Copyright 0 1997 by the Genetics Society of America
Insertions of a Novel Class of Transposable Elements With a Strong
Target Site Preference at the
r
Locus of Maize
Elsbeth L. Walker,*'+
William
B. Eggleston,: Demetrios Demopulos,59' Jerry Kermicles
and
Stephen L. Dellaporta"
*Department of Biology, Yale University, New Haven, Connecticut 06511, +Department of Biological Sciences, M o u n t Holyoke College, South Hadley, Massachusetts 01075, :Department of Biology, Virginia Commonwealth University, Richmond, Virginia 23284 and
sLaboratoly of Genetics, University of Wisconsin, Madison, Wisconsin 53706
Manuscript received June 8, 1996 Accepted for publication March 10, 1997
ABSTRACT
The rlocus of maize regulates anthocyanin synthesis in various tissues of maize through the production of helix-loophelix DNA binding proteins capable of inducing expression of structural genes in the anthocyanin biosynthetic pathway. The complex r variant, R-r:standard (R-r) , undergoes frequent muta- tion through a variety of mechanisms including displaced synapsis and crossing over, and intrachromoso- mal recombination. Here we report a new mechanism for mutation at the R-r complex: insertion of a novel family of transposable elements. Because the elements were first identified in the R ~ I gene of the
R-r complex, they have been named P Instability Factor ( P I 4 . Two different PIF elements were cloned and found to have identical sequences at their termini but divergent internal sequences. In addition, the PZFelements showed a marked specificity of insertion sites. Six out of seven PIFcontaining derivatives examined had an element inserted at an identical location. Two different members of the PIFelement family were identified at this position. The seventh PIFcontaining derivative examined had the element inserted at a distinct position within r. Even at this location, however, the element inserted into a conserved target sequence. The timing of PIF excision is unusual. Germinal excision rates can range up to several percent of progeny. Yet somatic sectors are rare, even in lines exhibiting high germinal reversion rates.
T
HE r-superfamily of genes in maize regulates the accumulation and distribution of anthocyanin pig- ments in various tissues of maize through the produc- tion of myc-homologous DNA binding proteins capable of inducing expression of structural genes in the antho- cyanin biosynthetic pathway (DOONER et al. 1991). The r-superfamily includes genes at the rlocus (DELLAPORTA et al. 1988), the b locus (CHANDLER et al. 1989), and the displaced r genes LC (LUDWIG et al. 1989) and Sn (CONSONNI et al. 1992) that are located 2 cM distal to the r locus on chromosome 10. At the T locus, both simple and complex gene arrangements are found. In simple r alleles, e.g., R-nj (DELLAPORTA et al. 1988), a single gene is present; r complexes, e.g., R-r (STADLERand NUEFFER 1953; DOONER and KERMICLE 1971; ROE
BINS et al. 1991; WALKER et al. 1995) and R-st (R-stippled)
(ASHMAN 1965; EGCLESTON et al. 1995), consist of sev-
eral r genes. Often the genes within a complex have different patterns of expression, thus causing anthocya- nin accumulation in distinct tissues or sets of tissues.
The r complex R-r:stundard (R-r) has been the subject of numerous genetic studies (STADLER and NUEFFER
Corresponding author: Stephen L. Dellaporta, Department of Biology,
Yale University, New Haven, CT 06520-8104. E-mail: [email protected]
'
Presrnt addre.rs: 1319 Main St., Fitchburg, MA 01420.Genetics 146: 681-693 (June, 1997)
1953; STADLER and EMMERLING 1956; ASHMAN 1965;
DOONER 1971; DOONER and KERMICLE 1971, 1974, 1976) and, more recently, of molecular analyses (ROE
BINS et al. 1991; WALKER et al. 1995). The R-r complex is made up of two distinct regions: the proximal Pcom- ponent and the Ssubcomplex. The P component con- tains the R-p gene that confers color to the coleoptile, seedling leaf tip, roots and anthers. The Ssubcomplex contains two functional R-s genes (R-sl and R-s2) that confer pigment to the aleurone layer of the endosperm of seeds, and a third, nonfunctional gene called r-q,
which lacks r coding sequences and retains only 5' r-
homologous sequences, ie., it is an R-p promoter with- out a coding region attached. The two R-s elements are in an unusual head-to-head arrangement and appear to share a common, bidirectional promoter called CT (WALKER et al. 1995). These four genes of the R-r com- plex are arranged in the order R-p r-q R-sl R-s2, with all elements except R-sl oriented with 5' ends proximal (Figure IA). The organization of the R-r complex ap- pears to have resulted from a transposon-mediated rear- rangement event. Evidence for this conclusion stems largely from the presence of remnants of the transpos- able element, doppiu, found at the breakpoints within the elements of the Ssubcomplex (r-q, R-SI and R-s2)
