• No results found

DNA shuffling by random fragmentation and reassembly:

N/A
N/A
Protected

Academic year: 2021

Share "DNA shuffling by random fragmentation and reassembly:"

Copied!
5
0
0

Loading.... (view fulltext now)

Full text

(1)

Genetics

DNA

shuffling by random

fragmentation and

reassembly:

In

vitro

recombination

for

molecular

evolution

WILLEM P. C. STEMMER

AffymaxResearchInstitute, 4001 Miranda Avenue, Palo Alto, CA 94304

CommunicatedbyPeterSchultz,June21, 1994(receivedforreviewDecember20, 1993)

ABSTRACT Computer simuations of the evolution of linearsequenceshave demonsttedtheimportanceof

recom-binatlon ofblocks ofsequenceratherthanpoint mutagenes alone. Repeated cycles of pointmutagenesis, recombination, and slosnhould allow in molecular evolution of complex quences, suh asproteins. A methodfor the

reas-semblyofgenesfromtheir randomDNA gments, rting in in vitro recombini sreported.A1-kbgene,after DNase

Idigesto andpurificationof 10-to50-bp random a nts,

wasr to dtoal size and function. Similarly,a

2.7-kb plasmid could be fitly reambled. Complete

recombination wasobtand betweentwomarkers separated by 75 bp; each marker was located on a separate gene.

Oligonucleotides

wIth3'and 5'ends that arehomologousto the

genecambe addedtothe frag mentiure N

incorporated

into the reassembled

ne.

Thus, mix ofsthetic oligo-nuclotidesandPCR a can be mixedinto agene at

definedpositionsbasedonhomolog.Asanexample, a library ofcmera ofthehunanand murinegenesforinterleukin 10 hasbeenprepad. Shu g canalsobiused for the in vitro equivalentof some s geneticmapulaions, such a a

bakros with parental DNA. Theadvantagesof recombina-tionover exiting mut methods arelikelytoincrease

withthe numbersofcyclesof molecularevolution.

The mostwidely used methods forproteinmutagenesis are

oligonucleotide-directed mutagenesis (1-5) and error-prone

PCR(6,7).Althoughrecombination,withalow level ofpoint

mutation, was long ago demonstrated to be the preferred

method formultiplecyclesofmutagenesis(8-10), sofarno methods havebeen developed forgeneral, homologous

re-combination ofDNAin vitro.Atechnicallysimpleapproach torecombinationis reported, and its application-tothedesign of linear sequences such as DNA, RNA, and proteins is

explored(Fig. 1).Themethodinvolvesdigestingalargegene

withDNaseIto apoolof random DNA

fragments (Fig.

2).

These

fragments

canbereassembled intoafull-lengthgene by repeated cycles of annealing in the presence ofDNA polymerase. The fragmentsprime each other based on

ho-mology,and recombinationoccurswhen

fragments

fromone

copyofageneprime onanother'copy, causing atemplate switch.

Thefirstexperimentwas an attempt toreassemble a1-kb genefrom short randomfragments andthen todeterminethe rate ofmutations that may have occurred (Fig. 2). Next I testedwhetherrecombinationcouldbeobtainedbetweentwo genes, each carrying a stop codon marker atpositionsthat differby75bp(Fig. 3). Oligonucleotides wereadded to the poolofrandom

fragments

todeterminewhether theybecame incorporated intothe gene (Fig. 4). Finally, I attempted to create a library of chimeras from a pair of homologous

interleukin

1P

(IL-1)genesfromdifferentspecies (Fig. 5).

My interest is inapplyingrepeated cyclesofDNAshuffling and selection tothe molecular evolution (11-13) ofgenes, operons, andbiosyntheticpathways. I recently demonstrated theutility of this approach with afrlactamase system(14). Whilemany differentlibrary formats for molecular evolution have beenreported for polynucleotides (15-17) andpeptides andproteins[phage (18-20), lacZ (21), and polysomes(22)], in none of these formats has recombination by random crossovers been used todeliberately create a combinatorial library.

