Abstract

(1)

R

OMAN

F

RANICZEK

, I

ZABELA

D

OLNA

, B

ARBARA

K

RZYŻANOWSKA

Transferable Resistance to Different

Antimicrobials Due to CTX−M−Type

ββ

−Lactamases

Among Citrobacter freundii, Serratia marcescens,

and Enterobacter

spp. Clinical Isolates

Koniugacyjna oporność na różne grupy antybiotyków

uwarunkowana wytwarzaniem

ββ

−laktamaz typu CTX−M

u klinicznych izolatów

Citrobacter freundii

,

Serratia marcescens

i

Enterobacter

spp.

Department of Microbiology, Silesian Piasts University of Medicine in Wrocław, Poland Adv Clin Exp Med 2007, 16, 4, 493–500

ISSN 1230−025X

ORIGINAL PAPERS

Abstract

Objectives. The aim of the study was to evaluate the transfer frequency of plasmid−borne genes coding for extend− ed−spectrum β−lactamases (ESBLs) from clinical isolates of Citrobacter freundii, Serratia marcescens, and

Enterobacterspp. to the E. coliK12 C600 recipient strain. Moreover, the susceptibility to selected antibiotics and chemotherapeutics of the donor strains and transconjugants obtained in the mating experiments was determined.

Material and Methods. A total of 32 ESBL−producing clinical isolates, including Enterobacter spp. (n = 21),

Serratia marcescens (n = 6), and Citrobacter freundii(n = 5) isolated from children hospitalized in the Medical University Hospital in Wrocław, Poland, were used in this study. ESBL production was confirmed by the double− disk synergy test (DDST). Transfer of plasmid−mediated genes coding for ESBL was carried out by the conjuga− tional broth method. Susceptibility to antibacterial drugs was performed by an agar dilution technique on Mueller− Hinton agar. The presence of the blaCTX−Mgene in the donor strains and transconjugants was determined by PCR.

Results.Nineteen (59.4%) of the 32 clinical isolates studied transferred plasmid−mediated genes coding for ESBL to the E. coliK12 C600 recipient strain with a frequency of 10–7_{to 10}–1_{per donor cell. The donor strains and their}

transconjugants displayed resistance patterns typical of ESBL producers. They were resistant to cefotaxime, cef− triaxone, and aztreonam, but susceptible to carbapenems (imipenem and meropenem) and oxyimino−β−lactams (ceftazidime, cefotaxime, ceftriaxone, and aztreonam) combined with clavulanic acid. The MICs of cefotaxime and ceftriaxone were significantly higher than those of ceftazidime, suggesting that this resistance may result from cefotaximase activity (e.g. CTX−M−type β−lactamases). On the basis of PCR, the blaCTX−Mgene was identified in 15

donor strains as well as in 15 transconjugants. Additionally, resistance to non−β−lactam antibacterial drugs (partic− ularly to aminoglycosides) was, in many cases, co−transferred to the recipient strain by conjugation.

Conclusions. These data confirm the necessity of detecting the ESBL phenotype in clinical isolates of Gram−neg− ative rods since conjugative plasmids responsible for the production of ESBLs may often encode resistance to antimicrobial agents other than β−lactams (Adv Clin Exp Med 2007, 16, 4, 493–500).

Key words: ESBL, plasmids, conjugation, antimicrobial resistance.

Streszczenie

Cel pracy.Celem badań było określenie częstości przekazywania genów plazmidowych kodujących β−laktamazy o rozszerzonym spektrum substratowym (ESBL) z klinicznych szczepów Citrobacter freundii, Serratia marce− scensiEnterobacterspp. do szczepu biorcy E. coliK12 C600. Oznaczono ponadto wrażliwość na wybrane anty− biotyki i chemioterapeutyki szczepów dawców oraz uzyskanych w krzyżówkach transkoniugantów.

Materiał i metody.W badaniach zastosowano 32 szczepy kliniczne wytwarzające ESBL: Enterobacter spp. (n = 21),

(2)

Gram−negative rods of the genera Serratia, Citrobacter, andEnterobacterare major nosocomi− al pathogens responsible for various type of infec− tions, such as respiratory tract infections, urinary tract infections, bacteremia, and meningitis, partic− ularly in intensive care, neonatal, and surgical units [1–4]. The principal mechanism of resistance to β−lactam antibiotics in these microorganisms is the production of an inducible, chromosomally encod− ed AmpC β−lactamase. The hyperproduction of AmpC β−lactamases observed in so−called dere− pressed AmpC mutants of these bacteria confers a high level of resistance to almost all β−lactams except cefepime, cefpirome, and carbapenems [5, 6]. Moreover, extended−spectrum β−lactamase (ESBL)−producing strains of Serratia marcescens, Citrobacter freundii, and Enterobacter spp. have been isolated as well, and their prevalence is report− ed to be on the increase in recent years [7–9]. It is well known that genes coding for ESBLs are usual− ly localized on large and transferable plasmids that can be exchanged between bacterial species via conjugation [10–12]. Additionally, such conjuga− tive plasmids often carry genes conferring resis− tance to other classes of antibiotics and chemother− apeutics (e.g. aminoglycosides, tetracycline, and co−trimoxazole), limiting the treatment options [13]. In recent years there has been an increased prevalence of CTX−M−type ESBLs, which display a much higher activity against cefotaxime than against ceftazidime. These enzymes are now among the most common ESBLs in the world [14–19].

