• No results found

Immunoglobulin light chain variable region gene sequences for human antibodies to Haemophilus influenzae type b capsular polysaccharide are dominated by a limited number of V kappa and V lambda segments and VJ combinations

N/A
N/A
Protected

Academic year: 2020

Share "Immunoglobulin light chain variable region gene sequences for human antibodies to Haemophilus influenzae type b capsular polysaccharide are dominated by a limited number of V kappa and V lambda segments and VJ combinations"

Copied!
11
0
0

Loading.... (view fulltext now)

Full text

(1)

Immunoglobulin light chain variable region

gene sequences for human antibodies to

Haemophilus influenzae type b capsular

polysaccharide are dominated by a limited

number of V kappa and V lambda segments and

VJ combinations.

E E Adderson, … , P M Wilson, W L Carroll

J Clin Invest. 1992;89(3):729-738. https://doi.org/10.1172/JCI115649.

The immune repertoire to Haemophilus influenzae type b capsular polysaccharide (Hib PS) appears to be dominated by certain light chain variable region genes (IgVL). In order to examine the molecular basis underlying light chain bias, IgVL genes have been cloned from a panel of heterohybridomas secreting human anti-Hib PS (antibody) (anti-Hib PS Ab). One hybridoma, representative of the predominant serum clonotype of anti-Hib PS Ab in older children and adults following immunization or Hib infection, uses a V kappa II segment identical to the germline gene A2, and a JK3 segment. A second kappa hybridoma uses a member of the V kappa I family and a JK4 segment. Four lambda antibodies, all cross-reactive with the structurally related antigen Escherichia coli K100 PS, use V lambda VII segments which are 96-98% homologous to one another, and may originate from a single germline gene. Two additional lambda antibodies, not K100-cross-reactive, are encoded by members of the V lambda II family. All lambda antibodies use highly homologous J lambda 2 or J lambda 3 segments. The VJ joints of all lambda antibodies and the V kappa

II-encoded antibody are notable for the presence of an arginine codon, suggesting an

important role in antigen binding. Although more complex than heavy chain variable region gene usage, a significant portion of serum anti-Hib PS Ab is […]

Research Article

Find the latest version:

(2)

Immunoglobulin Light Chain Variable Region Gene Sequences for

Human

Antibodies

to

Haemophilus

influenzae Type b Capsular Polysaccharide Are

Dominated by

a

Limited Number of V,: and

V.

Segments and VJ Combinations

ElisabethE.Adderson,* PenelopeG.Shackelford,* RichardA.

Insel,l

Anthony Quinn,* Patricia M.Wilson,*and William L.Carroll*

*Division of Infectious DiseasesandtHematology Oncology, MallinckrodtDepartment of Pediatrics, Washington UniversitySchoolof

Medicine, St. Louis Children's Hospital,St. Louis,Missouri63110;and

ODepartment

ofPediatrics, University ofRochester Schoolof

Medicine and Dentistry, Rochester,New York14642

Abstract

TheimmunerepertoiretoHaemophilusinfluenzaetypeb

cap-sularpolysaccharide(HibPS)appears tobedominatedby cer-tainlight chain variable regiongenes(IgVL).Inorderto

exam-inethemolecularbasis underlying light chain bias,

IgVL

genes have been clonedfroma panelof heterohybridomas secreting humananti-HibPS(antibody) (anti-Hib PSAb).One hybrid-oma, representative of the predominant serum clonotype of

anti-HibPS Ab inolderchildrenandadultsfollowing immuni-zation orHib infection, uses a

V.II

segment identical tothe

germlinegeneA2,and aJK3segment. Asecondkappa

hybrid-oma uses amember of the

V1I

family andaJK4segment.Four lambdaantibodies, all cross-reactive with thestructurally

re-lated antigen Escherichia coliK100 PS, useVAVII segments whichare96-98% homologoustoone another, and may origi-natefromasingle germlinegene. Twoadditionallambda

anti-bodies, not K100-cross-reactive, areencoded by members of theVIIfamily.Alllambda antibodiesusehighly homologous

J.2

or

J.3

segments.TheVJjointsof alllambda antibodiesand

theV

IK-encoded

antibodyarenotable for thepresence ofan

arginine codon, suggestinganimportantrolein antigen binding. Although more complex than heavy chain variable regiongene usage, asignificantportion ofserumanti-Hib PS Ab is likely

tobe encoded byalimited number ofV, andVA segmentsand

VJcombinations, which maybe selectively expressed during development, orfollowing antigenexposure. (J. Clin. Invest.

1992:89:729-738.)Keywords:B-cellrepertoire* somatic

mu-tation* generearrangement*carbohydrate antigen

Introduction

The development of the antibody repertoire involves the

re-combination of individual members oftwo orthreegroupsof

germline segments, nucleotide insertion or deletion at these

junctions, and somatic mutation ofrearranged genes (1-4).

The individual contributions of these molecular mechanisms

Presented in part at the annual meeting of the Society for Pediatric

Research,New Orleans,LA, 2 May 1991, and published in abstract form(Pediatr. Res.29:155A).

Address correspondence and reprint requests toDr. William L.

Carroll,Program in Human MolecularBiologyandGenetics,

Univer-sityof Utah, Bldg.533,Salt LakeCity,UT84112.

Receivedfor publication14August 1991and inrevisedform5 No-vember 1991.

tothegeneration ofthe immune repertoire againstaspecific antigenhasbeenextensivelystudied in murine systems, but it

isuncertainwhether thesefindingscanbeextrapolatedto

hu-mans.The chromosomal organizationofthehuman heavyand

lightchain variableregionsegmentswithin the

immunoglobu-lin loci differ from those of mice(5-7). Furthermore,the

re-sponse ofhighlyinbred laboratoryanimalstrains,and theuse

ofsimple haptensinmoststudies,maynotbecomparablewith the human response to clinically relevant antigens, such as

thosepresentedbymicrobialpathogens.

The immune responseto Haemophilus influenzae typeb

capsularpolysaccharide (Hib PS)' isanexcellent model to

ex-amine theimmune repertoireto afunctionally significant anti-gen. Hib isamajor bacterial pathogenin young children and

antibodydirectedagainstthecapsular polysaccharide,a

repeti-tivepolymer ofpolyribosylribitol phosphate,protects against

invasive infection (8). Similartothe response to other polysac-charide antigens,theimmuneresponsetoHib PS is

age-depen-dent. Childrenunder5 yr have lowerantibodyresponses and

are atgreatest risk ofinfection. Additionally,there appear to be variations in individual and ethnic susceptibilities toinvasive

Hib disease(9-11). Analysis ofthe immune response to Hib PS will contribute to ourunderstandingof thedevelopmentofthe

human antibody repertoire, and provide insight into age-re-lated and possible geneticpredisposition to infection caused

byHib.

Previous studies employing partial amino acidsequencing

of anti-Hib PS serum antibody purified to clonality have shown that light chains of anti-Hib PS antibody are encoded

by

V.,

and at least three

V.

genefamilies (12). Althoughhighly informative, these studies have inherent technologic limita-tions. To obtain sufficient antibody for analysis, only

individ-ualswith antibody concentrations much higher than those elic-ited in young infants could be studied (12). Amino acid

se-quences were unobtainable on

V.-encoded

antibodies, and certain regionsofV,,-encodedantibodies (12, 13). Obtaining

nucleic acid sequences ofvariableregion genesencoding anti-Hib PS Abs would permitprecisecomparison ofvariable

re-giongenesobtainedfromdifferent individuals,allowing classifi-cation of these genes into germlinefamilies andsubfamilies, analysisofD- andJ-segmentusage,and assessment of the role of somatic mutation in the clonal evolution of this immune response. Additionally, this information could beapplied to examination of the germline and expressed immune repertoire

1. Abbreviations used in this paper: Ars, anti-p-azophenylarsonate;

Hib, Haemophilus influenzae type b; Hib PS, Hib capsular

polysaccha-ride; IgVL,light chain variable region gene; PCR, polymerase chain reaction; SSC, standard saline citrate.

Light Chain Immunoglobulin Sequences of J.Clin. Invest.

© The AmericanSocietyfor Clinical Investigation, Inc.

0021-9738/92/03/0729/10 $2.00

(3)

of individuals of variousages,andpopulationsathighriskfor invasive Hib infection.