MATERIALS AND METHODS

Substrate Preparation. The substrates for the shuffling reaction were 1.0-kb double-stranded (ds)DNA PCR prod-ucts derived from pUC18 with the primer sequences AAAGCGTCGATTTTTGTGAT and ATGGGGTTC-CGCGCACATTT (Fig.2). The removal offree primers from thePCRproduct by Wizard PCR(Promega)wasfoundto be veryimportant.

DNase IDigestion.About 2-4 pg of the DNAsubstrate(s) wasdigested with0.0015unitof DNaseI(Sigma)perp1 in100 p1of 50 mMTris'HCI,pH7.4/1mMMgC12for 10-20 minat roomtemperature.Fragments of10-50bpwerepurifiedfrom 2% low meltingpoint'agarose gels by electrophoresis onto DE81 ion-exchange paper (Whatman), elution with 1 M NaCl, andethanol precipitation.

PCRWithout Primers. Thepurifiedfragmentswere resus-pended in PCR mixture (0.2 mM each dNTP/2.2 mM MgCl2/50 mM KCI/10 mM Tris-HCl, pH 9.0/0.1% Triton X-100)at aconcentrationof10-30ng/pl. No primers we're added at this point. TaqDNA polymerase' (Promega) was used at 2.5 units per 100

.1A

of reaction mixture. A PCR programof 940 for60 s;940C for30 s,50-55TC for30 s,and 72TC for 30s(30-45times); and72°Cfor5 min was usedin

an MJ Research (Cambridge, MA) PTC-150 thermocycler. ThePCRreassembly of smallfragments into largersequences wasanalyzedbytaking samples after 25, 30, 35, 40, and45 cyclesofreassembly (Fig. 2).Whereas thereassemblyof

100-to200-bp fragments canyielda single PCR product 'ofthe correct'size, 10- to 50-base fragments typically yield some productofthecorrect sizeaswellas products of heteroge-neous molecular weights. Most of this size heterogeneity appears tobeduetosingle-strandedsequences atthe ends of theproducts,since afterrestriction enzyme

digestion

asingle bandof the correctsizeisobtained.

PCRwith P . After 1:40dilution ofthisprimerless PCR productintoPCRmixturewith 0.8pMeachprnierand "15 additionalcyclesofPCR (94TC for30s,500( for 30 s, and 720Cfor30s),asingle product of the correct sizeistypically obtained (Fig. 2).

CloningandAnalysis. Afterdigestion of the PCR product withterminalrestrictionenzymes(BamHIandEcoO109)and gelpurification,thereassembledfragmentswereligated into

Abbreviations: IL,interleukin;ds,doublestranded X-Gal, 5-bromo-4-chloro-3-indolyl

P-D-galactoside.

10747

Thepublicationcostsofthisarticleweredefrayedinpartby pagecharge payment. Thisarticlemusttherefore be herebymarked"advertisement" in accordance with18U.S.C. §1734 solelytoindicatethis fact.

(2)

A fragment with DNAsel -B reassemble fragments _ C select best recombinants D X - X- X -XX X m , -M

NX

*-

NlXI

__ X X X X X XX 1.

repeat formultiple cycles

FIG. 1. (A) Apoolof homologous geneswithdifferentpoint mutations isfragmentedwith DNaseI.(B)Forsimplicity,allmutations shown areconsideredbeneficialand additive.(C) Reassemblyof the randomfragmentsintofull-lengthgenesresultsin frequent templateswitching andrecombination.Arecombinantgenecontainingthefour crossovers(thick lines)canbeselectedfrom thelibrary ofrecombinants basedon itsimprovedfunction.(D)Selectedpool of improved recombinants providesthestarting point foranotherround ofmutationandrecombination. Therecombinationprocessalonecausesalowlevelofpointmutationsbut,ifdesired,additional mutations could be introduced byerror-prone PCRorUVmutagenesis ofthepool ofgenes.

pUC18 digested with BamHI and EcoO109. After

transfor-mation and plating on plates with ampicillin, 5-bromo-4-chloro-3-indolyl (3-D-galactoside (X-Gal),andisopropyl (3D-thiogalactopyranoside, the resulting colonieswereanalyzed for the presence of the HindIII/Nhe I fragment, which is diagnostic forthe +/+ recombinant.