The aim of the present study was to determine the transfer frequency of plasmid−borne genes responsible for the synthesis of ESBLs from clini− cal isolates of Citrobacter freundii, Serratia marcescens, and Enterobacterspp. recovered from hospitalized children to the E. coli K12 C600

recipient strain. Additionally, the in vitrosuscepti− bility to antibacterial agents of the donor strains and their transconjugants obtained in the mating experiments was investigated.

Material and Methods

Bacterial Strains

Thirty−two ESBL−positive clinical isolates, including Enterobacter cloacae (n = 14), Ente− robacter sakazakii (n = 4), Enterobacter agglom− erans (n = 3), Serratia marcescens (n = 6), and Citrobacter freundii(n = 5), were collected during a two−year period (2004–2005) from children hos− pitalized in pediatric wards of the Medical Uni− versity Hospital in Wrocław, Poland. The isolates were obtained from different specimens, mostly from urine, stool, pus, throat swabs, and blood samples. Species identification of the strains was performed by the ATB automated identification system (bioMérieux, France) using the ID 32 E tests according to the manufacturer’s instructions.

Susceptibility Testing

The susceptibility to selected antimicrobials was tested by the agar dilution technique on Mueller−Hinton agar (Oxoid) according to the Clinical Laboratory Standards Institute guidelines [20]. The minimal inhibitory concentrations (MICs) of the oxyimino−β−lactams azteronam, cefotaxime, ceftazidime, and ceftriaxone were determined alone and in a fixed concentration of clavulanic acid (2 mg/l). The concentration of the antimicrobials tested ranged from 1 to 1024 mg/l. The inoculum of bacterial strains was 104_colony−

dwóch krążków (DDST). Przekazywanie genów plazmidowych kodujących ESBL przeprowadzono za pomocą metody koniugacji w podłożu bulionowym. Wrażliwość na leki przeciwbakteryjne oznaczono metodą seryjnych rozcieńczeń w podłożu agarowym Mueller−Hintona. Występowanie genu blaCTX−Mw szczepach dawców i transko−

niugantach oznaczono metodą PCR.

Wyniki. 19 (59,4%) spośród 32 badanych izolatów przekazywała geny plazmidowe kodujące ESBL do szczepu biorcy E. coliK12 C600 z częstością 10–7_{to 10}–1_{w przeliczeniu na komórkę dawcy. Szczepy dawców oraz trans−}

koniuganty wykazywały typowe dla producentów ESBL wzorce oporności. Charakteryzowały się opornością na cefotaksym, ceftriakson i aztreonam oraz wrażliwością na karbapenemy i oksyimino−β−laktamy (ceftazydym, ce− fotaksym, ceftriakson i aztreonam) skojarzone z kwasem klawulanowym. Wartości MIC dla cefotaksymu i ceftria− ksonu były znacznie wyższe w porównaniu z wartościami MIC dla ceftazydymu. Wyniki te mogą sugerować opor− ność wynikającą z wytwarzania cefotaksymaz (np. β−laktamaz typu CTX−M). Za pomocą metody PCR wykryto obecność genu blaCTX−Mu 15 szczepów dawców, a także u 15 transkoniugantów. W wielu przypadkach ponadto

oporność na nie−β−laktamowe leki przeciwbakteryjne (przede wszystkim na aminoglikozydy) była przekazywana do szczepu biorcy w wyniku koniugacji.

Wnioski. Wyniki przedstawione w pracy potwierdzają konieczność wykrywania fenotypu ESBL wśród klinicz− nych izolatów pałeczek Gram−ujemnych, gdyż plazmidy koniugacyjne determinujące syntezę ESBL często mogą kodować oporność na inne, nie−β−laktamowe, leki przeciwbakteryjne (Adv Clin Exp Med 2007, 16, 4, 493–500).

(3)

forming units (cfu) per spot deposited on the Mueller−Hinton agar. MIC values were read after 18 h of incubation at 35°C. E. colistrains ATCC 25922 and ATCC 35218 were used as quality ref− erence strains. Standard powders of antimicrobials were obtained from the following suppliers: aztre− onam (Bristol−Myers Squibb), ceftazidime (Glaxo Wellcome), ceftriaxone (Hoffmann−La Roche Inc.), amikacin, cefotaxime, and gentamicin (Sig− ma Chemical Co.), imipenem (Merck Sharp & Dohme Research), meropenem (Zeneca), lithium clavulanate (GlaxoSmithKline Pharma), and chlo− ramphenicol, co−trimoxazole, norfloxacin, and tetracycline (Polfa Tarchomin).