Our previous work, and that of others, indicated that the heavy chains ofanti-Hib PS Abs are encoded by a very

re-stricted numberofVHIII gene segments,incombination witha

variety of D andJHsegments (12, 14). We have extendedour

studiestoexaminelight chain variable regiongene

(IgVL)

usage

inthe humananti-Hib PSresponse. Amajor component of serum anti-Hib PS Ab expresses a cross-reactive idiotype

asso-ciated with theuseofa

VJII

gene(15, 16). Antibodies

express-ing thislight chain account for the majority of anti-Hib PS antibody in older infants and adults following invasive Hib diseaseorimmunization. Most lambda-encoded Hib anti-bodies and some kappa-encoded

(VJI

and

VJIII)

anti-Hib PS Abs cross-react with the capsular polysaccharide ofE. coli Kl00 (12, 17). Naturally acquired antibody of the majority of children expresses KI00PScross-reactivity,andthus,

coloni-zation with this organism mayprovide protective immunity before exposure to Hib (18). Our results indicate that two

im-potantanti-Hib PSlightchains, oneassociated with

VJII

ex-pression and theother with lambda antibodies cross-reactive withKlIOPS,areencoded bytwogermlineelements thatmay

be

expressed

with littleor nosomatic mutation.

Moreover,

a

nwngermline-encoded arginineatthe VJjoint is seen in the majority of anti-Hib PSAblightchains,aresultsuggestingan essential role inantigen recognition.

Methods

Hybridomas. Heterohybridomas secretinghuman monoclonal anti-Hib PSantibodywereobtained,aspreviouslydescribed(14). Volun-teerswereimmunized with either plain Hib-PS vaccine (Praxis Biologi-cals,Rochester, NY)orHib-PSdiphtheria toxoid conjugate vaccine (Hib-PS-D) (Connaught Laboratories, Swiftwater, PA).7dfollowing immunization, peripheral blood lymphocytes were harvested and fusedtothenonsecretingmousemyelomaSP2/O-Agl4.Anti-Hib PS

Ab wasdetectedby bindingtoHib PS in an ELISA, aspreviously described (14). Specificity wasdocumented by antibody bindingto

'251-labeledantigen(19),andby inhibition ofbinding by1.25,gg/mlof soluble HibPSinanELISA(20).Cross-reactivitywithE.coliKI00 PS

wasassayedby inhibition ofbindingtoHib PS-poly-L-lysine with 100

ug/mlof solubleKI00 PS inanELISA. Anantibodyconcentrationwas

selected that gavehalf-maximumabsorbance in theELISA. Greater than 15%inhibitionwasconsideredpositive.The E.coli KIOOPSwas

preparedfromE.coli strainEaster,bythe same method used to prepare

HibPS(19).Thegeneration ofhybridoma line16M3C8wasdescribed previously (2 1).

Cloningand sequencingofIgVLgenes.Total RNAwasprepared from106hybridoma cellsusingtheguanidineisothiocyanatemethod (22).2 to8 uggoftotalRNAservedastemplatefor first-strand cDNA synthesis,aspreviously described(14). 10pmol ofaconsensus anti-sewne primer corresponding to conserved sequences within the

human kappa or lambda constant region (23)

(C.

codons

181-172:5'CAGCGTCAAGCTTCTGCTGTGGCTGTAGGT

3',

C,,

co-dons 171-181

:5'CAGGCTCAGGAAGCTITCTGGCCGCGTACTTG-TT 3)was used toinitiate cDNA synthesis byavianmyeloblastosis

virus (AMV) reverse transcriptase (RT; Life Sciences, St. Petersburg,

FL).One half(10Ml)of the cDNA reaction wasdirectly dilutedinto

polymerasechain reactions (PCR),(24).

PCRconditionswere aspreviously described,except that 70pmol ofan internal constant region consensus primer (C. codons

125-117:5'CAACGGATCCTCTGATGGCGGGAAGAT 3',

C.

codons 125-117:5'TGGGGATCCAGCTCCTCAGAGGAGGG 3') and 70 pmol ofa degenerate 3' kappa or lambda leader sequence primer

(kappa:5'GGGAATTCATGGACATG(GA)(GA)(GAXGATXTC)CC-(ACT)(GAC)G(TC)(GT)CA(GC)CTT 3', lambda

5'GGGAATTCA-

TG(GA)CCTG(GC)(AT)C(TC)CCTCTC(TC)T(TC)CT(GC)(AT)-(TC)C 3') were used to amplify rearranged variable region genes (14, 25).

PCRproductswereisolated from lowmelting-pointagarose gels

(FMCBioproducts, Rockland, ME).Artificial restriction enzymes sites in each primer allowed directional cloning into MI3mpl8 and Ml3mp19 phagevectors(BoehringerMannheimCorp.,Indianapolis, IN). Sequencing of VL genes was performed by thedideoxy technique

(26). Two to five positive clones were obtained and sequenced for each

hybridomagene.

The 16M3C8 lightchainwasgenerated by amplification of first-strandcDNA,withprimerscorrespondingtoamino acidpositions-7 of the leader, to position 6 of the lambda light chain (5'CTGCACAGGGTCCTGGGCCGAGCTCGTGGTGACTCA 3), and theCAconstantregion(antisense, 5'GCATTCTAGACTATTAT-GAACATTCTGTAGGGGC3'). Blunt-ended PCR products were

cloned intoSmaIcutM13mpl8andMI3mpl9andsequencingwas alsoperformed bythedideoxymethod.

Southern blotanalysisofgenomicDNA.Peripheral blood was

ob-tained from 10 unrelatedhealthyadultvolunteers,fromL.S.(the

do-norofhybridoma LSF2),and fromaparent ofL.S. Lymphocyteswere separatedon aFicoll-Hypaque gradient,andgenomicDNA was

pre-paredbyProteinase Kdigestion (27). 10Mgof eachsubject'sgenomic DNAwasdigestedwithBamHI(4U/,MgDNA) (Boehringer Mannheim Corp.)at370C for 16h,accordingtomanufacturer's specifications.

DigestedDNAwasseparated byelectrophoresisina0.8% agarosegel

usingTAE buffer(0.04MTris-acetate/0.00I MEDTA),and was trans-ferredtoDuralon UV membranes(StratageneInc.,LaJolla, CA), us-ingapositivepressureblottingapparatus(Posiblotter, Stratagene, Inc.).

To examinegermlinerepresentationofanti-HibPSIggenes,genomic

DNAwashybridized with a320-bp EcoRI/Smal VA segmentfrom

hybridomaLSF2 thatlacked theassociated

J.

andCAregions.Probe

wasradiolabeledtohigh specific activity usingT7DNApolymerase

(28).Prehybridizationandhybridizationswerecarriedout in 5X stan-dard saline citrate (SSC), 5X Denhardt's solution, and 200 Mg/ml

sheared and denatured salmon sperm DNA(BoehringerMannheim Corp.)at42°Covernight.Filterswerewashed with 2xSSC,0.2% SDS

at roomtemperaturetwice,then with0.2xSSC,0.2%SDSat55 to 60°C twice,andexposedtoX-OMAT AR film(EastmanKodakCo.,

Rochester, NY)for 2-7 d.

In ordertofurther localize germline candidates withinVregion families, an oligonucleotide probe corresponding to conserved se-quences within the CDR-1 region (sense oligonucleotide: 5'GGCTC-CAGCACTGGAGATGTCACCAGT 3', antisense oligonucleotide:

5'GTAGGGATAATGACCACTGGTGACATCTCC 3) was

hybrid-izedtogenomicDNAusingthemethoddescribed by Hellman (29).15 Mg ofBamHI-digestedhumangenomicDNAwasseparatedby

electro-phoresisin 0.8% agarosegel usingTBEbuffer (0.09MTris-borate/

0.002 MEDTA). Agarose gelsweredriedundervacuumand

hybrid-ized in 5Xsaline/sodiumphosphate/EDTA(SSPE), 0.1% SDS,and106

Mg/mlofsheared and denatured salmon sperm DNA with 2X106 cpm ofprobe/mlofhybridizationsolutionat60°Cfor 16h(30,31). Hybrid-ization conditionswerepreviously adjustedtominimizenonspecific

binding.Gelswerewashed with 6X SSCat roomtemperature for 20 mintwice, followed bya4-hroom temperature wash. Thegel was

finallywashed in6xSSCfor3 minat64°C,andexposedtoX-OMAT ARfilmfor 4 d.