Whole Plasmid Reassembly. A 1:1 mixtureoftwo2.7-kb whole plasmids, pUC18+/- and pUC18-/+, containing stop codons at different locations of lacZa (Fig. 3) was

digested with DNase I and 100- to 200bp fragments were

purifiedasdescribed above.Thereassemblyprogramwas60 cycles of940Cfor30 s, 550C for30 s, and720Cfor30splus 3 s percycle. Gel analysis showed that most ofthe PCR product was >>20 kb. After digestion withaunique enzyme (EcoO109),mostoftheproduct consisted ofasingle band of the expected size, which was gel purified, ligated,

trans-formed, and plated on LB/ampicillin/X-Gal plates as de-scribed above.

IL-1

P

Experiments. Amurine IL-1p3gene (BBG49)and a

humanIL-1(3gene withEscherichia colicodon usage(BBG2; R& DSystems)werePCRamplified fromplasmidtemplates usingtheprimersTTAGGCACCCCAGGCTTTand ATGT-GCTGCAAGGCGATT, resulting in two 0.8-kb PCR frag-ments. The areas ofsequence identity between the human and the murine IL-1(3 sequences are on average only 4.1 baseslong(Fig. 5). Toforcerecombination based onsuch short sequenceidentity,averyloweffectiveannealing

tem-peraturewasused. After thedenaturationstep,thetubewas

rapidly cooledindryice/ethanolandreheatedtothe anneal-ingtemperature. Then 1unitoftheKlenowfragmentofDNA

(Jei PIrlt\ I)\~~c1JIf)-f) rd!' Ff5,l)) t~ P(ER ;ltvlT~;'1W,', ,Io O -up!:^iLaclphau tr t:'8s i kh I1( 1)1)h

polymerase Iwasadded. Because the enzymeis heat-labile, itneedstobeaddedateverycycle. Preparationof dsDNA PCR products, DNase I digestion, and purification of

frag-mentswas asdescribedfor lacZ.Onlythefirst15PCRcycles of thereassemblywereperformed with the heat-labile poly-merase [manualPCR program:

940C

for1 min, 10 s ondry ice/ethanol (until frozen), incubation for -20 s at

250C,

additionof 1 unitofKlenowfragment, reactionfor 2 min at

250C

(15 times)].After these15manualcycles,Taq polymer-ase wasadded and an additional22cycles ofPCR without primers were performed

(940C

for 30 s,

350C

for 30 s, no

720C).

Thereaction mixture was thendiluted 1:20, primers

were added at 0.8

ILM

(AACGCCGCATGCAAGCTTG-GATCCTTATT and

AAAGCCCTCTAGATGATTAC-GAATTCATAT), and plus primer PCR wasperformed as

described forlacZ. Thesecondprimerpair differed from the first pair only because a change in restriction sites was preferred. Afterdigestion ofthePCR product with XbaIand Sph I,thefragmentswereligated into Xba I/Sph I-digested pUC18. The sequences ofthe insertsfrom several colonies were determined by dideoxynucleotide DNA sequencing

(United States Biochemical).

RESULTS ANDDISCUSSION

Reassembly of the

kcZa

Gene. Fig. 2 shows aDNase I digest ofa1.0-kb sequence carryingthe genefor

the

lacZae

fragment.

Gel-purified 10- to50-bpfragmentswere reassem-bled(initiallywithoutprimers)toasingle PCR product ofthe correct size. Of the resulting colonies, 84% (n = 377) are

TIR'R ENIll.ll ;ni1'''

*:FI

k ' Ibp h Jp

FIG. 2. Reassemblyofa1.0-kbgenefrom10-to50-bprandomfragments.(a)A1-kbDNAfragment encodinglacZa wasamplified byPCR. Afterdigestion ofthe gene with 0.15 unit of DNase Ifor15minat200C(b),fragmentsof 10-50baseswerepurifiedfromanagarosegel (c). (d)Purifiedfragmentswerereassembled into afull-lengthgene at ahigh fragmentconcentration (30ng/pJ)in the absence ofprimers.The average sizeofthe PCRproductsincreasesgraduallyvia theprimingof oneproductonanother. Theheterogeneousappearance of theproductislargely duetothepartiallysingle-strandednatureof theproduct. (e)Afteraddition ofprimersandadditionalcyclesofPCR,asinglePCRproductof thecorrectsize istypicallyobtained.Cloningof thisproductintoaplasmid yielded -84%light-todark-bluecolonies, reflectingmutations that occurredduringthereassemblyprocess.