ESBL Production

ESBL production was determined using the double−disk synergy test (DDST) according to Jarlier et al. [21]. This test was performed by plac− ing disks of ceftazidime, cefotaxime, and aztreon− am (30 µg each) at distances of 20 mm (center to center) from a disk containing amoxicillin + clavu− lanic acid (20 and 10 µg, respectively). The strains that demonstrated synergy between oxyimino−β− lactams and clavulanic acid were considered to produce ESBL enzymes.

Resistance Transfer Experiments

Conjugational transfer of plasmids encoding ESBL was performed with all ESBL−positive strains studied (resistant to cefotaxime or cef− tazidime but susceptible to nalidixic acid) using the mixed broth method. E. coliK12 C600, which is resistant to nalidixic acid and susceptible to all β−lactams, was used as the recipient strain. Logarithmic−phase broth cultures of the donor and recipient strains (each of a concentration of appro− ximately 109_{cfu per ml) were mixed at a ratio of}

1 : 1 and incubated at 37°C for 24 h. Transconju− gants were selected on MacConkey agar (Biomed) supplemented with nalidixic acid (64 mg/ml) (Chinoin, Hungary) to inhibit the growth of the donor strains and with cefotaxime or ceftazidime (4 mg/ml) to inhibit the growth of the recipient strain. After the incubation period, the number of colonies was counted. The transfer frequency of plasmid−mediated ESBL was expressed as the transconjugant cfu number relative to the donor cfu number after the mating period.

Plasmid DNA Preparation

Plasmid DNA was extracted from the donor strains and their transconjugants by the alkaline method using the Qiagen Plasmid Mini Kit (Qia−

gen, Germany) according to the manufacturer’s procedure.

PCR Amplification

of the

bla

CTX−M

Determinant

Plasmid DNA preparations from the donor strains and transconjugants were used as templates for blaCTX−M gene amplification. PCR was per−

formed in a volume of 25 µl containing 1 µl of DNA sample, 2.5 µl of PCR buffer and 2.5 U of Taq polymerase (Qiagen, Germany), 0.2 mM of each dNTP, and 50 pmol of the specific oligonu− cleotide primers P1C 5’ – TCGTCTCTTCCAG – 3’ and P2D 5’ – CAGCGCTTTTGCCGTCTAAG – 3’ (Bionovo, Legnica, Poland). The amplifica− tion was carried out in a DNA Engine PTC−200 termocycler (JM Research, USA). The PCR con− ditions were: 3 min at 95°C, 30 cycles of 30 s at 95°C, 30 s at 55°C, and 30 s at 72°C, and finally 3 min at 72°C [22]. After the amplification, elec− trophoresis on 2% agarose (Sigma−Aldrich, Germany) gel supplemented with ethidium bro− mide (0.25 µl/ml) was performed to reveal the PCR products of an expected size of approximate− ly 1000 bp.

Results

Conjugation Experiments

All the 32 clinical isolates selected for this study were identified as ESBL producers based on the positive result of the DDST. In order to deter− mine the transfer frequency of ESBL−encoding genes to the Escherichia coliK12 C600 recipient strain, all these strains were subjected to conjuga− tion experiments as donor strains. Transconjugants were obtained for 19 (59.4%) of them (14 Ente− robacter spp., 3 Citrobacter freundii, and 2 Serratia marcescens). The effectiveness of conju− gational transfer ranged from 2.4 × 10–7 _{to 4.0 ×}

10–1 _{per donor cell (Table 1). All the transconju−}

gants displayed ESBL expression, which was con− firmed by the conventional DDST.

Antimicrobial Susceptibility

of the Donor Strains

(4)

cephalosporins. In contrast, most of the donor strains (11/19) were susceptible to ceftazidime. The MIC values of cefotaxime and ceftriaxone (in most cases from 128 to > 1024 mg/l) were substantially higher than those of ceftazidime (MIC range: 2–512 mg/l).

In all cases, however, susceptibility to oxyimi− no−β−lactams (3GC and aztreonam) was efficient− ly restored (MIC range: from < 1 to 2 mg/l) in the presence of clavulanic acid at a concentration of 2 mg/l. Moreover, all the donor strains were uni− formly susceptible to carbapenems (imipenem and meropenem) (MIC: < 1 mg/l).

In the group of non−β−lactam antimicrobials, susceptibility testing gave the following results: all donor strains were resistant to gentamicin (MIC range: 32 to > 1024 mg/l) and most of them (14/19) were additionally resistant to amikacin (MIC range: 1024 to > 1024 mg/). Except for two isolates, these strains were resistant to co−trimoxa− zole (MIC: > 1024 mg/l), but none of them exhibi− ted resistance to norfloxacin. Resistance to tetracycline (MIC range: 16–128 mg/l) and to chloramphenicol (MIC range: 32–128) was de− monstrated in 6 and 3 donor strains, respectively.