E. L. Walker d nl. 682
A
B
P
-
9 Sf 52"
-190 kb -10 kb 0
R-r
dlsDlaced
R-g NCO R-; co r-r NCO r-r CO
[P'l s1 s 2 [pxq] S1 S2 P q [SI A s 2 1 I PXS2 1
I
t
0.8-43.3 X 10-3
[P'] q s1 52 R-r*
FIGURE 1.-(A) Structure of the R-r complex (WALKER d
nl. 1995). The complex is made up of three intact rgenes, R-
p,
R-sl, and R-s2, and one nonfunctional truncated gene, r-q.The orientation of R-p, r-q, and R-s2 is 5' proximal, as indi- cated by the directions of the arrows. The R-SI gene is in the opposite orientation, with 3' proximal. Because of their close proximity, the 7-9, R-SI, and R-s2 genes are referred to collec- tively as the .$subcomplex. The R+ gene is located at a dis- tance of -190 kh from the genes of the .$subcomplex. (R) Instability of R-r and it5 derivatives. R-r gives rise to R+Ioss (R-g) and R-+loss (r-r) derivatives at the frequencies shown. Derivatives belonging to the R-g NCO class back mutate to R-
rat the frequencies shown (DEMOPUI.OS 1985). The resulting component structure is shown for derivatives resulting from displaced synapsis and crossing over [crossover (CO) deriva- tives] and derivatives that are generated by other modes of mutation [noncrossover (NCO) derivatives]. Chimeric genes resulting from unequal crossing over are indicated as gene X
gene. Line thickness indicates the relative frequency of each mutational event.
T h e R-r complex spontaneously gives rise to mutant derivatives at high frequencies, as summarized in Figure 1B. These derivatives have lost either R+ or R-s gene function, but not both functions in a single event. Deriv- atives of R-r that have lost the capacity to color plant parts are called
R-g
( X , colored aleurone conferred bya functional R-s gene; -g, green plant conferred by a
mutant or absent R+ gene). Those that have lost the capacity to color seeds are called r-r (r, colorless aleu- rone conferred by a mutant or absent r-s gene; -r, red plant conferred by a functional R+ gene). The mutant derivatives of the R-r complex can be further classified according to the mechanism through which they arise. Derivatives arising as the result of unequal crossing over
between the homologous segments within the complex are called crossover (CO) derivatives. Those arising by
other mechanisms are collectively called noncrossover (NCO) derivatives. Thus there are four broad catego- ries of mutant derivatives from the R-rcomplex: r-r CO,
r-r NCO, R-g CO, and R-g NCO.
T h e C O derivatives of the R-r complex represent in- terstitial deletions resulting from displaced synapses a n d crossing over between the highly homologous ge-
netic element. within the complex (ROBBINS PI (11.
1991). T h e position of the crossover event determines whether the resulting derivative will have lost R-I, or the Ssubcomplex. If the crossover occurs between R+ and
r-q, the resulting derivative loses R+ function but retains both functional R-s genes, giving it the gene comple- ment r+Xr-q R-SI R-s2 (an R-gderivative), where r-qXrj)
indicates the chimeric (and nonfunctional) gene frag- ment formed by recombination between R+ and r-q. If the crossover occurs between Rf) and R-s~, a chimeric R-pXR-s2 gene is formed while the interstitial seg- ment containing r-q a n d R-SI is lost. The chimeric Rj1XR-.s2 gene pigments plant parts, since it contains the 5' (promoter) region of R+, which confers tissue specificity, fused to functional rdownstream sequences from R-.s2.
The third class of derivatives of the R-r complex, the
r-r NCO class, result. from a more localized type of deletion. Formation of these derivatives is an intrachro- mosomal event, since the derivatives are recovered o n parentally marked chromosomes and in lines that are hemizygous for the rcomplex. In these derivatives, both the R-SI a n d R-s2genes become nonfunctional resulting in the total loss of seed color. Each of the r-r NCO derivatives analyzed has a small (0.4-4.3 kb) deletion encompassing the CT region between the R-SI a n d R- s2 genes, along with a variable length of transcribed sequence. The mechanism leading to these deletions is not entirely clear. They may result from residual activity of the transposon inverted repeats that reside at the positions of the breakpoints of two of these derivatives (WALKER et nl. 1995).
Spontaneous Mutations at the r Locus 683
and hence appears to be the result of a very small (<50 bp) mutational change in R$ (ROBBINS et al. 1991).