X X m

N mm m

X -M m

(3)

Template Phenotype

pUC18- + White pUC18+ - White

LacZalphagene

BamHI

Polylinker XhoI NcoI NheI Ecrl EcoOl09

BamHI 0

Polylinker HindM Scal 75bpb) Hpal EcrV EcoOO09

Lo--

L o

Hindm-NheIdiagnostic fragment Sall XhoI NcoI PstI BstEII

.TCCGACC+ ms___ ATCCGTCGT.ACTG ACCCTG TTACCC^^CTTAkTCG

SailI PstI SphI HinDII ScalPstI BstEtI

J

Fspl NheI EcoRI BssHIIPvul

:CCTTGCTGCGCATCCACCTTCGCGktfa- -GCGT

_

_- II-I-

-FspI HpaI EcrV BssHIIPvuI

FIG.3. Efficiencyof recombination between twoinactive lacZagenes, eachcarryingasinglemarker at apositionthat differsby75 bases. Each marker is a 20- to30-bp nonhomologoussequencewith four stopcodons,ofwhich two are in the lacZframe(small boxes),with one in eachof theother twoframes(underlined).The two 1-kbtemplatesweremixedat a1:1ratioandshuffled. Aftercloning,24%(n=386) ofthe colonies had an active lacZ gene, resultingin blue colonies onX-Galplates, which is nearthetheoretically expectedvalue for complete recombination(25%). All10ofthe blue colonies contained theexpected HmdIII/NheIrestrictionfragment(datanotshown).

LacZ+, versus 94% without shuffling. When ahigh

concen-tration offragments(10-30

ng/0l)

wasused,thereassembly reactionwassurprisinglyreliable. Bysequencing ofrandom clones, it has been shown that the reassembly process introduces point mutationsata rateof0.7% (n=4437bases; Table 1), which is similar toerror-prone PCR (6,7); 11/12 typesof substitutionswerefound withnoframeshifts(Table 1). Sincetheonly difference compared tonormal PCRwas

theuseofsmallfragments,therateofpointmutagenesismay depend on the size of the fragments that are used in the reassembly. In contrast to PCR, DNA reassembly is an

inverse chain reaction. In PCR the number ofpolymerase

startsitesand the numberofmolecules growsexponentially, whereas in DNAreassemblythe number ofstartsites and the number (but not the size) ofthe molecules decreases over

time. Thisreaction mayperhaps beusedfor reassemblyof genesfromthehighly fragmentedDNAoffossils (23).

LacZ alpha gene

NheI Ecl F 4- l EcoOO09 BanAH L- Z Spike: I 18 HitindU 18

HindM-NheI diagnosticfragment

% blue colonies

Control(nospikedoligo) 0.0 % (N=>1000) Top strand spike 8.0 % (N=855) Bottomstrand spike 9.3 % (N=620) Topandbottom strand spike 2.1 % (N=537)

FIG. 4. Mixtures ofsynthetic oligonucleotides canbe addedto

the random fragments derived from a gene. In the reassembly reaction,theseoligonucleotidescanbeincorporatedinsteadof the originalsequence. A 1-kb PCRfragmentcontaininglacZ- from the

pUC18-/+plasmid(seeFig. 3)wasdigestedwith DNase I and small fragments were purified. A66-mer oligonucleotide, containing 18 bases ofhomologytolacZ atboththe 3' and 5' ends, was mixed in

at a4-foldmolar excess. Thisoligonucleotidewasdesignedtoreplace the25-base heterologous lacZ-inactivatingmarkercontainingfour stopcodon mutationswithwild-type lacZ sequence. Thedegreeof incorporation of sucholigonucleotides can be varied over a wide rangebyadjustingthe molarexcess, theannealingtemperature, or the melting temperature of the homologous flanking sequence. Incorporationwasless when both thetopand bottom strand oligo-nucleotides wereadded, presumably becauseofcompetitive hybrid-ization with thecomplementaryoligonucleotide.