Antimicrobial Susceptibility

of the Transconjugants

The MIC values of oxyimino−β−lactams for the transconjugants reflected well the resistance patterns obtained for donor strains (Table 2).

Almost all the transconjugants (18/19) exhibited resistance to gentamicin (MIC range: 16 to > 1024 mg/l). Resistance to amikacin (MIC range: 128 to > 1024 mg/l) was observed in 12 of them. The MICs of the aminoglycosides tested for the transconjugants were substantially lower in com− parison with those obtained for the respective donor strains. Resistance to co−trimoxazole was observed only in 8 transconjugants, although 17 of the 19 donor strains were resistant to this che− motherapeutic. Similarly, resistance to tetracycline and chloramphenicol was demonstrated in 5 and 2 of the transconjugants, respectively.

Resistance Patterns

to Non−

ββ

−Lactam Antibacterial

Drugs Co−Transferred

with ESBL Phenotype

The conjugative transfer of plasmids coding for ESBL from the donor strains to E. coli K12 C600 was in many cases accompanied by resis− tance to classes of antibacterial drugs other than β−lactams. As shown in Table 3, the most common resistance pattern acquired by transconjugants via conjugation was resistance to gentamicin and amikacin (7/19), followed by resistance to three antimicrobials: gentamicin, amikacin, and co−tri− moxazole (3/19). The remaining resistance pat− terns were detected in two or in individual transconjugants only.

Detection of the

bla

CTX−M

Gene

Results of PCR based on the PC1 and PD2 primers specific to CTX−M−type ESBLs in donor strains and their transconjugants are shown in Figure 1. The presence of the blaCTX−M gene was

detected in 15 donor strains as well as in 15 transconjugants obtained in mating experiments.

Discussion

The clinical isolates of Enterobacter spp., Citrobacter freundii, and Serratia marcescensoften exhibit high−level resistance to broad−spectrum penicillins, third−generation cephalosporins (3GC), and aztreonam. This resistance usually results from the production of two principal classes of β−lacta− mases: chromosomally encoded AmpC and/or ESBLs [6, 11, 23]. The high−level constitutive pro− duction of AmpC β−lactamases, due to a mutation in a chromosomal gene ampD, often occurs in stably derepressed mutants of Enterobacter spp., Citrobacter freundii, and Serratia marcescens, ren−

Table 1.Transfer frequency of ESBL−encoding plasmids

from donor strains (n = 19) to the E. coliK12 C600 recipient strain

Tabela 1. Częstość przekazywania plazmidów

kodujących ESBL ze szczepów dawców (n = 19) do szczepu biorcy E. coliK12 C600

ESBL−positive donor strains Transfer frequency (ESBL + szczepy dawców) (Częstość transferu)

Citrobacter freundii8 2.9 × 10–1

Serratia marcescens242 2.4 × 10–7

Serratia marcescens278 1.5 × 10–6

Enterobacter cloacae938 2.8 × 10–1

Enterobacter sakazakii924 1.5 × 10–1

Enterobacter agglomerans3447 1.3 × 10–1

(5)

T

able 2

. MIC values (mg/l) of antibacterial drugs for ESBL−positive donor strains (n = 19) and their transconjugants (T)

T

abela 2.

W

artości MIC (mg/l) leków przeciwbakteryjnych dla ESBL−dodatnich szczepów dawców (n = 19) i ich transkoniugantów (T)

Strains tested

Antibacterial drugs

(Badane szczepy)