An interesting feature of most of the R-gNCO deriva- tives is that they are unstable and back-mutate to R-r at a high frequency in certain lineages (0.8 X 1OP3-4.34
x
lo-')
(DOONER 1971; DOONER and KERMICLE 1974;DEMOPULOS 1985). In other lineages, the same deriva- tives can be stable. The rate of back mutation exhibited in the unstable sublines (DOONER and KERMICLE 1974) is -100-fold higher than the rate of forward mutation from R-r (DOONER a n d KERMJCLE 1971). DOONER
(1971) and DEMOPULOS (1985) hypothesized that the observed instability resulted from the presence of a non- autonomous transposable element at r$, which was acti- vated by the presence of its cognate autonomous ele- ment in these backgrounds. The strength of the
transposon model for the R-g NCO derivatives is that it explains the sometimes extremely high rate of instabil- ity exhibited by these derivatives. In addition, this model accounts for the effect of genetic background o n reversion frequency by predicting that the element present in the ,r$ gene of the R-g NCO derivatives is nonautonomous and thus must be activated by the pres- ence of the cognate autonomous element elsewhere in the genome. Alternatively, the background effect could reflect changes in the activity state of an autonomous element at r-p. A weakness of the transposon model, however, is the lack of visible somatic variegation in the R-gNCO derivatives. The anthers and other plant parts colored by the R$ gene are uniformly colorless with n o visible red sectors (DOONER 1971; DEMOPULOS 1985). Mutations caused by other maize transposon systems
e.g., Ac/Ds, Spm/Enl and M u usually exhibit somatic variegation (FEDOROFF 1990). Not all transposable ele- ment systems cause somatic instability. T h e P (ENCELS 1990) and hobo (BLACKMAN a n d GELBART 1990; CALVI a n d GELBART 1994) transposable elements of Drosoph- ila are active only in the germ line, and thus do not cause somatic variegation.
In this paper we report molecular evidence showing that the spontaneous R-gNCO derivatives, R-g:6, R-g:12, R-g:13, a n d R-g:14, result from insertion of a novel trans- posable element, the P Instability Factor (PIE), into the
R$ gene of the R-rcomplex. Two different PZFelements were cloned and found to have identical sequences at their termini but divergent internal sequences, In addi- tion, the PIF elements showed a marked specificity of insertion sites: each of the four R-g NCO derivatives, a colorless mutant derivative of the simplex (Rponly) derivative r-r:n46, and a mutant derived from the R-
sc:124 (sc, self colored: dark pigmentation of the aleu-
rone) derivative have a PIFelement in an identical loca- tion, despite the fact that different elements are present in the individual R-g derivatives and that the PIF ele- ment was found in both orientations at this location. PIF was also found in a different position in a second
colorless mutant derivative of r-r:n46, showing that it can insert elsewhere within the r gene sequence. How- ever, even at this location, the element inserted into a conserved target sequence. PIF excision frequently oc- curs around the time of meiosis and thus results in the formation of single kernel sectors, but PIF excision is also observed postmeiotically in aleurone, and is occa- sionally observed premeiotically.
MATERIALS AND METHODS
All derivatives were maintained in the W22 genetic back- ground.
R-r:standard: The R-?-:standard complex used in this study is typical of the A group of ralleles described by STADLER (1948). In the W22 genetic background used in this study this com- plex confers strong pigmentation of the aleurone of the seed, the coleoptile, the leaf tip of seedlings and the roots and anthers of mature plants.
R-sc:124: R-sc:124 (MCWHIRTER and BRINK 1962) confers strong anthocyanin pigmentation to the aleurone and embryo of mature kernels, and weak pigmentation to the coleoptiles of seedlings. This derivative is distinct from all others used in this study as it was derived (by unequal crossing over) from the R-st complex (KERMICLE 1970; ALLEMAN and KERMICLE 1993); all of the other derivatives discussed here are derived from the R-rcomplex. R-sc:124is a simple derivative consisting
of the single gene, R-sc, which is a composite of the proximal- most and distal-most genes of the R-st complex (ALLEMAN and KERMICLE 1993).