Crossover Between Two Markers in the lacZ Gene. Cross-overbetween the two inactive lacZa genes from plasmids pUC18-/+ and pUC18+/-, each of which contains asingle stop codon marker at positions that differ by 75 bases,was

measured aftershuffling (Fig. 3). The ratio of active, recom-binantcolonies was 24% (n = 386), close to the theoretically expected value of 25% forcompleterecombination.All 10 of the blue coloniesassayed contained thediagnosticHindIII/ NheIrestriction fragment.

The whole 2.7-kb plasmids containing these same LacZ-markers were alsoefficientlyreassembledfrom random 100-to 200-bp fragments. Forreassembly of fragments derived from whole plasmids the theoretical end point is a single, largeconcatemeric molecule. Asexpected, concatemersof >20 kb wereobtained, which, after digestion withaunique restriction enzyme, yielded theexpected2.7kb; 11% (n = 328) of the resulting plasmids hadrecombined in the 75-bp areabetween themarkers, resultingin a LacZ+ phenotype. Recombination ofaPool of Point Mutants. When 14

differ-entpoint-mutatedLacZ-colonies, obtained from the exper-imentdescribedinFig. 2,wererecombinedas apool, 34% (n

= 291)oftheresultingcolonies were LacZ+. These colonies presumablyarosebyrecombination ofthe DNAfrom differ-entcolonies. Assumingthat the pointmutations are spread out throughout the gene and that each of the 14 mutant plasmidscontainsonly oneknockout mutation,thenforeach marker there is a 13/14 chance of getting the wild-type versionand theprobability ofgettingall 14wild-typeversions in asingle clone is (13/14)14 = 35%, close totheobserved valueof 34%.Theclosematchbetweenthepredicted and the observedvaluesof bothLacZshuffling experimentssuggests that thefragments reassort freely.The34% valuecontrasts

withtheexpectedrateofreversalofasinglepoint mutation byerror-pronePCR,which should be closetothepublished mutagenesisrateof0.7%(7).However,acontrolexperiment usingerror-pronePCR insteadofshufflingwas notfeasible, because the 1-kb

fragment

proved toolargetobegenerated by error-pronePCR.

Incorporation of SyntheticOligonucleotides. Synthetic oli-gonucleotides canbe addedtothereassembly mixture and incorporated into the gene based solely on 15-20 bases of homology at the 5' and 3' flanking sequences (Fig. 4). Single-strandedDNAwasincorporatedmoreefficientlythan dsDNA(8-9.3%versus2.1%), presumablybecause of

com-petitive hybridization. Mixtures of synthetic oligonucleo-tides, PCR fragments,or evenwhole genescanbe mixedinto

another sequencelibrary,andthe insertion ofonesequence

cassette is independentfrom the insertion ofacassette in another part of the template (unpublished data). Thus, the

(4)

M H M H M H

AT G ~frCGA TOC A TCTGCAAGTGSIMMG GCCA2CA AAC

ATGGC T GMpT;GTa CGTACA. AGCTCTGCATJGCCA CA G AAC

AGG TC ATGAGC CGTh AAGGTG ACAIaTCC TmCft CTGffDTARGTGAAAAAAGAC2TGTCCCTB

AGG TC G ATGAG TCGT AAGGT CGAC TCC TGAAA TG CC T TAGAAAGAC C

GACrq Cta GTACC G CAAG GG TCGAGTCTGGTTC

GACU C~ AGACCCspAA~2 fG TGGACCGCAAA GG TCGAGTCTJaGTTC

MCCMA GG CAT CGTMTAAC GTCrC.GTCCTAA

H CAGGGTATGCTAACCTGTVYTCCOCGGTTSAEGGTCAGGATATCAPACTTCA ToFEGT GCTAA

"~I- -i -I

FIG. 5. Shuffling ofamurinegene(M)with a human gene(H;with E. coli codonusage)forIL-1,Brepresents an extremeexample of shuffling, sincethe averagelength ofsequenceidentity is only4bases. Crossoverscould beobtainedonly byensuringalowannealingtemperature,which requiredthe useofamanual PCRwith aheat-labile, low-temperatureDNApolymerase,such as the KlenowfragmentofDNApolymeraseI. Shownarethe 17 crossoversthatwereobtained fromDNA sequenceanalysis of nine colonies.Boxesshowmismatchedbases;thick bars represent crossovers.Surprisinglylittle sequenceidentitywassufficienttoyieldcrossovers,presumablybecauseofthetolerance formismatched bases at the lowannealingtemperature.

degree of recombination, the homology required, and the composition ofthemixturecanbeindependently and simul-taneously varied along thelength of thereassembled gene.

