome. The plasmid pP[RS5] was used as probe for the

P-element insertions. Their locations are listed in Table 1.

The plasmid pHeT-A/FR3 (Young et al. 1983) was used as a

probe for HeT-A sequences and was a gift from M. L. Pardue.

Chromosomes were examined with brightfield and phase contrast optics.

Metaphase chromosomes were prepared as described by

Gatti and Pimpinelli (1983). Chromosomes were stained

with 0.5 mg/ml 4,6-diamidine-29-phenylindole dihydrochlo-ride (Boehringer Mannheim) in PBS and observed by epiflu-orescence with UV excitation. A Ziess (Thornwood, NY) Ax-ioplan microscope, 100X Plan-NEOFLUAR objective, and FT 510, LP 520 filter set were used. Video image capture and pro-cessing was performed as described in Golic (1994).

Heat-shock regimens: To induce FLP expression in most cells of the male germline, males must be heat-shocked early in development since the hsp70 promoter of the FLP gene is efficiently induced only in the mitotically dividing stem cells (Bonner et al. 1984; M. M. Golic and K. G. Golic 1996).

Broods of eggs from crosses were collected by transferring the parents of the cross to fresh vials every 24 hr. Each vial was heat-shocked at 388 for 1 hr in a circulating water bath as de-scribed by Golic and Lindquist (1989), 2 hr after the parents

were transferred [effectively 2–26 hr after egg-laying (AEL)]. For the visualization of dicentric chromosomes in larval neuroblast cells, larvae carrying hsFLP2B and a Dc chromo-some were heat-shocked at 388 for 1 hr and allowed to recover for 2 to 6 hr before dissection.

Crosses: For most crosses where the progeny were counted, individual males were crossed to two or three virgin females and the progeny were counted 14 and 18 days after-ward. Crosses that produced ,10 progeny were considered sterile. At least five fertile individual flies of a genotype were tested. Selected lines were examined more carefully.

Statistical analyses: Descriptive and analytical statistics were performed using StatView (Abacus Concepts, Berkeley, CA) and the P-stat program (provided by W. R. Engels)

run-ning on a Macintosh computer.

Determination of lethal phase: To determine whether off-spring with chromosome fragments died, we set up single-pair matings of males with a fragment chromosome and females from a standard tester strain. Three days after setting up the crosses, the parents from vials with progeny were collected and placed together in a bottle to avoid including females that may not have mated. Eggs were then collected for 12 hr on plates of standard cornmeal-agar medium. Eggs were counted immediately after the egg-laying period, and the eggs that remained unhatched 48 hr later (48–60 hr AEL) were counted. Newly hatched larvae were removed from the plates during this interval and transferred to vials in order to mea-sure viability between the first instar and adulthood.

R E S U LT S

Recovery of broken chromosomes

Dispensable chromosomes that form dicentrics: We constructed three chromosomes that form dicentric chromosomes by FLP-mediated sister-chromatid fusion (Figure 2). Two of the chromosomes are entirely dis-pensable in somatic cells. The DcY chromosome consists

of a normal Y chromosome with a duplication of most of chromosome 4 appended to the tip of the YL arm. The chromosome 4 segment carries two copies of the P element P[RS5] in an inverted relative orientation, at which sister-chromatid fusion can occur. The y1?DcIV chromosome carries a duplication of the tip of the X chromosome, including the y1 gene, on the left arm. Inverted repeats of P[RS5] are carried on the right arm, in chromosome 4 material. Flies with fewer than two copies of 4 material have reduced viability, but when y1?DcIV is a supernumerary chromosome its loss has little effect. The X?DcYL chromosome carries the YL arm and chromosome 4 segment of DcY translo-cated onto the right arm of the X chromosome. The arm that undergoes sister-chromatid fusion is dispens-able; the other arm, the X chromosome, is not.

Dicentric chromosomes in larval neuroblasts: The gen-eration of dicentric chromosomes with DcY was demon-strated in neuroblast anaphase figures after hsFLP2B induction (Figure 3). A bridge of chromatin that spans the anaphase poles is seen. The efficiency of FLP-medi-ated dicentric formation is very high: approximately 70% of anaphase spreads from larvae with hsFLP2B and DcY contained a dicentric bridge (120 nuclei with bridges/ 166 nuclei). [Dicentric formation could not be scored in metaphase spreads as was previously done (Golic 1994) because the acentric portion generated from DcY includes only the tip of chromosome 4 and is very small; it cannot be seen in these spreads.] The frequency of dicentric chromosome formation is probably higher with 70FLP3A, which produces more FLP after heat-shock. X?DcYL should have a similar frequency of di-centric formation, because the arm that undergoes sis-ter-chromatid fusion is the same as in DcY, and does have a qualitatively similar frequency of dicentric bridges in larval neuroblasts (not shown). With y1?DcIV we could not quantitate the frequency of dicentric forma-tion because the small size of this chromosome

pre-Figure 3.—Anaphase bridges in mitotic neuroblast cells.

(6)

cludes the recognition of either the dicentric or acen-tric portions.

Many of the chromosome spreads that had bridges stretched between two poles of division also had con-densed chromosomes at the poles, indicating that the chromosomes had just moved to the poles (Figure 3b). Occasionally, spreads were seen where a bridge of DNA was stretched between two nuclei with decondensed DNA, suggesting that the bridge remained stretched between daughter cells (Figure 3d). Other spreads ap-peared to contain broken bridges (Figure 3c). In fixed and squashed preparations it is not possible to deter-mine with certainty the fate of a dicentric chromosome: we cannot tell whether an anaphase bridge would have broken, nor can we be sure that what appear to be bro-ken bridges were not brobro-ken during preparation. We used genetic tests to make these determinations.