R-g derivatives of R-r: The four R-g NCO mutants used in these studies, R-g:6, R-g:12, R-g:13, and R-g:14, arose from R-r homozygotes (BRINK et al. 1960; DOONER and KERMICLE 1974). Each of these derivatives is unstable in certain sublines. All four retain the complex structure characteristic of R-r and thus can be designated ric, r-q R-sl R-s2 (ROBRINS et al, 1991). Each is devoid of anthocyanin in coleoptile, root, leaf tip and anthers (tissues normally pigmented in the presence of a functional R-p gene). These mutants are spontaneous in origin. R-g:l is a CO derivative of R-r with the structure r-pXr-
q R-SI R52. It has, thus, lost R-p function.
r-g derivatives of R-g NCO derivatives and their revert-
ants: The colorless aleurone derivative r-g:13qs45 was recov- ered from an R-g:13/R-g:1 heterozygote; the colorless aleu- rone derivative r-g:14qsl31 was recovered from homozygous R-g:14 (DEMOPULOS 1985). Each was recombinant for flanking markers, indicating a crossover-mediated loss of the Ssubcom- plex. Following Zsr (Inhibitor ofstriate: a copy number depen- dent marker found on both segments of the genetic duplica- tion at R-r) analysis (KERMICLE and AXTELL 1981), each of these derivatives was shown to have lost one segment of the genetic duplication and therefore is designated as a simple r-
p
derivative. Revertant r-rderivatives that have regained plant color (simple R-p derivatives) were selected from these r-gderivatives. Three such revertants were chosen for this study:
r-r:g1870 and r-r:g1871 from r-g:13qs45, and r-r:g1886 from r- g:14qs131.
r-g derivatives: The r-r:n46 derivative is a simple Ric, GO derivative from R-r that has lost the Ssubcomplex (ROBBINS
684 E. L. Walker et nl.
The t"sc:124Y2902 derivative: The r-sc:124Y2902 derivative arose as a colorless kernel from a R-sc:124/R-r heterozygote.
DNA isolation and genomic blot analysis: Genomic DNA was isolated as described previously (DEILNORTA 1994) and was transferred to Zeta-probe membranes (Biorad) according to the manufacturer's instructions. Membranes were hybrid- ized and washed as described previously (DELIAPORTA and MORENO 1994).
Preparation of DNA probes: Probes used for genomic mapping were as follows: pR-nj:l (DELIAPORTA et al. 1988;
ROBBINS P t al. 1991); SAH2.0 (WALKER et al. 1995), two Hind111
to AvuI fragments derived from the h3D genomic clone of the Ssubcomplex (ROBBINS et al. 1991), which hybridize prox- imal to the sites of insertion of the PZFelements characterized (position 1890-3706 o f t h e Lcgenomic sequence; S. Lullwrc;, L. HABERA and S. WESSLER, personal communication); and PHE0.7, a Hind111 to EcoRI fragment derived from the h4.7 genomic clone of R-p (ROBBINS et nl. 1991), which hybridizes across the sites of insertion of the PEelements characterized (position 3700-4413 relative to the sequence of LC, S. LUD- \VI(;, I,. HAREM and S. WESSIXR, personal communication).
DNA fragments were isolated from low melting temperature agarose using Geneclean (BiolOl) and were labeled by the random priming method (FEINBERG and VOGELSTEIN 1984).
Construction of genomic libraries and plasmid res-
cues: Genomic libraries were constructed from homozygous K-g:12 and R-g:6 DNA that was digested to completion with restriction enzyme SstI. Digested DNA was ligated into pre- pared AZAPII vector arms (Stratagene) according to the man- ufacturers instructions, packaged using Gigapack XL (Stra- tagem), and plated on Escherichia coli strain ER1647 (New England Biolabs). Libraries were screened with the probe pR- nj: 1 . Appropriate clones were rescued as plasmids by superin- fection with the defective MI3 helper strain VCSMlS under kanamycin selection.
PCR analysis, subcloning and DNA sequencing: For ampli- fication of PIF ends and flanking T sequences, five primers
were used: oR29: 5' GTGCATCCGTCAGCTTTATTGCAA 3'; oR30: 5' CAGTGATTCTGTTCTTCTITGATGAAAC 3'; oR37:
GCTTGAAGAGG 3'; and oRglO: 5' AAGAATGGATGGAAA- GTTA 3'. Primers oR29, oR30 and oR37 prime within the large second intron of r. The positions of each primer as compared with the genomic sequence of the LC gene (S. LUD- WIG, I>. HABEKA and S. WESSLER, personal communication) are 386'7-3844 (oRL9; primes DNA synthesis toward the 5' end of r ) , 3617-3644 (oR30; primes DNA synthesis toward the 3' end of r ) , and 4429-4408 (oR3'7; primes DNA synthesis toward the 5' end of 7). Primers oRg9 and oRgl0 prime within
PIF. These primers were chosen so their priming sites are present in both PZF-6 and PZF-12. The position of each primer in the PIF-12sequence is 700-683 (oRg9; primes DNA synthe- sis toward the left end of PIF-12) and 2205-2223 (oRgl0; primes DNA synthesis toward the right end of PIF-12).