Creation ofaLibraryofChimeras of Two Related Genes. We attempted to create a library of chimeras between a

human(withE.colicodon usage)andamurineIL-1p gene. Sincethe areasofsequenceidentityareonaverageonly4.1 baseslong(Fig. 5), thisrepresentsanextremecase,exploring theminimumrequirements forcrossover. Crossovers could notbeobtained by severalapproachesusingTaqpolymerase, evenwhena 10-foldexcessofone of the IL-1,Bgenes was

used (data not shown). The explanation is that with any heat-stable polymerase, thecooling time of the PCR machine (94°C to 25°C at 1-2°C/s) causes the effective annealing

temperature tobehigher thanthe setannealing temperature. Toforce efficientcrossoversbasedonsuchalowdegree of homology, a very low effective annealing temperature is needed. Byusingthe Klenowfiagment ofDNApolymerase I,aheat-labilepolymerase,alowannealingtemperaturewas

obtained. Undertheseconditions,atotal of17crossoversby DNAsequencing of nine colonieswasobtained(Fig. 5).One ofthecrossovers wasbasedononly1or2bases of uninter-ruptedidentity, suggesting thatsomemismatches are toler-atedif sufficient flankinghomology ispresent.

TechnialIssues.Theremoval offreeprimersfromthePCR productbeforefragmentation proved tobe veryimportant. Withoutadequateprimer removal, contamination with full-length templatecanleadto alowfrequency ofrecombination. However,evenrestrictionfiagmentsorwholeplasmidscan

beefficiently reassembled from their fragments, avoidingthe potential contamination of PCR productswithprimers.

The preferred fragment size depends on the intended numberofcrossovers,which differs for variousapplications. For the in vitro evolution of a gene, for example, larger

Table 1. Mutations introduced by mutagenicshuffling

Transition Frequency Transversion Frequency

G A 6 A-T 1 A G 4 A- C 2 C T 7 C A 1 T C 3 C G 0 G C 3 G T 2 T A 1 T G 2

Atotalof 4437 bases of shuffled lacZ DNAweresequenced.The mutation rate was 0.7%; 11/12 types of base substitutions were

found, but therewere noframeshifts.

fragments, which result in one or two crossovers per gene, maybepreferred(14).

The stringency of annealing duringthe reassembly PCR dependsonthe minimumdegreeofhomology that should still yield crossovers. If the degree of homology is high, Taq polymerase canbe used with an annealingtemperature of between45°C and65°C. Crossoversoccurwhen a partially reassembled PCR product primes on the homologous posi-tionofarelated butnotidentical template(template switch). Crossovers based on identity of <15 bases appear more difficulttoobtain. Controlover the stringency of recombi-nation isexpectedtobemuch greaterwithin vitrothanwith in vivorecombination.

Comparison to Other Mutagenesis Techniques. The two mostwidelyused methodsforprotein mutagenesis are error-pronePCRand oligonucleotide-directed mutagenesis.

Error-prone PCRuseslow-fidelity polymerization condi-tions tointroduce alow level of point mutations randomly

over along sequence (6, 7, 24, 25). Error-pronePCR can be used to mutagenize a mixture of fragments of unknown sequence.However, computersimulations(8-10)have sug-gestedthatpoint mutagenesis alonemayoftenbe too gradual

toallow the blockchanges that are required for continued sequence evolution. Thepublished error-pronePCR proto-cols (6, 7) do not allow amplification of DNA fragments

>0.5-1.0kb, limiting their practical application.In contrast, DNA shuffling can be applied to sequences >1 kb, has a mutagenesisratesimilar toerror-prone PCR,and also works withpools ofunknown sequence. Repeated cycles of any mutagenesis strategy lead to an accumulation of neutral mutations, which, for example, maymakeaprotein immu-nogenic. Only with DNA shuffling is it possible to remove such neutralmutations by backcrossing with excess parental

orwild-typeDNA(14).