Dicentrics in the male germline: The markers present on the dispensable chromosomes were used to monitor their fates after the induction of FLP synthesis. In our experiments heat-shock was used to induce the 70FLP gene, and in the male germline this induction is lim-ited to the mitotically dividing stem cells (Bonner et al. 1984; M. M. Golic and K. G. Golic 1996). The FRT-bearing insertions on DcY and X?DcYL are inserted be-tween the chromosome 4 markers eyeless1 (ey1) and shaven1 (sv1). An FLP-mediated dicentric of this chro-mosome will lose the sv1 marker to the acentric por-tion (Figure 4). Loss of the acentric can be detected by uncovering recessive sv allele on the regular fourth chromosomes. The insertions on y1?DcIV lie slightly

more proximal, between the grooveless1 (gvl1) and ey1 markers. The sparkling1 (spa1) gene is distal to the in-sertions, and loss of the acentric produced after dicen-tric formation with this chromosome can be detected by uncovering a recessive spapol allele on the other fourth

chromosome.

Fragments recovered from DcY: The fate of a dicentric DcY chromosome in X/DcY males was assayed by heat-shocking males that carried 70FLP3A and also were ho-mozygous for the chromosome 4 marker svn, and then

test-crossing them to svn females. Offspring from this

cross are sv1 only if they inherit the intact DcY chromo-some. The progeny of the heat-shocked males included 276 shaven sons (Table 3A). All of the sons from 3 of the 71 fertile heat-shocked males were shaven; this likely indicates that dicentric chromosomes were formed in all the stem cells of those 3 males. Overall, approxi-mately 10% of the sons from these crosses lacked the sv1 marker of DcY. Many retained more proximal mark-ers of the DcY chromosome (described in a subsequent section). We conclude that these sons carry a broken fragment of DcY. We abbreviate fragment chromosomes derived from a dicentric chromosome as Fr chromo-somes; in these cases, FrY.

In this experiment heat-shocked males produced 27% fewer sons bearing an intact DcY than males that were not heat-shocked. This reduction must also be a result of dicentric chromosome formation. Only one-third of this reduction can be accounted for by trans-mitted fragment chromosomes, implying that two-thirds of germline cells with dicentric chromosomes do not

Figure 4.—Possible

fates of a DcY dicentric bridge in mitosis. A dicen-tric chromosome that is stretched between the poles of mitotic division may do the following: (1) break and deliver a broken fragment chromosome to each daugh-ter cell; (2) stretch between the daughter cells and per-haps block their further di-vision and differentiation; (3) segregate to one pole, delivering the entire dicen-tric chromosome to one daughter cell; or (4) be lost from both daughter cells. The third and fourth fates both result in cells that have lost the entire DcY chro-mosome. The markers on

DcY that distinguish

be-tween these fates are indi-cated. The presence of YS in cells was identified by suppression of a variegating

whs insertion, as described

(7)

give rise to viable Y-bearing offspring. The loss of Y-bear-ing offsprY-bear-ing must occur postmeiotically. If cells with a dicentric chromosome were eliminated premeiotically there would be an equal loss of X- and Y-bearing off-spring. Instead there is a deficit of Y-bearing offoff-spring.

Since DcY carries fertility factors required in primary spermatocytes, cells that lack substantial portions, or all, of DcY are unlikely to complete spermatogenesis. These events will not be detected with X/DcY males. Thus, the frequency of dicentric formation derived from the reduced recovery of DcY is probably an under-estimate, because many dicentric chromosomes may re-sult in cellular sterility, eliminating X- and Y-bearing ga-metes equally. To obtain a more accurate estimate of the frequency of dicentric chromosome formation, we also generated dicentrics with DcY in males carrying C(1;Y) so that the Y fertility factors of DcY were not re-quired for fertility. Transmission of DcY was measured by the production of sv1 sons. There was a 48% reduc-tion in the transmission of the intact DcY chromosome from heat-shocked males relative to the controls that lacked 70FLP, indicating that at least half of the germ-line cells in these animals have formed dicentrics (Ta-ble 3B). A corresponding number of shaven male prog-eny were recovered. Some of the shaven males recovered here retained more proximal markers from DcY and must therefore carry a FrY chromosome. Unlike the previous experiment with X/DcY fathers, in the experi-ment with C(1;Y)/DcY fathers, postmeiotic loss of Y-bear-ing progeny was not observed. Subsequent experiments

will show that a portion of the fragment chromosomes exhibit dominant semilethality. The recovered fragment chromosomes that are broken within Y chromatin do not have this property. The majority of the FrY chromo-somes that are broken distal to Y chromatin (within the appended chromosome 4) do exhibit this semilethality. Because the Y chromatin is needed for fertility in X/DcY males, there is a selective elimination of the fragments with breaks in Y chromatin in their germlines. We be-lieve this accounts for the disparity: in X/DcY males most of the cells with nonlethal fragment chromosomes are eliminated in spermatogenesis, while the cells with semilethal fragment chromosomes produce an increased proportion of the functional gametes. In C(1;Y)/DcY males it is likely that semilethal fragments are also pro-duced, but that they constitute a much smaller percent-age of all FrY-bearing gametes and do not result in an obvious loss of Y-bearing progeny.