The following primer sets were used for amplification of the proximal (5' in r) and distal (3' in r) portions of each HFinsertion: R-g:13: proximal, oR30 and oRglO; distal oR29 and oRg9; R-g:14: proximal, oR30 and oRgl0; distal oR29 and oRg9; r-g:n46g901: proximal, oR30 and oRg9; distal oR29 and oRglO; r-g:n46g90?: proximal, oR30 and oRg9; distal oR37 and oRgl0; and r-sc:124-Y2902: proximal, oR30 and oRg9; distal oR29 and oRglO. The primers oR30 and oR29 were used together to amplify fragments from r-T excision derivatives.
PCR amplification was performed in a 50 pl reaction vol- ume containing: -50 ng genomic DNA 1 X polymerase buffer (Promega); 2 mM MgC:lp; 2% formamide; 4 ~ L ' L I each M T P ,
dTTP, dGTP and dCTP; 1U Taq DNA polymerase (Promega). 5' GACCATCCAAACACCAGAATTC 3'; oRg9: 5' CAGGAA-
Reactions were carried out for 30 cycles of 45 sec at 95" dena- turation, 1 min at 55" annealing, 2 min at 72" polymerization. For amplification of empty sites, the polymerization time was reduced to 30 sec. For every primer set in every set of reac- tions, negative control amplifications were performed in which no DNA was added to the reaction. No amplification was ever observed in these control reactions. Each fragment of interest was amplified in at least two independent reactions, and at least two independent clones were analyzed. PCR frag- ments were cloned using the TA Cloning Kit (Invitrogen) according to the manufacturer's instructions, prior to se-
quencing. Sequences were generated from doublestranded plasmid DNA using the dideoxy chain termination method (SANGER pt ul. 1977) with the enzyme Sequenase I1 (US Bio- chemical). All sequences were confirmed on both strands.
RESULTS
Molecular cloning of the lesions in the R-g NCO de- rivatives: Using genomic blot analysis, ROBBINS et al.
(1991) showed that the R-g NCO derivatives R-g:6, R- g:12, R-g:13 and R-g:14 had lesions localized to a 4
kb Hind111 fragment of the R", gene. By using probes proximal (SAH2.0) and distal (PHE0.7) to the sites of' the lesions in R-g:6, R-g:12, R-g:13, and R-g:14, it was possible to determine the nature of the lesion in each derivative and to map them relative to known restriction sites in R-p. Interestingly, K-g:6, R-g:lJ and R-g:14 all contained an -5.2-kb insertion that mapped close to the Hind111 site within the large second intron of Rp. R-g:12 contained a smaller insertion of -2.3 kb that mapped to the same restriction fragment. The entire insertion for each derivative is contained within a single SstI fragment. Accordingly, Sstl genomic libraries were constructed for R-g:6 and R-g:12. From these libraries we recovered clones containing a 9.4kb Sstl fragment, which includes the R-g:6 insertion plus flanking R", se- quences and a 6.5-kb SstI fragment that contains the R- g:12 insertion with flanking R ~ I sequences. Molecular mapping data from these two clones and results from genomic blotting experiments on the uncloned R-g
NCO derivatives are summarized in Figure 2.
The insertions at R-g:12 and R-g:6 have the sequence characteristics of transposable elements Sequence analysis of the R-g:6 and K-g:12 clones revealed that the inserted DNA in each exhibits the characteristics of a transposable element. The element at R-g:12 (PIF-12)
contains perfect terminal inverted repeats of 14 bp (im- perfect repeats of 25 bp) and is flanked by 3-bp direct repeats. These sequencing results are summarized in Figure 3. The insertion at K-g:6
(PIF-6)
is in exactly the same nucleotide position as PIF-12 and has nearly identical inverted repeats at its ends, but is present in opposite orientation. Like PIF-12, PIF-6 is flanked by perfect 3-bp direct repeats. Within the inverted repeat there is a single nucleotide mismatch (shown in Figure5 ) at one end (the distal end) of PIF-6.
Spontaneous Mutations at the r Locus 685
= A
F .-FIGYRE 2.-Combined maps of four R-g NCO derivatives. The intron/eson structure (deduced by comparison to the genomic and cDNA sequences of LC, S. LYD\.VIG, L. HARERA
and S. \VESSI.F.K, personal communication) of the affected region of the X - f ~ component of R-r is shown. Each of the R- gSCO tlerivatives shown has an insertion in the large second intron. Above are the maps of the 5.2-kb insertion mapped in Il-g:6, R-g:13, and R-g:14, all of which are identical at the level ofgenomic restriction mapping. Below is shown the map of the 2.3-kb insertion mapped in Il-g:12. Restriction enzyme sites are as follows: R, BnmHI; E, EroRI; H, HindIII; S, SsW.