Inoligonucleotide-directed mutagenesis(1-5), a short se-quenceis replaced with a synthetically mutagenized oligo-nucleotide.Thisapproach does not generate combinationsof distant mutations andis combinatorialonlywithinthelimits oftheoligonucleotide.Thelimitedlibrarysize relative to the vast sequence space (13) means that many rounds of selection

areunavoidable forprotein optimization. Mutagenesis with synthetic oligonucleotides requires sequencing of individual clones after each selection roundfollowedby groupinginto families, arbitrarily choosingasingle family,andreducingit

to a consensusmotif,which isresynthesizedandreinserted intoasingle genefollowedby additional selection(3). This processconstitutesastatisticalbottleneck;it is labor inten-sive and notpracticalfor many rounds ofmutagenesis.

(5)

Error-prone PCR andoligonucleotide-directed mutagene-sis are thususefulfor single cycles of fine tuning but rapidly become limiting when appliedfor multiple cycles. One ap-parentexception is selection ofanRNAligase ribozyme from arandom RNAlibrary using manyrounds of amplificationby error-prone PCR and selection (15). Based on the work of Holland (9), it is surprising that such a complex structure could be evolved without recombination. However, the

oc-currenceof recombination in these experimentshas notbeen ruled out. Usingthe LacZ assay(Fig.3),recombination has been found to occur evenduringnormal PCR at afrequency of -0.03% per 25 cycles. Others have reportedarateof5.4% recombinants under standard PCRconditions (26). Consid-ering that>1000cycles of PCRwererequired for selection of the RNAligase,evensuchalowrateofrecombinationmay havecontributedsignificantly toevolution oftheribozyme. A method that wasdeveloped for assembly of synthetic oligonucleotidesinto afull-lengthgene(27) could be used for recombination but differs fundamentallyfrom DNAshuffling inthatitusesknownsequencesandfixedjunctionsites. The chain shufflingof the heavy- and light-chain genes of anti-bodies is also conceptually different since ituses a single, fixedcrossoversite(28).

Implicationsfor Molecular Evolution. Thegoalofapplied molecular evolution (11-13) is tomimic the natural design processandspeed itupby directed selectionin vitrotoward asimple, specific goal. Computer simulations ofevolution, calledgenetic algorithms (8-10), have shownthat recombi-nation (with a low level of point mutagenesis) between individuals is sufficient fortheevolution ofcomplexlinear sequences. Similarly, by mimicking the mechanisms by whichbacteriahaveevolvedavariety ofresistancegenes,the combination ofepisome transfer, recombination, point

mu-tation, and selection shouldallowone toefficiently redesign genes, operons, pathways, andperhaps whole bacterial ge-nomesforspecific applications (14).

Limitations in genetic algorithms become more pro-nouncedwhen morecyclesareperformed. The advantages of recombination, aswellasthe differencesbetweendifferent recombination formats, maybecomemorepronounced with increasing numbers ofcycles.

Theability toperformthe molecularequivalent ofsome standardgenetic matings by recombinationinvitro,suchas amolecularbackcross, islikely tobe useful. A molecular backcross is performed by repeated "mating" with the desired background while selecting for the mutations of interest(14).Asintraditionalbreeding,thisapproachcanbe usedtocombinephenotypes fromdifferentsourcesintothe background of choice.

Shuffling requires the presence of homologous regions

separating regions ofdiversity. Scaffold-like protein

struc-tures may be particularly suitable for shuffling. The

con-served scaffold determines the overall folding by self-association whiledisplayingrelativelyunrestrictedloops that mediatespecific binding. Examples ofsuchscaffoldsarethe immunoglobulin (-barrel,andthefour-helixbundle (29).

Itisof interest to notethat the crossover, the essenceof sexualrecombination andapresumably complex behavior,

actually occurs in naked DNA.Since sexuality appears to be a behavior that is inherent in the building blocks (13), recombination and sexuality are probably as old as DNA itself.