(Leki przeciwbakteryjne) CAZ

CAZ+Cla CTX CTX+Cla CRO CRO+Cla A T M A TM+Cla IPM MEM Gm An T NOR Sxt C 1. Citr obacter fr eundii 8 4 < 1 256 < 1 512 < 1 3 2 < 1 < 1 < 1 > 1024 1024 < 1 < 1 > 1024 8 T 8 4 < 1 256 < 1 512 < 1 3 2 < 1 < 1 < 1 > 1024 1024 < 1 < 1 1024 4 2. Citr obacter fr eundii 933 8 < 1 512 < 1 1024 < 1 6 4 < 1 < 1 < 1 > 1024 > 1024 2 < 1 > 1024 4 T 933 2 2 512 < 1 1024 < 1 3 2 < 1 < 1 < 1 > 1024 1024 2 < 1 > 1024 4 3. Citr obacter fr eundii 787 64 < 1 1 6 < 1 1 6 < 1 128 < 1 < 1 < 1 512 2 128 < 1 > 1024 4 T 787 64 < 1 1 6 < 1 1 6 < 1 128 < 1 < 1 < 1 6 4 < 1 256 < 1 > 1024 4 4. Serratia mar cescens 242 32 < 1 1024 < 1 512 < 1 256 < 1 < 1 < 1 > 1024 > 1024 16 < 1 > 1024 32 T 242 32 < 1 512 < 1 512 < 1 256 < 1 < 1 < 1 > 1024 > 1024 4 < 1 > 1024 32 5. Serratia mar cescens 278 4 < 1 1024 < 1 1024 < 1 128 < 1 < 1 < 1 > 1024 > 1024 16 < 1 > 1024 64 T 278 4 1 512 < 1 512 < 1 128 < 1 < 1 < 1 > 1024 > 1024 16 < 1 > 1024 64 6. Enter obacter cloacae 938 4 < 1 6 4 < 1 128 < 1 1 6 < 1 < 1 < 1 > 1024 > 1024 2 < 1 > 1024 4 T 938 2 < 1 6 4 < 1 128 < 1 1 6 < 1 < 1 < 1 512 16 2 < 1 2 4 7. Enter obacter cloacae 872 4 < 1 256 < 1 128 < 1 6 4 < 1 < 1 < 1 512 > 1024 2 < 1 > 1024 8 T 872 8 < 1 256 < 1 512 < 1 6 4 < 1 < 1 < 1 256 8 2 < 1 > 1024 2 8. Enter obacter cloacae 21 1 2 < 1 128 < 1 256 < 1 4 < 1 < 1 < 1 > 1024 > 1024 4 < 1 > 1024 4 T 2 1 1 2 < 1 128 < 1 256 < 1 4 < 1 < 1 < 1 1024 128 4 < 1 < 1 2 9. Enter obacter cloacae 70 2 < 1 256 < 1 256 < 1 6 4 < 1 < 1 < 1 > 1024 > 1024 2 < 1 > 1024 8 T 7 0 2 < 1 256 < 1 512 < 1 6 4 < 1 < 1 < 1 1024 128 2 < 1 < 1 2 10. Enter obacter cloacae 574 2 < 1 128 < 1 256 < 1 4 < 1 < 1 < 1 > 1024 > 1024 2 < 1 > 1024 4 T 574 2 < 1 128 < 1 256 < 1 4 < 1 < 1 < 1 512 512 2 < 1 > 1024 2 11 . Enter obacter cloacae 742 2 < 1 256 < 1 512 < 1 1 6 < 1 < 1 < 1 6 4 < 1 2 < 1 < 1 2 T 742 2 < 1 256 < 1 512 < 1 1 6 < 1 < 1 < 1 1 6 < 1 2 < 1 < 1 2 12. Enter obacter cloacae 675 32 < 1 512 < 1 1024 < 1 128 < 1 < 1 < 1 > 1024 > 1024 2 < 1 > 1024 2 T 675 32 < 1 512 < 1 512 < 1 128 < 1 < 1 < 1 512 512 2 < 1 2 2 13. Enter obacter cloacae 612 128 < 1 > 1024 1 > 1024 < 1 > 1024 < 1 < 1 < 1 > 1024 > 1024 2 < 1 > 1024 8 T 612 128 < 1 512 < 1 512 < 1 256 < 1 < 1 < 1 512 512 2 < 1 2 2 14. Enter obacter cloacae 6980 512 < 1 128 < 1 512 < 1 1024 < 1 < 1 < 1 3 2 4 128 < 1 > 1024 128 T 6980 512 < 1 128 < 1 256 < 1 1024 < 1 < 1 < 1 4 4 6 4 < 1 < 1 4 15. Enter obacter sakazakii 924 32 < 1 512 < 1 512 < 1 128 < 1 < 1 < 1 > 1024 > 1024 2 < 1 > 1024 4 T 924 32 < 1 256 < 1 512 < 1 128 < 1 < 1 < 1 512 128 2 < 1 < 1 2 16. Enter obacter sakazakii 834 64 < 1 3 2 < 1 3 2 < 1 128 < 1 < 1 < 1 128 < 1 128 < 1 < 1 8 T 834 64 < 1 3 2 < 1 3 2 < 1 128 < 1 < 1 < 1 6 4 < 1 128 < 1 < 1 4 17. Enter obacter sakazakii 8341 64 < 1 1 6 < 1 3 2 < 1 128 < 1 < 1 < 1 128 < 1 128 < 1 > 1024 8 T 8341 64 < 1 1 6 < 1 3 2 < 1 128 < 1 < 1 < 1 6 4 < 1 128 < 1 > 1024 8 18. Enter obacter agglomerans 3447 2 < 1 2 5 6 < 1 2 5 6 < 1 3 2 < 1 < 1 < 1 > 1024 > 1024 2 < 1 > 1024 2 T 3447 2 < 1 256 < 1 256 < 1 3 2 < 1 < 1 < 1 512 512 2 < 1 2 4 19. Enter obacter agglomerans 3365 4 < 1 256 < 1 512 < 1 3 2 < 1 < 1 < 1 > 1024 > 1024 2 < 1 > 1024 4 T 3365 4 < 1 256 < 1 512 < 1 3 2 < 1 < 1 < 1 512 128 2 < 1 2 4