Also shown are the locations of the primers (oR29, ORSO, oRJ'i, OR@, and oRglO) used for PCR amplification of the ends of various PIFelements.
tives, R-,q:13and R-,q:14, had indicated that these deriva- tives contained insertions indistinguishable in size and location from the insertion at R-g:e i.?., each had an insertion of -5.2 kb very close to the Hind111 site within the large second intron of the r+ gene. To investigate whether R-g:13 and R-g:14 contain PJFelements, prim- ers were designed that would amplify the proximal and distal ends of the insertions together with flanking DNA from r-l,. (see SIATERIAIS AND MMETH0I)S for a detailed
The proximal ends of various PIF elements
R-g:12
R-g: 6
R-g:13
R-g:14
9901
9903
Y2902
gtgaaaatctagtacactta GGGCCCGTTTGTTTCCTTGGAAATGAAACTCA'ITCCAT
3725
gtgaaaatctagtacactta GGGCCCGTTTGTTTGATTGGAATTGAATTGAATTGGAA
3725
gtgaaaatctagtacactta GGGCCCGTTTGTTTGATTGGAATTGGATTGAATTGGAA 3725
gtgaaaatctagtacactta GGGCCCGTTTGTTTGATTGGAATTGGATTGAATTGGAA 3725
gtgaaaatctagtacactta GGGCCCGTTTGTTTCCTTGGAAATGAAACTCATTCCAT 3725
atagaggatagaatctttta GGGCCCGTTTGTTTCCTTGGAAATGAAACTCATTCCAT 4310
g€gaaaatctagtacactta GGGCCCGTTTGTTTCCTTGGAAATGAAACTCAWCCAT
3725
description of the primers used.) The PCR fragments generated in this wav were subcloned and the DNA sequences were determined. Both R-g:l? and &:I4
contain PIF elements (PJF-I? and J'JF-14, respectivelv) indistinguishable in sequence, location, and orienta- tion from PJF-6, as shown in Figure 3. Both derivatives contain the one nucleotide difference in their distal inverted repeats. This finding caused concern that the PCR fragments generated from R-g:l? and R-g:14 were actually generated from contaminating R-g:6 DNA, o r that the R-g:13 and R-,q:14 genetic stock cultures had been contaminated with R-g:6pollen. To examine these possibilities, a separate source of seeds was used, and genomic DNA was prepared and amplified in a remote location in the lab using a separate set of reagents. The PCR fragments were generated again, subcloned and sequenced. The sequences obtained were identical to R-,q:6. Genomic blotting confirmed that the restriction maps of the r? genes of the new stocks of R-g:I? and R-g:14 were identical to that of ICg"6. I t is formallv possi- ble, however, that R-g:6, R-g:13 and J<-g:14 are not inde- pendent mutations, but instead resulted from pollen contamination o r a mistake in labeling seed stocks.
Characterization of other r derivatives confirms the insertion site specificity of PIF: Three other unstable r
derivatives were examined for the presence of a f J F element. Two of these, r-g:n46g901 and r-g:n46g90?, arose as colorless plant mutants from the r-r CO deriva- tive, r-r:n46 (KERMICLE 1985). The r-r:n46 derivative is simplex, containing onlv a chimeric R-jO/R-s2 compo- nent, and thus is not expected to undergo mutation via
a crossover mechanism (ROBBIXS PI nl. 1991). The other derivative, r-sc:124Y2902, arose as a colorless kernel from R-sc:124, a simplex r derivative that normallv pig- ments onlv the aleurone (AILEMAN and KF.RMI<:I.E 1993). This derivative is particularlv interesting because it represents a distinct r gene, R-x, rather than an R ~ I
The distal ends of various PIF elements
TTCCAATTCAGCCCAATTCCAATCAAACAAACGGCCC ttagagttttccaaagtat 3741 3741
ATGGAATGAGTTTCATTTCCAAGGAAACAAACGGGCCA ttagagttttccaaagtat
ATGGAATGAGTTTCATTTCCAAGGAAACAAACGGGCCA ttagagttttccaaagtat 3741
ATGGAATGAGTTTCATTTCCAAGGAAACAAACGGGCCA ttagagttttccaaagtat 3741
TTCCAATTCAGCCCAATTCCAATCAAACAAACGGGCCC ttagagttttccaaagtat 3741
TTCCAATTCAGCCCAATTCCAATCAAACAAACGGGCCC ttagagaagactgtaaaga 4326
TTCCAATTCAGCCCAAWCCAATCAAACAAACGGGCCC ttagagttttccaaagtat 3741
FIGCM 3.-DSA sequences of the sites PIFinsertions at r. Each derivative shown has an insertion of a PIFelement within the second intron of an r component. The nucleotide positions given correspond to the sequence of the I x gene (S. L L ~ I X V K ; , L.