Results

Hybridomas

Eight hybridoma

celllines fromsevenindividualswere

initially

selected from 20 cell lines.Allindividuals demonstrated sub-stantial increases inserumanti-Hib PS Ab 1moafter vaccina-tion(Table I).Hybridomaswereselected toexemplifyserologic characteristics (kappa or lambda expression, and Kl00 PS

(4)

TableI.SummaryofHybridomaCell Lines*

Serum Anti-Hib PS Ab

Total Ab XKlIOO Inh Vaccine KlOO Inh

Hybridoma Isotype Age Form of mAb Pre Post Pre Post

RC3 IgA/k Adult PS-D - 1.1 300 1 1 1 1

ED6.l

IgG2/k

4 yr PS-D - 0.8 22 0 0

SB5/D6 IgA

I/X

Adult PS-D + 2.0 688 30 27 RAY4

IgA2JX

Adult PS-D + 1.9 28 0 42 LSF2

IgAI/X

Adult PS + ND 138 ND 29 JB32 IgA1/X 11 yr PS + 0.3 125 19 33 JB21

IgGJ/X

il yr PS - 0.3 125 19 33

l6M3C8

IgG2JX

Adultt PS - ND ND ND ND

*Columns shownameofhybridomacellline, isotypeof anti-Hib PS Absecreted,age ofsubjectatimmunization,typeof vaccine(PSis plainpolysaccharide,PS-Dis Hib PScovalentlylinkedtodiphtheria

toxoid),presence(+)orabsence(-)of inhibitionofbindingof anti-Hib PS AbbyE.coli KlIOOPS,concentrationoftotalserumanti-Hib PS AB pre- and 1mopost-immunization,andpercent inhibitionof bindingofserumlambdaantibodiestoHib PSbyE.coltKlIOOPS in

pre-and 1 mopost-immunizationsera.*Poolof 3 adult donors.

ND,notdone.

cross-reactivity)

andtorepresent theresponse to

"T-indepen-dent"

plain polysaccharide,

or

"T-dependent"

polysaccharide-protein

conjugate

forms of

antigen. (Table

I).

Four

lambda-expressing

anti-Hib PS

Ab,

obtained from four different

subjects,

cross-reacted with K100 PS. One of

theseindividuals, RAY4,hadnodetectableserum

cross-reacti-vity before immunization. The Abs JB32 and JB21 were

ob-tained from thesame

individual,

anddiffered in

heavy

chain

isotype

andK1OO

cross-reactivity.

GermikeVIVII C AG ACT GTG

RAVO -.

S851DO . .. G .--

-LSF2 G .--

-.B32 G .

GTG ACT

IgV~ genes.

1gVL

nucleic acid sequences were obtained

fromtwo

kappa

andsix lambda

hybridomas.

Candidate germ-line

1gVL

sequenceswere

sought by comparing hybridoma

se-quencestothose

registered

withEMBLandGenBank

(32).

Four

lambda-expressing

hybridomas,

derived from four unrelated

subjects,

use

V,

segmentswhichare96-98%

homolo-goustoone

another,

andaremembersof the

germline

V5VII

family

of which a

single

member, 4A,has been

previously

de-scribed

(33)

(Fig. 1). Notably,

eachof these fourV5VII-encoded

hybridomas

cross-reactswith KlIOO PS. The

high degree

of

ho-mology

between thesesegmentssuggeststhat thesegenes may

be encoded

by

a

single,

orgroup

of, closely

related

germline

elements. Thefour

hybridoma

genesshareanumberof nucleic acid differences

(maximum

nucleic acid sequence

homology

89%)

from the

only

previously sequenced

VVII

germline

gene

4A,

implying

that thesegenes maybederived fromanother,as

yet

undescribed, V,~VII germline

element.

The

homology

of the translated amino acid sequencesof these4 VVII sequences

parallels

the nucleic acid

homology.

The

hybridoma

V~VIIgenesare90to97%

homologous

atthe amino acid level

(Fig. 2).

Framework

regions

are94 to 100%

homologous,

whereas CDR

regions

are72to96%

homologous.

Whether these minor differences reflect

genetic

polymor-phisms,

orsomatic

mutation,

cannotberesolved from these data.

JB21 and 16M3C8, the

lambda-expressing hybridomas

which donot cross-reactwithKlIOO

PS,

areencoded

by

aV511

gene

family

member

(34),

(Fig. 3).

JB21is 91%

homologous

to

the

germline

V.2.

1 gene

(99% homologous

inframework

re-gions

and 74%

homologous

in

CDRs).

16M3C8is 89%

homolo-gous to

V,2.

1

(95%

inframework

regions

and 77% in

CDRs).

JB21 shares 87% amino acid

homology

with the translated

V.2.

1

germline

sequence

(99%

inframework

regions

and 60% in CDR

regions),

and 16M3C8 shares 82% amino acid

homol-ogy

(92%

in framework

regions

and 60% in

CDRs)

(Fig. 4).

CDR.-1

TCC AGC ACT GGA GCA

...T

...T

...AT

.--GT

CAG GAG CCC TCA CTG ACT GTG TCC CCA GGA GGG ACA GTC ACT CTC ACC

--G

-30-GTC ACC AGT GGT

A...

TAC TAT CCA AAC C-T . .--C T..

C-T.--.-C T.. C-T . .--C T.. C-T - G-C

T--40 TGG TTC CAG CAG AAA CCT GGA

.G .- -C -G .- -C -G .- -C -G ., C

50 CAA GCA CCC AGG GCA CTG ATT TAT AGT

C . .- A-- -. .- GAA C . .- A-- -. .- GAA

C . . A . . -GAA

-C . . A .GAA

70

GGC TCC CTC CTT GGG GGC AAA

T .

CDR-2 ACA AGC AAC

. -G AAA CAC TCC

60

TGG ACC CCT GCC CGG TTC TCA

.-A

-.A .A

s0

GCT GCC CTG ACA CTG TCA GGT GTG CAG CCT GAG GAC GAG GCT GAG

-C .T -G.TC

-C .T ..G.-- -T

--C -T -G.-- -T

-C .T .G.--- -T. .--- -C

90 TAT TAC TGC CTG CTC TAC

-T T .- -. C-T- --G -C-T -A

-C-T. T . . -C. CDR-3

TAT GGT GGT GCT CAG

AC .-- - C

-G-GTA TTC

..A--100

GGC GGA GGG ACC AAG C TG ACC GTC CTA Ke.Oz.

Ke-Oz-gern~neJ52/3

Figure Nucleotidesequencesof theV,andJ,genes from fourhybridomacell lines(RAY4,SB5/D6, LSF2, JB32),andfrom the VVIIgermline

gene, 4A(33). NumberingisaccordingtoKabat(23).These sequence dataareavailable fromEMBL/GenBankDataLibraries under accession numbers M809 17(RAY4), M809 18(SB5/D6),M80915([SF2),andM809 19(JB32).

GermilneVIV1I I4AY4 S851DS LSF2 JB32 TGT GCT G C GC G C G C

QumlineVAVII

RAVO S851DO

LSF2 £B32

Germim VIVII

RAVO S51D/6

LSF2 J532

GerermoVIIII RAY4 S85/DO LSF2

(5)

20

-A---A - - -A

-- A

-WFQO KPGQA PRA L

T

-0DR-2 50

YST SNKHSWT

-E- S

-E - ----E

-E- N

--IE - - -

-s0 90

ALTL SGVOPE D EAEVY C LLY

...A --- -- -

s--...A --- --S

...A --- --S

.A -...0.D - F . -.S

CDR-1 30

A8SSTGAVTSGY YPN

G -H - -Y

GS ..--- --H- -V

G-- - - D- -- - H- -V

- - -0- -- - SH -AVY

60 P A

COR-3

YGGAQV FG G

-8S - -R- - -

--S- --8----.

- T- --R - - -

--SADR-.

.-G T K L T V LgorffdkwJ12/3

Figure2. Translatedamino acidsequencesof

V,

and

Jx

from fourhybridomacelllines(RAY4, SB5/D6, LSF2,JB32),andfrom theV~VII

germlinegene, 4A(33). (SeeFig. 1.)

Thesetwo

VJII-encoded

genesegmentsare91%

homologous

to

oneanother, and haveincommon anumberof nucleic acid differences fromthe

V.2.