Many of the shaven sons of C(1;Y)/DcY males lacked all of the markers of the chromosome 4 duplication. These males may carry shorter FrY chromosomes or no FrY at all. To distinguish between shaven males that carried a fragment chromosome and those with no Y chromosome, we assayed for the suppressive effect of Y chromosome material on position-effect variegation. We crossed C(1;Y)/DcY males that carried 70FLP3A to females that were homozygous for the variegating P-ele-ment insertion P[.whs.]ZQa. This line carries two

P elements at 84D-E of chromosome 3 that variegate for eye color because of a position effect on their white

TABLE 3

Production of chromosome fragments from DcY and X?DcYL males after FLP induction

Male parent

Copies of

FLP HS N

Sterile (%)

Offspring Transmission (%)

Average Females sv1 Males sv Males Dc Fr

A. X/DcY 1 2 54 3 (6) 89.4 2293a 2268 0 100 0

1 1 95 25 (26) 92.8 3621 2695 276b 73 8

B. C(1;Y)/DcY 0 1 20 3 (15) 92.1 621 940 4c 99 1

1 1 37 7 (19) 125.6 1448 1181 1140d 52 48

C. X?DcYL/Y 1 2 17 5 (29) 52.2 281 345 0 100 0

1 1 57 8 (14) 84.6 1876 1319 950e 55 41

The crosses were as follows:

A. w1118/DcY; 70FLP3A/2; ci svn/ci gvl eyR svnF x w1118; ci gvl eyR svn!!;

B. C(1;Y)/DcY; ci svn/ci gvl eyR svnF x w1118; ci gvl eyR svn!! (without FLP) and C(1;Y)/DcY; 70FLP3A/2; ci

svn/ci gvl eyR svnF x w1118; ci gvl eyR svn!! (with FLP);

C. X?DcYL/Y; 70FLP3A/2; ci svn/ci gvl eyR svnF x C(1)DX, y f/Y; ci gvl eyR svn!!.

Transmission rates for Dc and Fr chromosomes were calculated as ratios of sv1 or sv males to female progeny, respectively, which were then normalized to the ratio of total males:females in the control crosses. The values given are the unweighted means of individual male values, and therefore differ slightly from the values that would be calculated from the progeny totals given here. N, number of males crossed; average is the mean num-ber of progeny produced from fertile males.

a 5 w1 female progeny were also observed.

b These offspring are derived from at least 50 independent events (from separate males or carrying different

markers from the same male).

c These offspring are derived from 4 independent events.

(8)

genes (Ahmad and Golic 1996). X0 males have white eyes with occasional red spots. Variegation in this line is suppressed by addition of a Y, so that XY males have eyes that are mostly red. Flies with YS only are a pale yellow color with red spots, but can still be distin-guished from flies lacking any Y material. Therefore, this line provides a suitable test for distinguishing be-tween flies that carry DcY, fragments of DcY, or flies that lack DcY entirely. By crossing C(1;Y)/DcY males to the ZQa-bearing females and evaluating variegation in sons, we found that chromosome loss was very rare following dicentric formation in germline cells of these males (Table 4). We conclude that most of the shaven male progeny from C(1;Y)/DcY males carry FrY chromosomes. Those that lack any Y are probably the result of occa-sional nondisjunction.

It is clear that dicentric chromosomes can be made at high frequencies in the male germline and they of-ten break. However, one of the possible fates of a dicen-tric chromosome in mitosis—where daughter cells are tied together by an unbroken anaphase bridge—can-not be identified with these tests. If this occurred in the male germline we expect that cell proliferation would be blocked and reduce the production of gametes from such males. Induction of FLP in the X/DcY genotype in fact did sterilize 20% of the males, and we considered that this might result if all germline stem cells in these males had formed dicentric bridges that did not break. Alternatively, these germline cells may have lost one or more fertility factors after dicentric breakage. To deter-mine whether the observed male sterility resulted from loss of Y fertility factors or from stretched bridges be-tween cells, we generated males that carried DcY and a C(1;Y) that carried all of the Y fertility factors and tested their fertility after FLP induction. We used three copies of 70FLP to increase the frequency of dicentric formation. When FLP was induced, 68% of the X/DcY males were sterile—almost a fourfold increase relative to noninduced males. However, in males with C(1;Y), the induction of FLP caused no increase in sterility (Ta-ble 5). We conclude that sterility in the X/DcY geno-type results from the loss of fertility factors on DcY after dicentric chromosome breakage. While we cannot ab-solutely rule out a low frequency of bridges that stretch

but do not break, our results can be sufficiently ex-plained by assuming that dicentric bridges break.

Fragments from X?DcYL: The Y fertility factors of X?DcYL are not required for fertility in X?DcYL/Y males, and offspring carrying fragments of X?DcYL (X?FrYL chromosomes) can be detected by the pres-ence of the X portion and loss of sv1. When heat-shocked males were mated to attached-X females, 41% of X?YL-bearing gametes were recovered as shaven male progeny (Table 3C). These males must carry an X?FrYL chromosome. There was equal transmission of the X?YL chromosome (X?DcYL and X?FrYL) and its ho-molog. This confirms our observations with DcY: dicen-tric chromosomes can break in mitotic divisions and the centric fragments can be transmitted.

The frequency of dicentric formation: The recovery of 48 and 41% fragment chromosome-bearing males implies that almost half of all viable germline cells had experi-enced dicentric chromosome formation and breakage with the DcY and X?DcYL chromosomes. Another esti-mate of the frequency of dicentric formation can be made from the number of male parents that transmit only the broken forms of Dc chromosomes. Four per-cent of fertile X/DcY males transmitted only FrY and X chromosomes: in every stem cell of these males the DcY chromosome must have undergone dicentric forma-tion. Assuming that there are roughly 10–16 germline stem cells in each male (Lindsley and Tokuyasu 1980),

TABLE 4

DcY chromosome loss test from C(1;Y)/DcY males

Male parent

Copies of

FLP HS n Sterile

Offspring Transmission (%)

Females XY Males X0 Males Y 0

C(1;Y)/DcY 1 2 34 6 718 2388 0 100 0

1 1 26 3 535 1644 5 92 0.2

The cross was C(1;Y)DcY; 70FLP3A/2; ci svn/ci gvl eyR svnF x w1118; P[. whs .]ZQa !!. Transmission

fre-quencies for DcY and 0 were calculated as XY F:! and X0 F:!, respectively, which were then normalized to the

F:! ratio in the control cross. The frequency of X0 sons from heat-shocked parent males with these sex chro-mosomes but without 70FLP is reported in line 3 of Table 3.