An – amikacin, A

TM – aztreonam, C – chloramphenicol, CTX – cefotaxime, CAZ – ceftazidime, CRO – ceftriaxone, IPM – imipenem, ME

M – meropenem, NOR – norfloxacin, Gm – gentamicin, T

– tetracycline, Sxt – co−trimoxazole, Cla – clavulanic acid at a concentration of 2 mg/l. An – amikacyna, A

TM – aztreonam, C – chloramfenikol, CTX – cefotaksym, CAZ – ceftazydym, CRO – ceftriakson, IPM – imipenem, MEM

– meropenem, NOR – norfloksacyna, Gm – gentamy−

cyna, T

–

(6)

dering them resistant to all β−lactams except car− bapenems, cefepime, and cefpirome. Such mutants may be selected during therapy with a number of β− lactam antibiotics, especially ceftazidime, cefo− taxime, and ceftriaxone [11, 24].

ESBLs are less common than AmpC β−lacta− mases, although these enzymes have become more and more prevalent among Enterobacter spp., Citrobacter freundii, and Serratia marcescens in recent years [2, 7–9, 25]. ESBLs effectively hydrolyze most penicillins and cephalosporins; however, they are not active against carbapenems or cephamycins and are inhibited by β−lactam inhibitors (clavulanic acid, sulbactam, and tazo− bactam). ESBL−encoding genes are usually carried by transferable plasmids and/or transposons, which contributes to their rapid dissemination among Gram−negative bacilli, particularly by means of conjugation [26].

Table 3. Resistance patterns to non−β−lactam antibacteri−

al drugs co−transferred with ESBL phenotype

Tabela 3.Wzory oporności na nie−β−laktamowe leki prze−

ciwbakteryjne przekazywane wraz z fenotypem ESBL Resistance patterns No. of transconjugants (Wzory oporności) (Liczba transkoniugantów)

Gm, An 7

Gm, An, Sxt 3

Gm, T, Sxt 2

Gm 2

Gm, An, Sxt, C 1

Gm, An, T, Sxt, C 1

Gm, Sxt 1

Gm, T 1

T 1

An – amikacin, C – chloramphenicol, Gm – gentamicin, T – tetracycline, Sxt – co−trimoxazole.

An – amikacyna, C – chloramfenikol, Gm – gentamycy− na, T – tetracyklina, Sxt – kotrimoksazol.

Fig. 1. Agarose gel electrophoresis of PCR products in donor strains (lanes 2–20) and their transconjugants (T) (lanes 22–40).

Lanes: 1 and 21 – DNA molecular−size markers. Positive results of PCR – lanes: 2 (C. freundii8); 3 (C. freundii

933); 5 (S. marcescens242); 6 (S. marcescens278); 7 (Ent. cloacae938); 8 (Ent. cloacae872); 9 (Ent. cloacae211); 10 (Ent. cloacae70); 11 (Ent. cloacae574); 12 (Ent. cloacae742); 13 (Ent. cloacae675); 14 (Ent. cloacae612); 16 (Ent. sakazakii924); 19 (Ent. agglomerans3447); 20 (Ent. agglomerans3365); 22 (T 8); 23 (T 933); 25 (T 242); 26 (T 278); 27 (T 938); 28 (T 872); 29 (T 211); 30 (T 70); 31 (T 574); 32 (T 742); 33 (T 675); 34 (T 612); 36 (T 924); 39 (T 3447); 40 (T 3365)

Ryc. 1. Elektroforeza w żelu agarozowym produktów PCR szczepów dawców (ścieżki 2–20) i ich transkoniugantów (T) (ścieżki 22–40).

Ścieżki 1 i 21 – markery długości fragmentów DNA. Dodatnie wyniki PCR – ścieżki: 2 (C. freundii8); 3 (C. freundii

(7)

All the ESBL−positive isolates selected for this study, representing the species Enterobacter cloa− cae(n = 14), Enterobacter sakazakii(n = 4),Ente− robacter agglomerans (n = 3), Serratia marces− cens (n = 6), and Citrobacter freundii(n = 5), were subjected to conjugation experiments. Most of them (59.4%) successfully transferred ESBL− encoding plasmids to the Escherichia coli K12 C600 recipient strain. This confirms a very effec− tive mechanism of ESBL dissemination among Gram−negative bacteria viaconjugation. However, the number of the strains studied which gave pos− itive results in the mating experiments was lower than the data reported by Park et al. [9], who demonstrated a higher percentage (76.6%) of Enterobacter cloacae, Citrobacter freundii, and Serratia marcescensthat transferred ESBL−encod− ing plasmids by conjugation.