1

germline

gene

(especially

in

CDRs).

Whether

they

derive fromanother

germline

gene, orwhether

thesedifferences reflectmutation, is unknown.

Allfourof the V~VII-encoded antibodiesarealsoencoded

by VHIII

segments

closely homologous

tothe

germline

gene9.1

(5).SimilarVHsegments also encode Ab

utilizing

other

V.

and

V,,

genesegments(Table

II) (manuscript

in

preparation).

Itis

uncertain whether

pairing

of9.1-likeVH and

V.VII-encoded

heavyand

light

chains contributesto

binding specificity

or

avid-ity.

JB21andRC3,alsoencoded

by

9.1-likeVHgenesegments,

but paired with

V.11-

and VKII-encoded

light

chains,

respec-tively,

donot cross-reactwith KlIOOPS.

Allsix of the lambda

light

chainsareencoded

by

a common

J,\ segment

closely homologous

to bothJ,\2 andJ,\3

germline

genes

(Fig.

1) (2

3).

J,\2

is associated with the use of the

(Kem-Oz-)C,\

segment2,and

JA\3

withthe

(KermfOz')CX

seg-ment3

(37).

Eachof these

J,\

segments substitutes the codon GTG for thereported

germline

sequenceGTAatamino acid

position 97.

Interestingly,

this

change

does not result in an

amino acid

replacement,

and isthereforenotof

importance

in

antigen binding.

This minorsequencedifferencemayreflecta

shared

genetic polymorphism,

ratherthan somatic mutation. The

hybridoma

RC3 uses a

V.II

segment identicalto the

germline

VJII

geneA2,anda

J1.3

segment

closely homologous

to the

germline

sequence

(Fig.

5) (13).The second kappa hy-brioma, ED6.1, is encoded by a memberofthe Vj

family

germiNeVA2.1 CAS TCT 0CC CTS ACT CAS OCT

£B21.. ..

16430..

SOCC TOC GOT TOT 050 TOT OCT GSA CGA TOO ATC

gormlin.VA2.1 ATC TCC TOO ACT GSA

£B21..

iwasc..e-S..

ACC AGO AGT

-O -..

CDR-1

OAT OTT

--0c ..

GaO AST

--T

SO-30

TAT AAC OTT OTC TOO TOO TAC

- TA-..

40

garmlinVA2.1 CAA CAS CAC CCA

£B21 A .

lowM308. A

GGC AAA GCC CCC AAA CTC ATS

-A 50

ATT TAT SAG

-.. T

O--...T

CDR-2

OGOC AGT AAO

-T- -0- --T

-T- TA- -TT

gerfmlinVA2.1 TCA

£B21..

Iow..08 A

so OTT TCT AAT

5.

--COC TTC TCT GGC TCC AAS

70

TOT SOC AAC ACS

--A

0CC TOC OTG ACA

-0

-..C

germllnVA2.1 ATC TCT SOS CTC CAS £621..

16M308 5--...A

80 OCT

C-

-SAG SAC SAG OCT SAT TAT TAC TOO TSC

A-A-

-*0

TCA TAT SCA GOT --- A-- ACC

ASS

A--Con-3

AOT AGC ACT TTA 'STA

C-C - OTC COG --G

SAC -C- *-. COG

--TTC SOC GOA 555 ACC AAS

-..A

-S

. G .

OTG ACC OTC CTA

Figure3.Nucleotide sequences ofV.andJ.genes fromtwohybridomacelllines (JB2 1 and 16M3C8).Alsoshown isagermlinegene V2. 1(34),

andgermlineJ.2/3gene(23).Anasterisk denotes thebeginningof theJ.,segment.NumberingisaccordingtoKabat(23).Thesesequencedata

areavailable fromEMBL/GenBankDataLibraries under accession numbers M809 16 (JB2l1)and M80921 (16M3C8). 732 E. Adderson,P.G. Shackelord,R. A.Insel,A.Quinn,P. M. Wilson,andW.L. Carroll

Germhne VA VII RAY4 885/D6 LSF2 JB32

GermkneVAVII RAY4 S85/D6 LSF2 J£32

Germnew VA VII RAY4 885/DO LSF2 J£32

70

F - -

-20 AOC

000 CCC

gerAmin VA2.1

£621 16M308

(6)

germHVneVA2.1 0 S A L T JB21

16M3C8

CDR-1 gernline VA2.1 T 0 T S S JB21

16M3C8 A - S

germlneVl2.1 A P K L M JB21

16M3C8

germlnk V12.1 S K S G N JB21

16M3CS

90

geomi. VA2.1 Y C C S Y

JB21 . s

16M3C8 - S

20

0 P A S V S G S P G 0 S T I S C

30 40

D V G S Y N L V S W Y 0 0 H P G K

A Y

50 CDR-2 00

Y E G S K R P S G V S N R F S 0

D V T N.- - - D

-L - D V Y -

-70 80

T A S L T S G L 0 A E D E A D Y

V - - - p

CDR-3

A G S S T L 'V F G 0 G T K L T V L germlno J A2/3

T T - T V R -R S D T - R

Figure 4.Translatedamino acidsequences of VAand JA genesfromtwohybridomacelllines (JB21and 16M3C8).Shown forcomparisonis the translated sequence of the VAgermlinegeneVA2.1, andJA2/3germlinegene. An asterisk denotes thebeginningofthe

J.

segment.(SeeFig.3.)

(36), and uses a

JA4

segment differingfrom the germline

se-quencebyasinglebase(Fig.6). The ED6.1 sequenceis identi-caltothepartial aminoacidsequencereportedpreviously for2

kappa antibodies purified fromserum(12).

VJjoints ofsevenof these eight hybridomaVL genes are

notableforthepresenceofanargininecodon(Fig.7).

Compari-sonof germlinesequencesindicatesthat in the RC3 VLgene,

the codon CGA could only havearisen by theaddition ofa

non-germline-encoded Gatthe

VJ,,

joint. In the VAVII-en-coded antibodies, the relevant germline

V.

segment is

un-known. Theargininecodonmaybegermline-encoded, or

re-sult from either mutation or N sequence addition. The VJ

splicejunctionin all lambdaantibodiesisidentical, implying this

VIJ.

combinationisanecessaryprerequisite for

genera-tionof thearginine. SincetheCDR-3region encodes thethird hypervariableregion,thefrequent finding ofanarginine resi-dueatthislocation,andparticularlyits presence in both kappa

TableH.SummaryofVHandVL GeneSegments*

Hybridoma VH Segment VL Segment

SB5/D6 VHIII9.1(5) VAVII4A(33)

RAY4 VHIII 9.1 VAVII4A

JB32 VHIII 9.1 VxVII4A

JB21 VHIII 9.1 VJI2.1 (34)

RC3 VHIII9.1 VIIA2 (13) LSF2 VHIII 9.1

VxVII

4A

16M3C8 VHIII VH26 (35) VJI2.1

ED6.1 N.K.

VJI

cloneKC-1 (36)

*Columns show name of hybridoma cell

line

and most closely

homologousknown germline VH and VL segments. Reference for

germlineshown in parentheses. NK, Not known.

andlambda anti-HibPS Abclonotypes, impliesthis residue is ofconsiderableimportanceinantigenbinding.

Southern

blots/analysis of

germline VAVII

genes

Theavailable repertoireofVAVII familymembers was exam-ined by hybridization of human genomicDNA with theVAVII

probegenerated fromLSF2. 10prominent bands,aswell asan

additional5 fainterbands,weredemonstrated (Fig. 8). Nota-bly, polymorphismsuchasthe presence or absence of a5.0-kb

fragment, and varying intensity ofthe 3.5-kb fragment, was demonstratedevenwithin thisrelativelysmallsample.The hu-manlambda variable region locus is believedtocontain about

60members,ofwhich 10aremembers oftheVAVII family(33, 38).The five lessprominentbandsmay represent membersof otherVA familiessharingsignificant homologywith theVAVII

family. Todetermineif the

VXVII-encoded

antibodies derive fromasinglegermline gene,anoliogonucleotide probe corre-sponding to conserved VAVII CDR-l sequence was used to

identify a single 3.7-kb genomic DNA fragment. Although

morethan one Vgene maybe present ina single restriction fragment, both the repeated isolation ofhighly homologous

VAVII genes, andthesingle prominant band detected with the oligonucleotide probe, suggeststhat asingle VA gene may be

responsible for the generation of lambda anti-HibPS Abthat cross-reactswithKI00 PS (Fig. 9). Less prominant higher

mo-lecular weightbands are alsopresent,buthybridize weaklyto theoligomer after subtraction of nonspecific background bind-ing by high molecular weightDNA.