TABLE 5

Male sterility after DcY dicentric formation

Genotype HS Fertile Sterile P

X/DcY 2 30 7

1 8 17 ,0.0001

C(1;Y)/DcY 2 23 7

1 20 10 0.39

Males homozygous for 70FLP3A and heterozygous for

70FLP4A and carrying the specified sex chromosomes were

heat-shocked, and each male was mated to two w1118 virgins. A

(9)

and that they are equally likely to undergo dicentric for-mation, the frequency of dicentric formation per cell (x) can be estimated by solving the equations 0.04 5 (x)10 and 0.04 5 (x)16. Thus, in X/DcY males the

fre-quency of dicentric formation is between 72 and 82%. This calculation can also be performed with the C(1;Y)/ DcY and X?DcYL/Y genotypes: 11 of 30 fertile C(1;Y)/ DcY males transmitted only fragment chromosomes; the estimated frequency of dicentric formation in this gen-otype is between 90 and 94%. Nine of 49 X?DcYL/Y males produced only fragment chromosomes, for a fre-quency between 84 and 90%. Thus, the frefre-quency of di-centric formation with these chromosomes in the male germline is at least 41%, and probably 70–90%. This high frequency allows us to easily determine the conse-quences of dicentric formation in germline mitotic di-visions and to produce many isolates of chromosome fragments.

Dicentric formation with y1?DcIV: Because structural dif-ferences between centromeres can affect the behavior of a dicentric chromosome in female meiosis (Novitski 1952), we thought it worthwhile to examine the fate of dicentric chromosomes that carried a normal cen-tromere. Chromosome 4 can exist as a dispensable su-pernumerary chromosome and is suitable for such ex-periments.

We identified chromosome 4 lines that carried in-verted repeats of P[RS5] by heat-shocking and mating males that carried hsFLP2B and a chromosome 4 with two copies of the element. We looked for loss of distal markers as an indicator of the formation and breakage of dicentric fourth chromosomes. In these crosses we followed the sparkling1 (spa1) gene as a marker for the

distal part of chromosome 4. Males from 6 of the 12 lines examined produced some sparkling progeny when FLP was induced, indicating that the insertions in each of these lines are inverted with respect to one another, that dicentric chromosomes were produced, and that the tip of the chromosome was lost. The insertion line 23 was chosen for further characterization; the P elements in this line are inserted at 102C2-C5 of the right arm.

Because there is a paucity of useful markers on chro-mosome 4, we generated a modified chrochro-mosome 4, based on the double insertion line 23, that could be fol-lowed through dicentric formation and mitosis. To pro-vide a marker with which to follow inheritance of this chromosome, a duplication of the tip of the X chromo-some, including the y1 gene, was recombined onto the left arm of chromosome 4, generating the chromo-some y1?DcIV (Figure 2). This duplication is very small and adds very little chromatin to chromosome 4. There-fore, we expect that the strength of the chromosome 4 centromere should not be altered by this duplication.

When flies that carry y1?DcIV chromosome are crossed to C(4)/C(4) flies, the y1?DcIV chromosome is dispensable in the progeny. We assayed the conse-quences of dicentric formation in the male germline with this chromosome, as we had with DcY and X?DcYL. Broken fragment chromosomes (y1?FrIV chromo-somes) were produced (recognized as yellow1 spar-kling progeny); chromosome loss (yellow sparspar-kling progeny) was not observed (Table 6). There was also a 9% reduction in the recovery of the y1?DcIV chromo-some. With two copies of 70FLP there was a further re-duction in the recovery of y1?DcIV (from 91 to 71%), and there was an increase in the number of progeny

TABLE 6

Production of chromosome fragments from y1?DcIV males after FLP induction

Male parent

Copies of

FLP HS N

Sterile (%)

Offspring

y1 y Transmission (%)

Average spa1 spa spa1 spa DcIV FrIV

A. y1?DcIV/4 1 2 50 5 (10) 136.0 3007 0 3112 0 100 0

1 1 141 6 (4) 123.5 7738 126b 8814 0 91 2

2a 1 28 0 (0) 119.6 1343 58c 1949 0 71 4

B. y1?DcIV/C(4) 1 2 43 3 (7) 134.4 2829 0 2546 1d 100 0

1 1 42 5 (12) 140.4 2143 58e 2995 0 62 2

The crosses were as follows:

A. y w/Y; 70FLP3A/2; y1?DcIV/4 F x y w; C(4)RM, spapol!!;

B. y w/Y; 70FLP3A/2; y1?DcIV/C(4)RM ci eyRF x y w; C(4)RM spapol !!.

Transmission rates of y1?DcIV and y1? FrIV were calculated as the ratios of y1 spa1 progeny or y1 spa progeny, respectively, to y spa1 progeny, which were then normalized to the ratios of total y1:y progeny in the control crosses. The values given are the unweighted means of individual male values. N, number of males crossed; aver-age is the mean number of progeny produced from fertile males.

a These males were y w/Y; 70FLP3A/1; 70FLP4A/1; y1?DcIV/1.

b These offspring are derived from at least 44 independent events (from separate males). c These offspring are derived from 23 independent events.

d 2 y ci ey progeny were also observed.

(10)

with fragment chromosomes (line 3 of Table 6). How-ever, the number of y1?FrIV-bearing progeny was much less than the number of missing y1?DcIV chromosomes in both cases. This implies that there were many frag-ment chromosomes that could not be recovered. There were no males that produced only y1?FrIV chromo-somes.