It is worth noting that an especially high effec− tiveness of conjugation (10–2_{to 10}–1_{per donor cell)}

was observed in experiments with the Citrobacter freundii donor strains. These results agree with those reported previously by Gniadkowski et al. [22], who showed a very high frequency of conju− gation (10–2 _{per donor cell) with}_{Citrobacter fre−} undiistrains. In contrast, the transfer frequency for the two Serratia marcescens strains studied was significantly lower (10–7_{and 10}–6_{per donor cell).}

The conjugational crossings with 13 (40.6%) of the 32 strains tested were found to be infertile. This suggests that in some cases the genes coding for ESBL might be integrated with the chromosome or non−transferable plasmids. Therefore additional stud− ies are needed to determine their genetic localization. The donor strains and their transconjugants displayed susceptibility patterns typical of ESBL producers. The majority of them (16/19) displayed resistance to cefotaxime, ceftriaxone, and aztreon− am. In addition, all donors and transconjugants were uniformly susceptible to imipenem and meropenem (MIC < 1 mg/l). These results support the previous suggestion that carbapenems are the major treatment option for infections caused by ESBL−producing bacilli [10, 11, 27]. Moreover, MIC values of 3GC and aztreonam were signifi− cantly decreased (from < 1 to 2 mg/l) in the pres− ence of clavulanic acid. MIC values of cefotaxime and ceftriaxone were considerably higher than

those of ceftazidime. These findings suggest the presence of CTX−M−type ESBLs (so−called cefo− taximases) that display much higher activity against cefotaxime and ceftriaxone than against ceftazidime. The CTX−Mβ−lactamases are mem− bers of a family of ESBLs that emerged in the late 1980s; the global expansion of these enzymes was observed in the mid−1990s. Nowadays they are the most prevalent ESBLs in many countries world− wide [12].

As expected, PCR results based on P1C and P2D primers specific to CTX−M−type β−lacta− mases confirmed the presence of the blaCTX−Mgene

in 15 of the 19 donors. Similar results were obtained for the transconjugants. This suggests that the blaCTX−M gene was effectively transferred

from all the blaCTX−M−haboring donor strains to the

E. coliK12 C600 recipient strain. These findings confirm data obtained by other authors that demonstrated a high prevalence of CTX−M−type enzymes in Poland [17, 22, 25]. Similar results were reported by Kim et al. [8] and by Park et al. [9], who demonstrated that CTX−M−type β−lacta− mases were the most common ESBLs among clin− ical isolates of Citrobacter freundii, Serratia marcescens, and Enterobacterspp. in Korea.

ESBL−encoding plasmids may also harbor determinants for resistance to other classes of antibiotics and chemotherapeutics, such as amino− glycosides, tetracycline, and co−trimoxazole [13, 28]. Such plasmids are thus regarded as an impor− tant source of transferable, multiresistance deter− minants, limiting the options of physicians treating infections caused by ESBL−producers. All of the donor strains were resistant to gentamicin and most of them to amikacin (14/19) and co−trimoxa− zole (17/19), whereas resistance to tetracycline and chloramphenicol was found in 6 and 3 donor strains, respectively. Interestingly, resistance to non−β−lactam antimicrobials was in many cases co−transferred with ESBL−encoding plasmids to the recipient strain.

In conclusion, the results of this study revealed a high prevalence of CTX−M−type ESBLs among clinical isolates of Citrobacter freundii, Serratia marcescens, and Enterobacter spp. In addition, these strains displayed high−level resistance to both β−lactam and non−β−lactam antimicrobials.

References

[1] Sanders WEJ, Sanders CC: Enterobacter spp.: pathogens poised to flourish at the turn of the century. Clin Microbiol Rev 1997, 10, 220–224.

[2] Luzzaro F, Perilli M, Migliavacca R, Lombardi G, Micheletti P, Agodi A, Stefani S, Amicosante G, Pagani L: Repeated epidemics caused by extended−spectrum β−lactamase−producing Serratia marcescens strains. Eur J Clin Microbiol Infect Dis 1998, 17, 629–636.

(8)

[4] Lin YC, Chen TL, Ju HL, Chen HS, Wang FD, Yu KW, Liu CY:Clinical characteristics and risk factors for attributable mortality in Enterobacter cloacaebacteremia. J Microbiol Immunol Infect 2006, 39, 67–72.

[5] Thomson KS, Smith Moland E:Version 2000: the new β−lactamases of Gram−negative bacteria at the dawn of the new millennium. Microb Infect 2000, 2, 1225–1235.

[6] Livermore DM, Brown DFJ:Detection of β−lactamase−mediated resistance. J Antimicrob Chemother 2001, 48, S59–S64.

[7] Canton R, Oliver A, Coque TM, Varela MC, Perez−Diaz JC, Baquero F:Epidemiology of extended−spectrum

β−lactamase−producing Enterobacterisolates in a Spanish hospital during a 12−year period. J Clin Microbiol 2002, 40, 1237–1243.

[8] Kim J, Lim YM:Prevalence of derepressed AmpC mutants and extended−spectrum β−lactamase producers among clinical isolates of Citrobacter freundii, Enterobacter spp., and Serratia marcescensin Korea: Dissemination of CTX−M−3, TEM−52 and SHV−12. J Clin Microb 2005, 43, 2452–2455.