Discussion

To examine the molecular basis ofthe immuneresponse toHib

PS,a panelofhybridomas secretinghuman monoclonal

anti-Hib PS Ab has been developed. Our previous studies showed

exclusiveuseof members of the VHIII genefamilyin this

(7)

germline A2 RC3

germline A2

RC3

D V M T 0 T P L S L S V T P G 0 P A S S C K

10 20

GAT ATT GTG ATG ACC CAG ACT CCA CTC TCT CTG TCC GTC ACC CCT GGA CAG CCG GCC TCC ATC TCC TGC AAG

,..

... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ...

S S 0 S L L H S D G K T Y L Y W Y L a K P

CDR 1 30 40

TCT AGT CAG AGC CTC CTG CAT AGT GAT GGA AAG ACC TAT TTG TAT TGG TAC CTG CAG AAG CCA ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ...

G 0 P

GGC CAG CCT

... ... ...

P 0 L L I Y E V S N R F S G V P D R F S G S G S

50 CDR-2 60

germline A2 CCA CAG CTC CTG ATC TAT GAA GTT TCC AAC CGG TTC TCT GGA GTG CCA GAT AGG TTC AGT GGC AGC GGG TCA RC3 ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ... ...

G T D F T L K S R V E A E D V G V Y Y C M 0 S

70 80 90

germline A2 GGG ACA GAT TTC ACA CTG AAA ATC AGC CGG GTG GAG GCT GAG GAT GTT GGG GTT TAT TAC TGC ATG CAA AGT RC3 - - - ... ... ... ... ... ... ... ... ... ... ... ... ... ...

I L P R F T F G P G T K V D K R CDR -3

germlineA2 ATA CAG CTT CCT C * TTC ACT TTC GGC CCT GGG ACC AAA GTG GAT ATC AAA CGT germline J,3 RC3 . . - - -. GA GG .. . ... ... ... ... ... ... .. A

Figure5.NucleotidesequencesofV,and J,genesfromthehybridomacelllineRC3.Alsoshownisthetranslatedamino acid sequenceofthe

RC3VK gene. Shownfor comparison is thenucleotidesequenceofagermlineV,,gene, A2 (13), andgermlineJ,3 gene. Anasterisk denotesthe

beginning oftheJ.,segment.Numbering isaccordingtoKabat(23). Thissequence datais available from EMBL/GenBankDataLibraries under accession number M80914 (RC3).

D I a

ED6.1 GAC ATC CAG

M T 0

ATG ACC CAG

S P S S L S

10

TCT CCA TCC TCC CTG TCT

A S

GCA TCT V

GTA

G D R

GGA GAC AGA

V T I

20 ED6.1 GTC ACC ATC

P C R

CCT TGC COO

A S 0 S CDR-1

GCA AGT CAG AGC

I S S Y 30

ATT AGC AGC TAT

L N W Y

TTG AAT TGG TAT

0 H K

EDO.1 CAG CAC AAA

0 s G

ED6.1 GGG

L T I

ED6.1 CTC ACC ATC

p

40 CCA

G K A P V L L I

GGG AAA GCC CCT GTG CTC CTC ATC

V P S R F S G S G S G 60

GTC CCA TCA AGG TTC AGT GGC AGT GGA TCT GGG

S S L 0 P E D F A T Y

80

AGC AGT CTG CAA CCT GAA GAT TTT GCA ACT TAC

L D T S N L

50 CDR-2 TTA GAT ACA TCC AAT TTA

T D F T

70

ACA GAT TTC ACT

Y C 0 0

TAC TGT CAA CAG

S Y T L

CDR-3

EDO.1 AGT TAC ACT CTC

P L T F G G G T K V E I K R

CCG *CTC ACT TTC GGC GGA GGG ACC AAG GTG GAG ATC AAA CGA

....T. germlineJx4

Figure6.Nucleotide sequence of VX and

J.

genes fromhybridomacellline ED6. 1. Also shown is the translatedaminoacid sequence of the ED6. 1 V,gene. An asteriskdenotesthebeginningof theJ,segment.Numberingisaccordingto Kabat(23).This sequence datais availablefrom

EMBL/GenBankDataLibrariesunderaccession number M80920(ED6. 1).

(8)

vx

germline A2 L P HIB RC3 -

-HIB ED6.1 T L

HIB RAY4

HIB SB5/D6 HIB LSF2 HIB JB32

VA

G A A D

HIB JB21 T V HIB I6M3C8 T T

Vx or 'N'

R

p

VA or 'N'

R

J.,

W T F G P G T K V D K R

F - - -germline

J.

3

L - - - G - - -

-L - - - G - - - germline J.4

JA

V F G G G T K L T V L

- - - gormlne J12/3

Figure7.Translatedamino acid se-quences of VJjointsfromseven

hybrid-omacelllines(RC3,ED6. 1, RAY4,SB5/ D6, LSF2, JB21,and 16M3C8).Also shownaretranslated amino acid

se-quences of thegermlineV.geneA2,and

germlineJ,3,J,4,andJA2/3genes.(See Figs. 2, 4,and6.)

muneresponse, and theapparentrestriction totwo or three germline VH genes. In contrast, VL gene usage is more complex, with antibody encoded by a number of

V.

and

V,

families (12).

Analysis of light chain variable regiongenesobtainedfromcell linesselectedto representvarious characteristics ofserum

anti-bodies showed that despite diversity in the variety oflight chain variable regiongene segments utilized,most serum anti-Hib PS Absmaybe encoded by a limited numberof

V.

and VA

germlinegenes.

1

2

3

4

5

6

7

8

9

10

11

12

21.2

-Wm-

41

414aw

A 0 4

Thelight chain distribution of anti-Hib PS Ab is character-izedbyapredominance of kappa light chains, althoughsome individuals predominantlyorexclusivelyexpresslambdalight

chains(39, 40).Scottetal.have shown that

VJI

light chainsare

themostcommonlyexpressedlightchainsamongclonally

puri-fiedserumanti-Hib PS antibodies from adults with high re-sponses toimmunization. Limited amino acid sequences ofa

number of these serum antibodies showed that greaterthan

60%ofsubjects immunized with plain HibPS produce

anti-body encoded by a

V.11

family member, andfurther, thata

number of these antibodies show identical amino acid homol-ogy with the translated aminoacidsequence of thegermline

V,11geneA2(12, 13).Lucasetal. havedescribedan

anti-idio-typic monoclonal antibody(Hibid-1)that identifies anti-Hib PS antibodiesexpressingthislightchain(16).Onaverage,60%

1

2

3

4

5

6

7

8

9

10

21.2

---

----I

4E-

-F _US _ , _- _b_ _ _m _ ,

2.0

- *

Figure 8. Southern blot analysis for VVII family members in

BamHI-digestedhumangenomic DNA. Lane 12 contains genomic DNAfrom thesubjectfrom whomhybridomaLSF2 was obtained. Lane 9contains genomicDNAfrom aparentof LS. The remaining

10 donorsareunrelated.Anarrowindicates the 3.7-kb fiagment

which is identifiedby theoligonucleotideprobeillustrated in Fig. 9.

5.1 - *.

Figure9.Driedgel hybridizationofBamHI-digestedhumangenomic DNA withanoligonucleotide probe correspondingtoconserved

VVIIhybridomaCDR-l sequences.GenomicDNA in lanes1,4, 5,

6,7,9 and1OofFig.8 corresponds to that in lanes2, 7, 4, 8,10,5

and 9 ofFig. 9, respectively.

LightChainImmunoglobulinSequencesofAnti-HaemophilusCapsularPolysaccharideAntibodies 735

4.Z-i" *.