H.\RER\ and S. \V\'ESSI.ER, personal communication), which is highly similar in sequence to the R+ component of R-r (E. MT.\l.KI:.R,
686 E. L. Walker et al.
gene as in each of the other mutations under consider- ation.
Each of these three derivatives appeared in genomic blotting experiments (not shown) to contain an inser- tion of -2.3 kb within the large second intron, and thus resembled the R-g NCO derivative R-g:12. We rea- soned that if these derivatives did contain a PIF inser- tion, then primers that were designed for amplifying R- g:13 and R-g:14 could likewise be used to amplify the ends of PIF elements from the three new derivatives. PCR amplification of each derivative with appropriate primer sets (see MATERIALS AND METHODS) was consis- tent with each mutation being caused by a PIFelement. The proximal and distal PCR fragments from each de- rivative were subcloned and the DNA sequences of each were determined. The results are shown in Figure 3.
In each of these three derivatives the PIFelement has inserted in the same orientation as the PIF at R-g:12. Two of the derivatives, r-g:n46g901 and r-sc:124Y2902, have PIF insertions at the exact same position as the insertions in the R-g NCO derivatives. Note that the preferred target site is used even when PIFinserted into the distinct r-sc gene of r-sc:124Y2902 'os. the r-p gene of each of the other derivatives. The one exception to this preferred target site selection is r-g:n46g90?. The insertion in this allele was 585 bp downstream of the site at which the other six PIF elements integrated. In- terestingly, the sequences of the target sites are identi- cal (TTAGAG), as is the target site duplication (TTA). Thus, even though a different target site location was used in this derivative, the target site sequence was iden- tical in all derivatives examined.
Analysis of R revertants from 11 If PIF is a transpos- able element, then R revertants from PIFinduced r de- rivatives should be the result of excision of the PIF ele- ment. To test this idea, the putative empty target sites from revertants were examined. To simplify analysis of
PIF excision events, empty target sites were obtained from simplex PIFinduced derivatives. Complex deriva- tives (like the R-g NCO derivatives) have intact r se- quences in their unaffected R-s genes that would con- found PCR analysis of the revertant R-1, gene. Therefore, by displaced synapsis and crossing over, sim- plex CO derivatives of R-g:l? and R-g:14were generated (see MATERIALS AND METHODS), as shown in Figure
4A.
Each simplex CO derivative contains a chimeric r$/R-s 2 gene that is nonfunctional due to the presence of the
5.2-kb PIFelement, but contains the promoter region of
R-p. Three colored plant revertants were tested: r-
r:g1870, r-r:g1871, and r-r:gl886. Genomic blotting (not shown) indicated that each of these derivatives has lost the 5.2-kb insertion characteristic of PIF. The appro- priate fragments from each of the three derivatives were generated using primers oR29 and oR30 (see MATERI-
ALS AND METHODS for a description), and were sub- cloned for nucleotide sequencing.
The nucleotide sequences from the relevant portion of each PCR fragment along with the nucleotide se- quence of the progenitor R-p component are shown in Figure 4B. The PIF element was absent in each of the
r-r revertant derivatives examined. Target site duplica- tions were also absent. Instead, each derivative exhib- ited an excision event that included a small deletion. The smallest deletion occurred in r-r:g1871 that lost only the three nucleotides of the target site duplication itself. Hence in this revertant, the normal R$ sequence has been exactly restored. The r-r:gl886 derivative has lost one copy of the target site duplication and one additional nucleotide, a total of four nucleotides. The largest deletion was found in r-r:gl870. This revertant has lost 32 nucleotides: the duplicated target site se- quence and the 29 bp adjacent to it. It is interesting to note the small direct duplication (underlined in Figure 4B) that is present at the borders of the deletion in r-r:g1870. Possibly this duplication could be a site of recombination.