It is possible that loss of chromosome 4 material de-creases the recovery of fragment chromosomes from the y1?DcIV/4 males as a consequence of the resultant germ-cell aneuploidy. We tested the fate of the chromo-some 4 dicentrics produced by FLP in males where y1?DcIV was present as a supernumerary chromosome 4. The transmission of the intact y1?DcIV decreased from 91%, when the homolog of DcIV was a normal 4, to 62%, when the homolog of DcIV was a compound chromosome 4 (Table 6). This suggests that in y1?DcIV/ 4 males many cells that made dicentrics were inviable because of chromosome 4 aneuploidy, and failed to produce any gametes. With the addition of a third copy of chromosome 4 these cells can proceed through sper-matogenesis. Thus, the cells that make functional sperm now contain a higher percentage of cells with di-centric chromosomes, and the transmission of the in-tact y1?DcIV chromosome, compared to its homolog, is reduced. There was no significant effect of dicentric formation on fertility (Table 6).

While the presence of C(4)RM increased the measur-able frequency of dicentric formation, there was no commensurate increase in the recovery of progeny car-rying y1?FrIV chromosomes. Just as with the fragments of DcY, the reduced recovery of progeny carrying the y1?FrIV chromosome must result from a postmeiotic ef-fect. The evidence provided below suggests that many y1?FrIV chromosomes are not recovered because they are lethal.

Chromosome fragments generated by P transposase:

Although broken chromosomes are very rarely recovered after irradiation of normal males or females (Muller and Herskowitz 1954; Mason et al. 1997), such chro-mosomes are recovered more frequently after irradia-tion of mu2 females (Mason et al. 1984), or after P-ele-ment mobilization (Levis 1989). This suggests that the method by which a chromosome is broken might influ-ence the consequinflu-ences of that break. To compare the behavior of chromosome fragments generated by break-age of a dicentric chromosome with that of fragments produced by transposase, we induced terminal deficien-cies with P transposase on DcY and on the P[RS5]1B chromosome 4. These were identified by loss of the dis-tal portion of the chromosome. Transposase-induced fragments of DcY, called FrYD chromosomes, occurred at frequency of 0.26 events/fertile parent (12 indepen-dent events found from 46 transposase-bearing male parents). A line was established from each FrYD -bear-ing male. Other exceptional males were observed: one that was gvl1 ey sv1; two that were gvl ey sv1 and

re-tained the whs P element; and a fourth that was gvl ey sv.

These were sterile and were probably instances where interstitial portions of the chromosome had been de-leted (see Engels and Preston 1984).

Fragments of chromosome 4, called FrIVD, were re-covered at the lower frequency of 0.02 events/fertile parent (5 independent events from 270 male parents). Four of the spa male progeny were crossed to y w; C(4)RM, spapol virgins. Two were sterile and the third

transmitted only the homolog to progeny. The fourth male was fertile and transmitted a chromosome derived from the P[RS5]1B chromosome. This line was named FrIVDA; it retains a copy of P[RS5] at 102C2-5 but lacks chromosome 4 material distal to 102D1-2.

FrY and FrIV chromosomes were recovered much more readily by dicentric chromosome formation than by transposase. FrY chromosomes were produced ap-proximately three times more frequently after dicentric formation than after exposure to transposase, and FrIV chromosomes were recovered 16 times more frequently.

Characterization of broken chromosomes

Dominant semilethality characterizes some fragment chromosomes: The recovery of fragment chromo-somes from dicentric chromochromo-somes demonstrates that a chromosome broken in this way can be viable. How-ever, the overall deficit of Dc chromosomes suggests that some Fr-bearing gametes or zygotes are inviable. This effect was especially pronounced with y1?DcIV, where in one experiment 95% of the fragment chro-mosomes were not recovered (Table 6, line 5). This hy-pothesis is strongly supported by our observations (be-low) that many of the recovered fragments exhibit a dominant semilethality.

Transmission of Y chromosome fragments: FLP synthesis was induced in X/DcY males, those males were mated, and lines of independently generated FrY chromo-somes were established for further characterization. Two groups of FrY lines are apparent (Figure 5). In the first group, which includes the DcY control and four FrY lines, the Y was transmitted at a normal rate. The second group, with ten FrY lines, exhibited a great re-duction in the rate of FrY transmission, which is ob-served as a reduction in male progeny from an X/FrY father. Many of these low-transmission lines also showed sterility of some males (the y-axis of Figure 5). Males from a given line showed variability in their transmission ra-tios, but this variability was not heritable (not shown).

(11)

males from the FrY1A line showed a significant level of embryonic lethality; this lethality can account for two-thirds of the total reduction in fragment-bearing prog-eny (Table 7).

Fragment chromosomes of DcY that were generated by P transposase could also be divided into two groups by their rates of transmission: three lines were transmit-ted at a normal rate, and one line (FrYD14A) showed low transmission similar to that of low-transmission FrY lines (Figure 5).

We measured the transmission from 12 X?FrYL lines (Figure 5). Two showed decreased transmission of the X?FrYL chromosome (X?FrYLd26e and X?FrYLd34r).

Transmission of chromosome 4 fragments: The transmis-sion of FrIV chromosomes and of fourth chromosomes from three control genotypes was assayed. For controls,

we tested the intact chromosome y1?DcIV, the chromo-some Dp(1;4)193, y1?spapol (from which the y1

duplica-tion on y1?DcIV was derived), and the chromosome Df(4)G. Df(4)G chromosome was assayed because it is a deficiency of all chromosome 4 material distal to 102E2-10, and therefore lacks a region similar to that missing from the y1?FrIV chromosomes. It is capped with the tip of the X chromosome. All three control chromosomes were transmitted at the same rate as their homologs [either a normal 4 marked with ciD or

C(4); Figure 5]. We measured transmission of y1?FrIV chromosomes from males heterozygous for C(4). Most lines exhibited reduced transmission of y1?FrIV, with transmission ratios ranging from 0.01 to 0.86 relative to the C(4) homolog (Figure 5). Egg-to-adult counts with the low-transmission y1?FrIVC72 line showed that its re-duced transmission could be entirely accounted for by embryonic lethality (Table 7).