I

.s-.f-. 41.# "

:,

(9)

of the total anti-Hib PS antibody of most children and adults immunized with either Hib PS or Hib PS-conjugate vacine expressesthis idiotype (15, 16). Taken together, this suggests the mostcommon clonotype of anti-Hib PS Ab is encoded by a single

VJII

gene. The

V,

locus contains approximately 50

functionalgenes, of which 40% are members of the

VJI

family (41). The

VJII

A2 germline gene is known to be present in a

singlecopy(13). Ourfindings definitivelydemonstratethat at least aportionof

VJI-encoded

antibodies are encoded by un-mutatedgermlineelements. Oursubject R.C. was immunized with PS-protein conjugate vaccine, whereas Scott's subjects wereimmunized with the plain PS vaccine. Thus it is possible that theunmutated

VJII

A2 segment is utilized irrespective of

antigenpresentation inaT-independentorT-dependent form. Lambdavariable region gene usage appears similarly re-stricted. Themajority oflambda-expressing anti-Hib PS Ab in adults with high antibody responses to vaccine cross-reacts with E.coiiKI00 PS (17). The capsular polysaccharides of Hib

andE. coliK100 arestructurallysimilarandgastrointestinal colonizationwithE.coliKI00inducesantibodytoHibPS in humans (42). "Naturallyoccurring" anti-HibPS Ab in chil-drencommonlycross-reactswithKI00PS,whereas Ab

ofindi-vidualsimmunizedwith Hib PS or responding to Hib infection

islessfrequently cross-reactive (18).The kappa/lambda ratio

ofnatural anti-Hib PS Ab islower in infants than in older

children, andin thevaccine-inducedantibody ofadults(39). Further, Hibid-1 (the CRI associated with expression ofthe V

KII

light chain) is expressed less frequentlyandcomprisesa smaller proportion oftotal anti-Hib PS Ab in preimmune compared with postimmunizationsera.Expression of Hibid-l following immunization is similar in adults and children. Theseresultsimplythatcross-reactiveantigensmayinduce the

naturalantibody of children.KI00PS-cross-reactiveantibody

mayprovide protective immunityin youngchildrenuponfirst

exposuretoHib.Thesecross-reactive antibodiesappeartobe

subsequently replacedordominated byantibody specific for

HibPS whenindividualsareexposedtothisantigen by immu-nization, coloimmu-nization,orinfection.Wedemonstrate thatcross

reactivity oflambda antibodies may be mediated through a

singlelightchaingermlinegene. Themechanism forthe clonal

dominance ofthe

VJI

antibodies is unclear;the

avidity

for Hib

PSoftheseKIOOPS-cross-reactive antibodies fromadults is

similarto thatof Hib

specific

PSantibodies

(P. Shackelford,

unpublished observation).

Lambdaantibodiesexpressingthe

VJII

genedidnot

cross-reactwithE.coli KI00 PS. Whether allnoncross-reactive anti-bodiesareencodedbycloselyrelated membersofthe

VJI

gene

familywillrequire further characterization of additional anti-bodies.

By the age of about5 yrmostindividuals have

acquired

protective anti-HibPS Ab. Allofthehybridomasin thisstudy

werederivedfrom olderchildrenoradults,who haddetectable

preimmunization antibody. TheBcells immortalized by

fu-sion,therefore,mostlikelyrepresentasecondaryimmune re-sponse. Despite this, VH gene segments obtained from these

hybridomasappeartoberelativelyunmutated(14),andit ap-pears thatsomeVL genesaresimilarlyconserved. The RC3 V,, gene segment is identical to the A2

germline

gene, and

al-though thepertinent VAVII germlinegene is notknown,the

paucity ofdifferences in ViVII segments from fourdifferent subjectssuggeststhesegene segmentsare

relatively

unmutated. J, and

J.

segmentsarealso

highly homologous

to

germline

ele-ments. Thus, at least a portion of the anti-Hib PS response represents the useofunmutatedgermlineelements.

VJjoints ofthe majority of rearranged VL genes also appear

tobe an additional sourceofrestriction in theanti-Hib PS immune response. Although there is variability in the use of

J.,

segments, VKI-encoded VL genes arecharacterizedby the

pres-enceofanarginineatamino acidposition95a(13).Inthe RC3 VL gene and at least one ofthe antibodies (B-G2a) described by

Scott, thisappearstohavearisen byNsequenceaddition. In

four other kappa antibodies described by Scott, alternative

joiningmay havegenerated this invariant arginine (13).Allof the lambda VL genes in the present study aresimilarly

charac-terized byaninvariant arginine-96. ThegermlineVAVII

seg-mentisnotknown; thereforethemechanismused to generate

thiscodonis uncertain.Theinvariantpresenceof thisresidue in many anti-Hib PS Abs supports the previous suggestion that

itmay beofgreatimportanceinantigen binding(13).This also

is supported bystudiesofthemurine anti-p-azophenylarsonate

(Ars) response.Anti-Arslight chainsalsocontainaninvariant arginineatposition 96,encodedby intracodonicsplicing ofa

single

V,

(Vl0-Ars)

and a singleJ,

(J,1)

segment (43). This

arginine is essential forArsbinding, and the substitution of tyrosine for argininehas been shown toabolish binding (44).

The presenceofarginine residuesclusteredwithinthe CDR's of theheavy chains of murine anti-DNA antibodiescorrelates

with increased affinity, and the arginine requirement in the anti-Hib PS response mayindicate itsparticipationin the

rec-ognition

ofthesimilar phosphate-ester linkage oftherepeating carbohydrate moiety (45). Thus, although diversity existsin the

useofa

variety

ofVand J segments,certainVJ

combinations,

which produce argininecodons byjunctional flexibilityorN

segment

addition,

may bestronglyselected.

Does therestrictednatureofVH and VL segment usage in the humananti-HibPS response

explain

theage-related

acqui-sition of

immunity

to this

organism?

In both miceand hu-mans,preferentialuseof certain VH gene segmentsisobserved inearly development.In

mice,

biasedusage ofJH-proximal VH

gene segmentsoccursinfetal andneonatal animals(46, 47). Developmental

regulation

ofVLgene usageisless

extensively

studied than VH genes. Teale and Morris noted

preferential

expression

ofcertain

V,

familiesinLPS-stimulated murine

fe-tal B cellscomparedtoadultBcells, withnoevidencefor

posi-tion-dependent bias

(48).

Kaushiketal.alsodescribed

nonsto-chasticuseof

VK

familiesinadult

mice,

suggesting

molecular

constraintsmay

persist beyond

theneonatal

period (49).

Two

orthreeVHgene segments, anda

single

V.

anda

single

V,

gene segments, appeartoencodea

large

proportion

of anti-HibPS Ab in immune

subjects.

Theuse of

highly

conservedVgene segments in human anti-Hib PS response may

place

consider-able restraintsonthe immune response.The

inability

toutilize these genes, whether due to chromosomal

position

or other molecularconstraints, may be

responsible

for the

age-related

susceptibility

toHib infection. The lack ofsomatic

hypermuta-tion ina

portion

ofthese antibodies would also

place

greater

dependenceonthe

germline

repertoire,

in that it may be

impos-sible to

improve

antibody affinity by

antigen-driven

selection

of favorable mutations. The absenceor

polymorphism

ofthese genes also may contributetoindividual and ethnic

susceptibil-ityto invasive Hib disease. In

addition,

the

repertoire

differ-ences detected in some individuals

(such

as the absence of

kappa

antibody,

ortheabsence oftheVII-associated CRI)may

be

explained

by

theuseofotherminor

light

chains.An

(10)

ual missing the A2 germlinegene has beendescribed, although

the functional implications of such a deletion are not

known(13).

Expression of certain VHgenefamily members in miceis correlated with B cell subpopulations (50).An alternative

expla-nation for thepoorresponsetoplain HibPSmaybe a

matura-tional delay in recruitment ofa critical B cellpopulation that

selectivelyexpressesimportantvariable

region

gene segments. We and othersnotethatanarginineisexpressedattheVJ joint in the great majority of anti-Hib PS light chains.In some cir-cumstances- N segment addition isrequired to generate this codon. The additionofthese extranucleotidesisinfrequentin light chain recombination, suggestingthat theseBcell precur-sors maybe relatively infrequent(51). Moreover,N segment

addition alsoappears tobedevelopmentallyregulated.

Neona-tal murine B cells lack N sequences, and theirpresence in heavy chain recombination increaseswithtime(52). In addi-tion, N sequenceadditionmayalsocorrelate withcertainBcell subsets. N segments appear to be rare in Ly1-B cell-derived populations (53).