I thank Dr. William Dower, Dr. Peter Schatz, and Dr. Larry Mattheakis for valuable discussions andforcomments on the manu-scriptand AndreasCrameri for assistance with DNAsequencing. Thecommunicatingmember is chairman of theAffymaxResearch Institute Scientific Advisory Board.

1. Reidhaar-Olson, J. F. & Sauer, R. T. (1988) Science 241, 53-57.

2. Stemmer, W. P.C., Morris, S. K. & Wilson, B.S. (1992) BioTechniques14,256-265.

3. Arkin,A.& Youvan, D. C.(1992)Proc.Natl.Acad. Sci. USA 89,7811-7815.

4. Oliphant,A. R.,Nussbaum,A. L.&Struhl,K.(1986) Gene 44, 177-183.

5. Hermes, J. D.,Blacklow,S.C. &Knowles,J. R.(1990) Proc. Natl.Acad. Sci. USA87,696-700.

6. Leung, D. W.,Chen,E.&Goeddel,D.V.(1989)Technique1, 11-15.

7. Caldwell,R.C. & Joyce,G. F.(1992)PCRMethodsApplic. 2, 28-33.

8. Holland,J. H.(1992) Sci. Am. 267, 66-72.

9. Holland, J. H. (1992) Adaptation in Natural and Artificial Systems(MIT Press, Cambridge, MA),2ndEd.

10. Forrest,S. (1993)Science 261,872-878. 11. Joyce,G. F.(1992)Sci. Am.267,90-97. 12. Kauffman, S.A.(1992)J. Theor. Biol.157,1-7.

13. Kauffman, S.A. (1993) The Origins ofOrder(Oxford Univ. Press, NewYork).

14. Stemmer,W. P. C. (1994) Nature (London) 370, 389-391. 15. Bartel, D. P.& Szostak,J. W.(1993) Science 261, 1411-1418. 16. Bock,L.C., Griffin,L. C., Latham,J.A.,Vermaas, E. H. &

Toole,J.J.(1992)Nature(London)355, 564-566. 17. Tuerk, C. &Gold,L. (1990)Science249,505-510.

18. Cwirla, S.E., Peters, E. A.,Barrett, R. W. & Dower, W. J. (1990)Proc. Natd.Acad. Sci. USA 87, 6378-6382.

19. Scott,J. K.&Smith,G. P.(1990) Science249,386-390. 20. McCafferty,J.,Griffiths,A.D.,Winter, G.&Chiswell,D. J.

(1990) Nature (London) 348, 552-554.

21. Cull, M.G., Miller, J. F. &Schatz, P.J. (1992) Proc. Natd. Acad.Sci. USA89,1865-1869.

22. Mattheakis, L., Bhatt,R.&Dower, W. D.(1994)Proc.Natd. Acad. Sci. USA 91, 9022-9026.

23. Cano, R.J., Poinar, H.N., Pieniazek, N.J., Acra, A. & Poinar,G.0. (1993)Nature(London) 363, 536-538. 24. Gram, H., Marconi,L.,Barbas,C. F.,Collett,T.A., Lerner,

R. & Kang, A.S. (1992) Proc. Natl. Acad. Sci. USA 89, 3576-3580.

25. Hawkins,R.E.,Russell,S. J. &Winter,G. (1992)J. Mol. Biol. 226, 889-896.

26. Meyerhans, A., Vartanian, J. P. & Wain-Hobson, S. (1990) Nucleic AcidsRes. 18,1687-1691.

27. DiDonato, A., De Nigris, M., Russo, N., DiBiase, S. & D'Alessio, G. (1993)Anal.Biochem. 212,291-293.

28. Waterhouse,P.,Griffiths,A. D.,Johnson,K.S.&Winter, G. (1993)Nucleic Acids Res. 21, 2265-2266.

29. Osterhout,J.J.,Handel,T.,Na,G.,Toumadje, A., Long,R., Connolly, P.J., Hoch, J.C., Johnson, W.C., Live, D. & DeGrado,W. F.(1992)J. Am. Chem. Soc. 114, 331-337.

References

Related documents