[9] Park YJ, Park SY, Oh EJ, Park JJ, Lee KY, Woo GJ, Lee K:Occurrence of extended−spectrum β−lactamases among chromosomal AmpC−producing Enterobacter cloacae, Citrobacter freundiiand Serratia marcescensin Korea and investigation of screening criteria. Diagn Microbiol Infect Dis 2005, 51, 265–269.

[10] Jacoby GA, Medeiros AA: More extended−spectrum β−lactamases. Antimicrob Agents Chemother 1991, 35, 1697–1704.

[11] Livermore DM:β−lactamases in laboratory and clinical resistance. Clin Microbiol Rev 1995, 8, 557–584.

[12] Paterson DL, Bonomo RA:Extended−Spectrum β−Lactamases: a clinical update. Clin Microb Rev 2005, 18, 657–686.

[13] Livermore DM, Yuan M: Antibiotic resistance and production of extended−spectrum β−lactamases amongst

Klebsiellaspp. from intensive care units in Europe. J Antimicrob Chemother 1996, 38, 409–424.

[14] Tzouvelekis LS, Tzelepi E, Tassios PT, Legakis NJ:CTX−M−type β−lactamases: an emerging group of extend− ed−spectrum enzymes. Int J Antimicrob Agents 2000, 14, 137–143.

[15] Bonnet R: Growing group of extended−spectrum β−lactamases: the CTX−M enzymes. Antimicrob Agents Chemother 2004, 48, 1–14.

[16] Yan JJ, Ko WC, Tsai SH, Wu HM, Jin YT, Wu JJ:Dissemination of CTX−M−3 and CMY−2 beta−lactamases among clinical isolates of Escherichia coliin southern Taiwan. J Clin Microbiol 2000, 38, 4320–4325.

[17] Baraniak A, Fiett J, Sulikowska A, Hryniewicz W, Gniadkowski M:Countywide spread of CTX−M−3 extend− ed−spectrum β−lactamase−producing microorganisms of the family Enterobacteriaceae in Poland. Antimicrob Agents Chemother 2002, 46, 151–159.

[18] Radice M, Power P, Di Conza J, Gutkind G: Early dissemination of CTX−M−derived enzymes in South America. Antimicrob Agents Chemother 2002, 46, 602–604.

[19] Schneider I, Keuleyan E, Markoyska R: Emergence of CTX−M 15 extended β−lactamase producing Enterobacteriaceae in Bulgaria, Romania and Turkey. Clin Microbiol Infect 2003, 9, 94.

[20] Clinical and Laboratory Standards Institute: Performance Standards for Antimicrobial Susceptibility Testing. Wayne PA, USA 2005, 15th_{Informational Supplement, M100–S15.}

[21] Jarlier V, Nicolas MH, Fournier G, Philippon A:Extended broad−spectrum β−lactamases conferring transfer− able resistance to newer β−lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns. Rev Infect Dis 1988, 10, 867–878.

[22] Gniadkowski M, Schneider I, Pałucha A, Jungwirth R, Mikiewicz B, Bauernfeind A:Cefotaxime−resistant Enterobacteriaceae isolates from a hospital in Warsaw, Poland: identification of a new CTX−M−3 cefotaxime− hydrolyzing β−lactamase that is closely related to the CTX−M−1/MEN−1 enzyme. Antimicrob Agents Chemother 1998, 42, 827–832.

[23] Paterson DL:Extended−spectrum beta−lactamases: the European experience. Curr Opin Infect Dis 2001, 14, 697–701.

[24] Conu P, Francioli P:relationship between ceftriaxone use and resistance of Enterobacterperiod. J Clin Pharm Ther 1992, 17, 303–305.

[25] Naumiuk Ł, Baraniak A, Gniadkowski M, Krawczyk B, Rybak B, Sadowy E, Samet A, Kur J: Molecular epidemiology of Serratia marcescens in two hospitals in Danzig, Poland, over a 5−year preiod. J Clin Microb 2004, 42, 3108–3116.

[26] Jacoby GA, Sutton L:Properties of plasmids responsible for production of extended−spectrum β−lactamases. Antimicrob Agents Chemother 1991 35, 164–169.

[27] Paterson DL: Recommendation for treatment of severe infections caused by Enterobacteriaceae producing extended−spectrum β−lactamases (ESBLs). Clin Microb Infect 2000, 6, 460–463.

[28] Franiczek R, Krzyżanowska B, Dolna I, Mokracka G, Szufnarowski K:Extended−spectrum β−lactamase−con− ferring transferable resistance to different antimicrobial agents in Enterobacteriaceae isolated from bloodstream infections. Folia Microbiol 2005, 50, 119–124.

Address for correspondence:

Roman Franiczek

Department of Microbiology,

Silesian Piasts University of Medicine Chałubińskiego 4

50−368 Wrocław Poland

Tel.: +48 71 784 12 83

e−mail: [email protected]

Conflict of interest: None declared