Incontrast to plain polysaccharide vaccines, mostyoung

infants respond well to the newer Hib-PS protein conjugate vaccines (54). It ispresentlyunknown if thisantigen formula-tion recruits an alternative antibody repertoire, or if, by an uncertain mechanism, developmental restriction ofa "dor-mant"Bcell subset is overcome. To address thisquestion,V geneexpressionininfantsmustbe examined.

Acknowledgments

The authors thank Drs. Moon H. Nahm, Dan M.Granoff, Alan L.

Schwartz, andHarveyR.Coltenfor helpful discussionandreview of this manuscript, and Mrs. Darlene Bradley for preparation ofthe

manuscript.

This work was supported by the Lattner Foundation, the Allison Hope Hollenbeck Fund, grant 61fromthe Marchof Dimes,the Mar-key Center in MolecularBiology ofHumanDiseasesatWashington University,grantRO IA119350 and Al 17217fromtheNational

Insti-tutesof AllergyandInfectious Diseases,grantRR-36fromtheGeneral

Clinical ResearchCenter, National Institutesof Health, and aPediatric FellowshipAward (E. E. Adderson)from Connaught Laboratories,Inc.

References

1.Tonegawa, S. 1983. Somaticgeneration of antibody diversity. Science (Wash.DC).302:575-581.

2.Akira, S.,K.Okazaki,and H.Sakano. 1987. Twopairs of recombination signalsaresufficientto causeimmunoglobulinV4D)-Jjoining. Science (Wash. DC). 238:1134-1138.

3.Alt, F. W., T. K. Blackwell, and C. D. Yancopoulos. 1987. Development of theprimary antibody repertoire. Science(Wash. DC).298:1079-1087.

4.French, D. L., R. Laskov, and M. D.Scharffi 1989. The role of somatic

hypermutation in the generation of antibody diversity. Science (Wash. DC). 244:1152-1157.

5. Berman, J. E., S. J. Mellis, R. Pollock, C. L. Smith, H. Suh, B. Heinke, C. Kowal, U.Surti,L.Chess, C. R. Cantor, et al. 1988. Content and organization of thehumanIgVHlocus:definitionofthree new VH families and linkage to theIgCH

locus.EMBO (Eur.Mol. Biol. Organ.) J.7:727-738.

6.Krawinkel,V., T.Christoph,andT.Blankenstein. 1989. Organization of the Ig VH locus inmiceandhumans. Immunol. Today. 10:339-344.

7.Straubinger,B., E. Huber, W. Lorenz, E.Osterholzer,W. Pargent, M. Pech, H.-D.Pohlenz,F.-J.Zimmer, and H. G. Zachau. 1988. The humanV.

locus-characterizationofaduplicated region encoding 28 differentimmunoglobulin

genes.J.Mol. Biol. 199:23-34.

8. Robbins, J. B., J. C. Parke, Jr., R. Schneerson, and J. K. Whisnant. 1973.

Quantitativemeasurementof"natural"andimmunization-induced

Haemophi-lusinfluenzaetypebcapsularantibodies.Pediatr.Res.7:103-1 10.

9.Ward,J.J.,H.S.Margolis,M.K.Lum,D. W.Fraser,and T. R. Bender. 1981.Haemophilus influenzaedisease in Alaskan Eskimos:Characteristicsofa

populationwithanunusualincidenceof invasive disease. Lancet. 1:1281-1285.

10.Coulehan,J.L.,R. H.Michaels,C.Hallowell,R.Schults,T. K.Welty,and J. S. C. Kuo. 1984. EpidemiologyofHaemophilus influenzaetypebdisease

amongNavajoIndians. Public HealthRep.99:404-409.

11.Granoff,D.M.,P. G.Shackelford,B. K.Suarez,M. H.Nahm,K. L.Cates,

T. V.Murphy,R.Karasic,M. T.Osterholm,J.P.Pandey,and R. S. Daum. 1986.

Haemophilus influenzaetypebdisease in children vaccinated withtypeb

polysac-charide vaccine. N.Engl.J.Med.315:1584-1590.

12.Scott,M.G.,J.J.Tarrand,D. L.Crimmins,D. W.McCourt,N. R.Siegel, C. E.Smith,and M. H. Nahm. 1989. Clonalcharacterizationof the humanIgG antibodyrepertoiretoHaemophilus influenzaetypebpolysaccharide.II. IgG

antibodies containVHgenesfromasingle VH familyandVLgenesfromatleast fourVLfamilies.J.Immunol. 143:293-298.

13.Scott,M.G.,D. L.Crimmins,D. W.McCourt,I.Zocher,R.Thiebe,H.G.

Zachau,and M. H. Nahm. 1989. Clonalcharacterizationof the humanIgG antibodyrepertoiretoHaemophilus influenzaetypebpolysaccharide.III. A

sin-gleVJIgeneandoneof severalJKgenesarejoined byaninvariantarginineto

form themostcommonL chain Vregion.J. Immunol. 143:4110-4116.

14.Adderson,E.E.,P. G.Shackelford,A.Quinn,and W. L. Carroll. 1991. Restrictedimmunoglobulin heavychain V gene usage in the humanantibody

response toHaemophilus influenzaetypebcapsularpolysaccharide.J.Immunol.

147: 1667-1674.

15.Lucas,A.H.,and D. M. Granoff. 1990. Amajorcross-reactiveidiotype

associated with human antibodiestotheHaemophilus influenzaetypebcapsular

polysaccharide.J. Clin. Invest.85:1158-1166.

16.Lucas,A.H.,R. J.Langley,D. M.Granoff,M. H.Nahm,M. Y.

Kita-mura,and M. G. Scott. Anidiotypicmarker associated with thegerm-line

en-codedkappa lightchain variableregionthatpredominatesthevaccine-induced

humanantibodyresponse totheHaemophilus influenzaebpolysaccharide. J.

Clin. Invest.88:1811-1818.

17.Tarrand,J.J.,M. G.Scott,P. A.Takes,and M. H. Nahm. 1989. Clonal

characterizationof the humanIgG antibodyrepertoiretoHaemophilus

influen-zaetypebpolysaccharide.J. Immunol.142:2519-2526.

18.Insel,R.A.,and P. W. Anderson. 1982.Cross-reactivitywithEscherichia

coliKIOOin the humanserumanticapsular antibodyresponsetoHaemophilus

influenzaetypeb.J.Immunol. 128:1267-1270.

19.Granoff,D.M.,P.G.Shackelford,J. P.Pandey,andE.G. Boies. 1986.

AntibodyresponsestoHaemophilus influenzaetypebpolysaccharidevaccine in relationtotheKm(l)andG2m(23) immunoglobulinallotypes.J.Infect.Dis.

154:257-264.

20.Shackelford,P.G.,D. M.Granoff,S. J.Nelson,M.G.Scott,D. S.Smith,

andM. H. Nahm. 1987. Subclassdistributionof human antibodiesto

Haemophi-lusinfluenzaetypebcapsularpolysaccharide.J. Immunol. 138:587-592.

21.Gigliotti,F.,L.Smith,andR. A. Insel. 1984.Reproducible productionof

protectivemonoclonal antibodiesbyfusion ofperipheralbloodlymphocyteswith

a mousemyelomacell line.J.Infect.Dis. 149:43-47.

22.Chirgwin,J.M.,A. K.Przybyla,R. J.MacDonald,andW. J. Rutter. 1979. Isolation ofbiologicallyactive ribonucleic acid and fromsourcesenriched in

ribonuclease.Biochemistry. 18:5294-5299.

23.Kabat,E.A.,T. T.Wu,M.Reid-Miller,H. M.Perry,and K. S.

Gottes-man.1987.Sequence ofProteinsofImmunologicalInterest.U.S. Public Health

Service,Bethesda,MD.

24.Saiki,R.K.,D. H.Gelfand,S.Stoffel,S. J.Scharf,R.Higuchi,G. T.Horn,

K. B.Mullis,and H. A. Erlich. 1988. Primer directedenzymatic amplificationof DNA withathermostableDNApolymerase.Science(Wash. DC).239:487-491.

25.Larrick,J.W.,L.Danielsson,C. A.Brenner,E. F.Wallace,M.

Abraham-son,K. E.Fry,andC. A. K.Borrebaeck.1989.Polymerasechain reactionusing

mixedprimers:cloningofhuman monoclonalantibodyvariableregiongenes fromsingle hybridomacells.Biotechnology.7:934-938.