Males that carried the transposase-induced fragment chromosome FrIVDA transmitted it at a ratio compara-ble to the controls. There was no reduced transmission of FrIVDA, although it is associated with sterility when heterozygous with ciD (Figure 5). Males that carried

FrIVDA and C(4) were usually fertile (not shown), sug-gesting that the sterility of FrIVDA/ciD males is caused

by aneuploidy.

At least some of the reduced transmission of the y1?FrIV chromosome is caused by the accumulation of additional copies of chromosome 4 in the lines carry-ing y1?FrIV (materials and methods). Both viability and meiotic segregation of fourth chromosomes are af-fected by this aneuploidy (Grell 1972, cited in Ash-burner 1989). However, this cannot account for the re-duced transmission of y1?FrIV chromosomes from males with newly induced dicentrics, because these par-ents had not accumulated additional fourth chromo-somes (Table 6). Zygotic lethality of the fragment chro-mosome likely accounts for the reduced recovery from the original parents as well as a portion of the reduced transmission in further crosses.

We conclude that some fragment chromosomes gen-erated from DcY, X?DcYL, and y1?DcIV share a similar defect that causes embryonic lethality and leads to re-duced transmission of the fragment chromosome. The similar behavior of these chromosomes must be due to their common feature: the broken chromosome end.

Structure of fragment chromosomes: Muller found that many chromosomes with apparently terminal defi-ciencies were in fact more complex rearrangements that maintained a telomere at the end. In order to de-termine whether the fragment chromosomes that we generated by dicentric breakage had been involved in further rearrangements, and in the hope of providing insight into the nature of the semilethal fragments, we characterized the structure of the recovered Fr chromo-somes with genetical and cytological assays. [The de-tailed results are presented in Ahmad (1997).]

Figure 5.—Lethal and sterile effects of fragment

(12)

Genetic structure of the recovered chromosome fragments: In some of the crosses where dicentrics were made with DcY or X?DcYL, flies also were homozygous for a chro-mosome 4 marked with gvl eyR svn. In these cases,

mark-ers both proximal and distal to the site of the FRT in-sertions also could be assayed in progeny. In other

cases, the positions of breakpoints were mapped in fur-ther crosses. Fragments of X?DcYL were also character-ized with respect to whether they carried all the male fertility factors of YL. Many fragment chromosomes were missing proximal markers (Figure 6). In no case was a distal marker retained while a more proximal one

TABLE 7

Viability of zygotes with fragment chromosomes

Paternal genotype

Eggs Adults

Total Unhatched Unhatched (%) ! F F loss

X/DcYa 713 15 2 1257 1195 2

X/FrY1A 752 118 16 3483 1580 27

Paternal genotype

Eggs Adults

Total Unhatched Unhatched (%) y y1 y1 loss

y1?DcIV/C(4) 2026 46 2 1899 1902 0

y1?FrIVC72/C(4) 3326 626 19 650 413 18

Eggs were collected as described in materialsandmethods. The same set of parents was transferred to new

vials to produce more offspring, which were scored when they eclosed as adults, but egg viability counts were made only from the first brood. Male loss and y1 loss refer to the % of total progeny that are expected to appear as these genotypes as adults, but do not. Male loss was calculated as 100 3 (!2F)/(2 3!). y1 loss was calcu-lated as 100 3 (y 2 y1)/(2 3 y). Approximately 98% of first instar larvae that were collected from each of these crosses eclosed as adults (n 5 200/genotype); thus, lethality after hatching does not account significantly for the reduced numbers of Fr-bearing progeny.

a Adult progeny in this case were counted from a different set of parents than those from which embryos were

collected.

Figure 6.—Mapping of

(13)

was absent. We conclude that the site of dicentric chro-mosome breakage is not limited to a single location.

We expected that if a dicentric bridge broke asym-metrically in mitosis one daughter cell would receive a short chromosome fragment and the other would re-ceive a long fragment. When dicentric formation was induced in males carrying X?DcYL and homozygous for the gvl eyR svn chromosome 4, the recovery of progeny

lacking gvl1 and ey1 implied that asymmetric breakage of the dicentric bridge did occur, because these flies must carry short fragments. A fly with the correspond-ing long fragment should be gvl1 ey1 sv; however, there were five males that produced only grooveless eyeless shaven offspring. Similarly, there was one C(1;Y)/DcY male that produced only this kind of offspring after di-centric formation. Only the short fragment chromo-somes were recovered, although the corresponding long fragments must also have been generated. This led us to ask whether any of the fragment chromosomes that we recovered were long fragments. For both FrY and X?FrYL chromosomes, the breakpoints that were mapped distal to the ey1 gene could be located in one of two dif-ferent regions of the chromosome. An eyeless1 shaven fly might carry a short fragment broken between ey1 and the site of sister-chromatid fusion, or a long frag-ment broken anywhere along the length of the YL arm, so that the recovered chromosome is deficient for ma-terial distal to the P insertions and duplicated for some

proximal material. Such a chromosome will also carry two P-element insertions. This can be detected using PCR amplification with primers specific to the P ele-ment ends. We screened, by PCR, all FrY and X?FrYL lines with breakpoints that had been genetically mapped as distal to the ey1 marker. (The y1?FrIV chromosomes could not be analyzed in this way because the distance between the two P elements is too great.) Although we found many lines that carried one P element, no lines appeared to carry more than one P element. However, if DNA near the end of a chromosome cannot be easily amplified, perhaps because telomeric DNA is com-pacted into an unusual chromatin structure, then this result would be misleading. Therefore, we do not con-clusively rule out the possibility that some fragment chromosomes carry two P elements near the terminus. However, if any fragments do include sequences of both P elements, we imagine that the break must be close to those sequences. Cytological analyses (below) confirmed this conclusion.