26.Sanger,F.,S.Nicklen,and A. R. Coulson. 1977. DNAsequencingwith

chain-terminatinginhibitors. Proc.Natl.Acad. Sci. USA.79:5463-5467.

27.Davis,L.G.,M. D.Dibner,and J. F.Battey. 1986. Preparation ofDNA fromeukaryoticcells:General method.InBasicMethods of MolecularBiology.

L. G.Davis,M. D.Dibner,andJ. F.Battey,editors.Elsevier,New York. 44-46. 28.Feinberg,A.P.,and B.Vogelstein. 1983.Techniqueforradiolabelling DNA restriction endonucleasefragmentstohigh specificactivity. Anal. Biochem.

132:6-13.

29.Hellman, L.,andV. Petterson. 1987.Analysisofcloselyrelated genesby theuseofsyntheticoligonucleotide probeslabelledto ahighspecificactivity.

Gene Anal. Tech. 4:9-13.

30.Tsao,S.G.,C. F.Brunk,and R. E. Pearlman. 1983.Hybridizationof nucleic acidsdirectlyin agarosegels.Anal. Biochem. 131:365-372.

31.Miyada,C.G.,C.Klofelt,A. A.Reyes,E.McLaughlin-Taylor,andR. B. Wallace. 1985. Evidence thatpolymorphismin the murinemajor histocompati-bility complexmay begeneratedbyanassortmentofsubgenesequences. Proc.

Nat[.Acad. Sci. USA82:28902894.

32.Devereux, J.,P.Haeberli,and0. Smithies. 1984. A comprehensive set of

sequenceanalysisprograms for the Vax. Nucleic Acids Res. 12:387-395.

(11)

33.Anderson, M. L. M., M. F. Szajnert, J. C. Kaplan, L. McColl, and B. D. Young.1984. The isolation ofa human Ig VA gene from a recombinant library of chromosone 22 and estimation ofthe copy number.NucleicAcidsRes. 12:6647-6660.

34.Brockley, F., D. Alexandre, P. Chuchana, S. Huck, G. Lefranc, and M.-P.

Lefranc. 1989. First nucleotidesequenceofahumanimmunoglobulinvariable X genebelongingtosubgroupII.Nucleic AcidsRes.10:3976.

35.Chen,P.P., M.,Liu, S., Sinha,and D. A.Carson. 1988.A16/6

idiotype-positive anti-DNA antibody is encoded byaconservedVH genewithnosomatic mutation. Arthritis Rheum. 31:1429-1431.

36. Kato, S.,K.Tachibana,N.Takayama,H.Kataoka, M.Yoshida,and T. Takano. 1991. Genetic recombination in chromosomal translation

t(2;8Xpl l;q24) ofaBurkitt's lymphoma cell line, KOBKl0l. Gene (Amst.).

97:239-244.

37. Udey,J., and B.Blomberg. 1987.Human Xlight chainlocus: Organiza-tionandDNA sequencesof three genomicJregions.Immunogenetics. 25:63-70.

38. Chuchana, P.,A.Blancher,F.Brockly,D.Alexandre, G.Lefranc, and

M.-P.Lefranc.1990.Definition ofthehumanimmunoglobulin variablelambda (IGLV) gene subgroups. Eur. J.Immunol. 20:1317-1325.

39.Ambrosino,D.M.,W.Greif, C. Thompson, and G.R.Siber. 1990.Kand A

light chain composition ofantibodyto thecapsularpolysaccharide ofHaemophi-lusinfluenzaetypeb.J.Infect.Dis. 161:922-925.

40. Insel,R. A., P.Anderson,M. E.Pichichero, S. Schuster,M.D. Amster,G.

Ekborg, and D. H.Smith. Anticapsular antibodytoHaemophilusinfluenzae.In

Haemophilus Influenzae. S.H.Selland P. F.Wright, editors. Elsevier,NewYork.

115-168.

41.Meindl,A., H.G. Klobeck,R.Ohnheiser,and H.G.Zachau.1990.The

VKgenerepertoireinthe humangermline.Eur. J.Immunol. 20:1855-1863.

42.Schneerson, R., and J. B. Robbins. 1975. Induction ofserum Haemophi-lusinfluenzaetypebcapsular antibodiesin adult volunteersfedcross-reacting

Escherichia coli075:K1OO:H5.N.Engl.J.Med.292:1093-1096.

43.Sanz, I., and J.D.Capra. 1987. V, and J,gene segments ofA/JArs-A

antibodies: Somaticrecombinationgeneratesthe essentialarginineatthe

junc-tion of the variable and joining regions. Proc. Natl. Acad. Sci. USA 84:1085-1089.

44.Jeske, D. J., J. Jarvis, C. Milstein, and J. D. Capra. 1984. Junctional

diversityis essential toantibody activity.J. Immunol. 133:1090-1092.

45.Shlomchik, M., M. Mascelli, H. Shan, M. Z. Radic, D. Pisetsky, A. Mar-shak-Rothstein, and M. Weigert. 1990. Anti-DNA antibodies from autoimmune mice ariseby clonal expansion and somatic mutation. J. Exp. Med. 171:265-297. 46.Yancopoulos,G.D., S. V.Desiderio, M.Paskind,J. F.Kearney, D.

Baltimore, and F. W. Alt. 1984. Preferential utilization ofthe most JH-proximal VH genesegments in pre-B-cell lines. Nature (Lond.). 311:727-733.

47.Perlmutter,R. M., J. F. Kearney, S. P. Chang, and L. E. Hood. 1985. Developmentally controlledexpressionof immunoglobulinVH genes.Science

(Wash. DC). 227:1597-1601.

48.Teale, J. M., and E. G. Morris. 1989.Comparisonof V, gene family expression in adult and fetal B cells. J. Immunol. 143:2768-2772.

49. Kaushik, A., D. H. Schulze, C. Bona, and G. Kelsoe. 1989. Murine VK gene expression does not follow the VH paradigm. J. Exp. Med. 169:1859-1864. 50.Jeong, H. D., and J. M. Teale. 1990.ContributionoftheCD5+Bcell to

D-proximalVH familyexpression earlyin ontogeny. J.Immunol.

145:2725-2729.

51.Carroll,W.L., C. 0.Starnes,R.Levy, andS. Levy. 1988.AlternativeV, generearrangements in a murine B celllymphoma.Anexplanationfor idiotypic

heterogeneity.J.Exp.Med. 168:1607-1620.

52. Feeney, A. J. 1990. Lack of Nregionsinfetal and neonatalmouse immu-noglobulin V-D-J junctional sequences. J. Exp. Med. 172:1377-1390.

53. Gu, H., I. Forster, and K.Rajewsky.1990.Sequencehomologies,N se-quence insertion and JH gene utilization in VHDJHjoining: implicationsfor the

joiningmechanism and theontogenictimingofLylB celland B-CLLprogenitor generation. EMBO (Eur. Mol.Biol.Organ)J.9:2133-2140.

54.Eskola, J.,H.Kayhty,H.Peltola,V.Karanko,P. H.Makela,J. Samuel-son, and L. K. Gordon. 1985.Antibodylevels achieved in infantsbycourseof

Haemophilus infleunzaetype bpolysaccharide/diphtheriatoxoidconjugate

vac-cine.Lancet. 1:1184-1186.

References

Related documents

Hence, it is now accepted that transgenesis can be used to increase the contents of bioavailable iron and zinc in the starchy endosperm of cereals (white flour of wheat and

Large myd mice at this level were phenotypically distinct - the cortical hemispheres were separate, and multifocal defects were present, with migration of

Gene pathways related to forebrain development in budgerigar lineage-specific EBRs and avian and archosaurian msHSBs. Budgerigar lineage-specific EBRs (top box) are enriched for

the CpG O/E and experimentally deduced methylation ratio.. The relationship between methylation and gene expression in H. B) Density plots for expression data for

As the host embryos are placed into the methylcellulose, roll them into position so that the targeted region is uppermost, since during transplantation the needle will enter the

Effects of Personal Characteristics on Serum CA125, Mesothelin, and HE4 Levels in Healthy Post-menopausal Women at High-Risk for Ovarian Cancer..

The development of the fisheries sector in Liberia is highlighted by little or no legislative framework to govern or manage the fisheries, the intervention of

The study will attempt to understand if using imagery will influence children’s motivation to participate in leisure-time physical activity (free time active play). POTENTIAL