Cytological structure of the recovered chromosome fragments: Polytene chromosomes of larvae from fragment chro-mosome lines were examined in order to confirm the genetic characterization. Eleven y1?FrIV chromosomes were examined: all ended at 102C1-5 (Figures 6 and 7), which is the site of sister-chromatid fusion (i.e., the lo-cation of P[RS5] elements). Nine FrY chromosomes were examined cytologically. They exhibited breaks at

vari-Figure 7.—Cytology of

fragment chromosomes. (a–h) Salivary cytology. The fragment chromosome end is indicated by an arrow. If the Fr is not paired with its normal homolog, then the same band on the regular fourth chromosomes is in-dicated by an arrowhead. (a) Normal chromosome 4. (b–d) Independently iso-lated y1?FrIV chromosomes

heterozygous with a normal chromosome 4. The frag-ments each end at 102C1-5. (e–g) Independent FrY chromosomes: (e) FrY2A (broken at 102B2-C2); (f)

FrY3F (102D2-5); (g) FrY8A

(102B2-5). (h) FrYD14A (broken at 102D2-6). (i–k) Mitotic cytology of X?FrYL

chromosomes. The frag-ment chromosome ends are indicated by arrows, the in-tact Y or X?DcYL

chromo-somes by arrowheads, and the breakpoint is indicated by a line between the two chromosomes. Lines in which the X?FrYL chromosome lacked a YL fertility factor were selected: (i)

metaphase of X?DcYL/Y. (j) X?FrYL d5d/Y, the most distal bright block on YL is missing. (k) X?FrYL d33a/X?DcYL, the most distal

(14)

ous points in the chromosome 4 material (Figure 6). X?FrYL chromosomes were examined by polytene or diploid cytology (Figure 7). These ended at differing positions, with breakpoints in euchromatin or in het-erochromatin. One X?FrYL breakpoint was located near the site of sister-chromatid fusion. There was no evidence of other rearrangements on these chromo-somes. We conclude that the recovered chromosomes have terminal deficiencies. We also confirmed by cytol-ogy that FrIVDA and four FrYD (4, 9B, 11B, 14A) frag-ment chromosomes induced by P transposase truly were terminal deficiencies. The other putative FrYD lines were not characterized.

The breakpoints of normal-transmission fragment chromosomes were found in all the genetically defined intervals along the chromosomes, and all but one of the normal-transmission fragments lacked P[RS5] se-quences. However, all low-transmission FrY, X?FrYL, and y1?FrIV chromosomes were broken near the P[RS5] ele-ments used to generate the dicentric chromosome, and retained a P[RS5] remnant near this end (Figure 6). The coincidence of the low-transmission with the pres-ence of P-element sequpres-ences near the broken end sug-gests that these sequences may play a role in determin-ing the properties of fragment chromosomes. One y1?FrIV chromosome, which we first categorized as a low-transmission line, later changed to normal-trans-mission behavior. We examined the salivary cytology of this chromosome after the change in transmission fre-quency. The chromosome ended at 102C1-5, as do the other low-transmission lines, but did not have P-element sequences (not shown). It is possible that these sequences were present on the originally isolated chromosome but were later lost, resulting in the change in behavior.

Hybridization for telomere sequences on the recovered chromo-some fragments: If a telomere is normally an essential chromosomal element, broken chromosomes should not be viable unless they have acquired a new telomere. We used in situ hybridization to examine the ends of the FrY, X?FrYL, and y1?FrIV chromosomes for the pres-ence of HeT telomeric sequpres-ences. Fourteen of the frag-ment chromosome lines showed no hybridization at the end of the Fr chromosome, although hybridization to the tips of other chromosomes and to the tip of the regular chromosome 4 was observed (Figure 8). One X?FrYL chromosome did hybridize with the HeT probe and therefore acquired HeT telomeric sequences, and one FrY chromosome also showed a slight but repeat-able hybridization signal and may also have an HeT te-lomere (Figure 8). The y1?FrIV chromosome that showed a change in behavior did not show a hybridiza-tion signal. Although in situ hybridizahybridiza-tion methods are sufficiently sensitive to detect a single copy of an HeT sequence at the end of a chromosome (Traverse and Pardue 1988), we cannot exclude the possibility that some fragment chromosomes may have truncated HeT elements that were not detected by hybridization.

D I S C U S S I O N

The fate of dicentric chromosomes in mitosis: We con-structed chromosomes that are dispensable for cell via-bility and that form dicentric chromosomes by FLP-mediated USCE. In the experiments reported here, we deduced the fate of dicentric chromosomes in mitosis by inducing FLP in males and examining their prog-eny. In the male germline the 70FLP gene that we used is only induced in the mitotically dividing stem cells (Bonner et al. 1984; M. M. Golic and K. G. Golic 1996). We estimate that dicentric formation with the DcY and X?DcYL chromosomes occurs in 70–90% of germline stem cells. It appears that the predominant fate of the dicentric chromosomes in those mitotic divisions is break-age: for example, 35% of C(1;Y)/DcY males transmitted only broken forms of DcY. Loss of the dicentric chro-mosomes in those divisions was not observed. We can-not exclude the possibility that some dicentric chromo-somes are stretched but not broken in mitosis, as the two daughter cells tied together in this way are not likely to be viable and would not produce gametes. However, this would require that mitoses with the same dicentric chromosome produce varying results.

In contrast, a dicentric X chromosome that is stretched at the reductional division in female meiosis usually does not break (Sturtevant and Beadle 1936). Novitski (1952) found that a dicentric chromosome involving X chromosomes would break when the chro-mosomes also carried part of the Y chromosome attached to the short arm. Novitski categorized a centromere as Figure 8.—Detection of HeT telomeres on fragment

chro-mosomes. Polytene normal and fragment chromosomes after hybridization with an HeT probe are shown. The tips of Fr chromosomes are indicated with arrows; arrowheads indicate normal tips. Hybridization signals are present on the regular fourth chromosomes. (a–b) DcY viewed by (a) phase-contrast and (b) brightfield optics. HeT is present on the chromo-some 4 duplication. (c–d) y1?FrIV chromosomes. No

hybrid-ization signals are present on the fragment ends. (e) FrY32D (102C-D); a weak signal is present at the tip of the fragment. (f) X?FrYL 28m (102D); a strong signal is present on the

(15)

strong or weak by whether one centromere in a dicen-tric chromosome could drag a weaker one at division. While the normal X centromere is weak, compound X-Y chromosomes have strong centromeres, and this strength is attributable to the large blocks of surround-ing heterochromatin (Lindsley and Novitski 1958). DcY and X?DcYL are similar in size and structure to the strong centromere chromosomes examined by Novitski, and their breakage in mitosis is consistent with having strong centromeres. While Novitski did not examine the strength of a chromosome 4 centromere, y1?DcIV is much shorter, has much less heterochromatin around its centromere than a normal X chromosome, and is therefore expected to be weak. However, dicentric chro-mosomes formed with y1?DcIV also frequently broke in mitosis. Breakage also seemed to be the most likely fate for dicentric chromosomes formed from a normal X chromosome in mitotic cells (Golic 1994). Our exper-iments revealed no obvious differences between the rel-ative strengths of these centromeres in mitosis. Instead of supposing that all the Dc chromosomes have strong centromeres, it seems more plausible that dicentric bridges have an inherently higher likelihood of break-age on the mitotic spindle than on a Meiosis I spindle.

Although we observed that a dicentric chromosome generated by FLP-mediated USCE is not lost in mitosis, ring-X chromosome loss can occur in the early syncytial embryo or during cellular mitoses (Zalokar et al. 1980; Bachiller and Sanchez 1991). It is thought that sister-chromatid fusion generates a dicentric chromosome, and this dicentric chromosome is lost (Hinton 1959). A ring chromosome that undergoes sister-chromatid fusion will generate a dicentric ring chromosome, with a double bridge at anaphase. Perhaps the added strength of the second bridge prevents breakage and the ring is then lost.

The fact that fragment chromosomes can be recov-ered suggests that the broken ends have been repaired by the acquisition of telomeres. However, most of the fragment chromosomes we recovered have not ac-quired HeT sequences at their termini. Broken chro-mosomes recovered by other means also do not usually acquire HeT sequences (Levis 1989; Biessmann et al. 1990). These groups have demonstrated that Drosophila does not require specific DNA sequences at chromo-some termini for viability. The fragment chromochromo-somes that we generated by dicentric breakage provide an-other example.

Broken chromosomes in Saccharomyces are mitoti-cally unstable (Sandell and Zakian 1993). With our fragment chromosomes, mitotic loss would not neces-sarily be apparent. For instance, the y1 marker on y1?FrIV chromosomes variegates, so it cannot be used as a marker for chromosome loss. The chromosome 4 marker gvl1 might be useful to visualize loss with FrY or y1?FrIV, but probably only if loss occurred very early in development. We saw no evidence that this occurred.

Very early loss of a X?FrYL chromosome in females might produce gynandromorphs, but these chromo-somes were usually kept only in males, where loss would certainly lead to cell death. It is conceivable that mi-totic loss could account for the male sterility that we ob-served with FrY chromosomes.

Muller (1941) argued that chromosomes with a sin-gle break could not be recovered after irradiation of the male germline. Subsequent experiments have dem-onstrated that such chromosomes only rarely survive (Le et al. 1995; Mason et al. 1997). Levis (1989) pro-posed that the failure to recover broken chromosome fragments was due to the elimination of fragment-bear-ing cells by a checkpoint that responds to DNA dam-age. However, fragmented chromosomes produced by breakage of dicentric chromosomes or by P-element transposase (Levis 1989) must evade this response mechanism. The mechanism of chromosome breakage may play a role in stimulation of a checkpoint response. For example, a break induced by P transposase may es-cape detection if a broken end is masked by a bound transposase complex. Additionally, the number of bro-ken ends may be crucial for adequate stimulation of a DNA damage response. Breakage of a chromosome by X rays produces two broken ends in a cell, but break-age of a dicentric chromosome in mitosis produces two daughter cells, each with a single broken chromosome end. It may be that the single broken end can escape detection.

Breakpoint distribution in fragment chromosomes:

Figure

TABLE 1
TABLE 3
TABLE 5
TABLE 6
+2

References

Related documents

Our results showed that when treated with ondansetron and [6]-gingerol in advance, the intake of kaolin of rats injected intraperitoneally with cisplatin was signi fi cantly

The program also offers 20 courses of Bachelor’s Degree in Education to students, namely Curriculum and Pedagogy, Malay Language Education, Islamic Education, TESL,

1. To analyze the land use and land cover changes occurred in Iskandar Malaysia between 1989 and 2014 using Landsat data and SVM and MLC classifres. To examine the

A collaborative study between the Universiti Teknologi Malaysia (UTM) and the Department of Survey and Mapping, Malaysia (DSMM), on the implementation of

This unique quality of HRV/HRC analyses has led to interest in its application in pre-hospital triage and emergency clinical decision making; interest which has been bol- stered by

Our study successfully implemented a referral program for maternal contraceptive services within pediatric care by having pediatric residents assess postpartum women ’ s needs

It was decided that with the presence of such significant red flag signs that she should undergo advanced imaging, in this case an MRI, that revealed an underlying malignancy, which

wenigen, großen Plaques lässt sich sowohl durch eine geringere Anzahl an. Bindungsstellen als auch durch