Structure of the PZF-12element: The complete, 2307- bp nucleotide sequence of PIF-12 was determined. The Genbank accession number for PIF-12 and flanking R-
p
sequences (not shown) is U85626. Sequence compari- son to the Genbank and EMBL sequence databases showed that PIF-12 is not a member of any previously characterized transposable element family. Two large open reading frames beginning with methionine resi- dues are found in the PIF nucleotide sequence. The first potentially encodes a peptide of 134 amino acids (nucleotides 140-844); the second potentially encodesa peptide of 113 amino acids (nucleotides 1652-1993). In addition, there are two somewhat smaller open read- ing frames, which do not begin with methionine co- dons, but which might represent additional exons of a spliced mRNA nucleotides 1524-1760 (78 amino acids) and nucleotides 1906-2190 (94 amino acids). FASTA (PEARSON and LIPMAN 1988) searches of the SWISS-PROT protein sequence database and BLAST (Basic Local Alignment Search Tool) (ALTSCHUL et al.
1990) searches of the nonredundant combined Brook- haven Protein Data Bank, SWISSPROT, and PIR data- bases or DBEST (Database of Expressed Sequence Tags) failed to reveal any significant similarities to known protein sequences.
A PIFlike segment was found within a dSpm/Enl ele- ment identified at the brittle-] locus (SULLIVAN et al.
Spontaneous Mutations at the r Locus 685
A
r - q Rsl RSZ
1-1
FIGVRE 4.-Analysis o f I’IFex-
cisions. (A) T h r rationale for generating simplrx (r-ponly)
I’Ikontaining derivatives from the complex (r-p I<-s) R-g NCO derivatives is shown. Crossing over between the r$ component of the I<-g NCO tlerivative and the R-s2 component of the CO
derivative R-.c;I ( = Ssu1,rom- plex only) generates an entirelv colorless (r-g) tlerivativc. ( B )
The nucleotide sequences of the empty sites from three I’IFexci- sions. Above is shown rhe sc-
quence of the intact I<-]) compo- nent. The TTA trinucleotide that is cluplicated upon I’IF in- sertion is shown in bold. T h e site
o f insertion of PIFin the dcriva-
genitors of the rxcision alleles tested) is shown schematically.
r-p B P Z P o c ~ - g : 1 3 Spaces in the sequences of the
a n d R-g:14 T C T A G T A C ~ G A G T T T T C C A A A G T A T T T C C T G C T A A T ~ T A T T T C A A T A T T A I’Ikxcision dcri\ratives indicate .?-P Gene O f r-r:n46g1870 TCTAGTACACTTA ( A 3 2 bpl TATTTCAATATTA deletions that occurred on ex-
B
R-g g e n e of R - r T CT AGT AC ACT T AGA GT ’?T T CCA AA GT A T T CC T G CT AA T ~ T A T T T C A A T A T T A tives R-g;13 anrl I<-g;14 (the pro-
T
R - p G e n e o f r-r:n46g1686 TCTAGTACACTTA ACTTTTCCAMGTATTTCCTGCTMTBCTTACTTATATTTCAATATTA cision. A small direct duplica-
3 - P q e n e of r-r:n46g1871 TCTAGTACACTTA GAGTTTTCCARAGTATTTCCTGCTAATACTTATATTTCAATATTA tion that borders the deletion
breakpoints of the r-r;gIR70 is
suggests that this element arrived at Irma by transposi- tion. The similarity between Irma and PIF-12 extends from the terminal inverted repeats to -100 bp on each end. The overall similarity of the ends of the hvo ele-
ments is
-io%.
The target site duplication at the PIF like insertion in Irmn was TTA (as shown in Figure 5; note that the strand shown for Irmn is the reverse com- plement of .5’ TTA 3’, ix., 5’ TAA 3‘). The more exten- sive 6 b p target sequence used at r is not identical in Irma: TTATAT in Irma; TTAGAG in r.The
PIF-12
is not a simple deletion derivative ofPIF-
6: The sequence of the 1368 leftmost and 266 rightmost nucleotides of PIF-6, together with R ~ I flank- ing sequences on both sides, was determined. This ele-
ment is much larger than PIP-12: 5.2 kb for PIF-6 com- pared to 2.3 kb for PIF-12. As noted above, the insertion at R-g6 is in exactly the same nucleotide position as PIF-I2 and is flanked by perfect %bp direct repeats, but is present in opposite orientation. Comparison of the partial sequences of PIF-6 to the sequence of PIF-12 (shown in Figure 6) reveals that the PIF-I2 element is not a simple deletion derivative of the PIF-6 element. Instead, ]-’IF-6 contains many nucleotide substitutions, insertions and deletions not present in PIF-12. The DNA sequences of PIF-6 and PIF-I2 are more similar near their termini and tend to become less similar in internal regions. Obviously, given the large size difference (2.9 kb) between the two elements, PIF-6 must contain a
substantial amount of DNA that is not found in PIF-12. However significant sequence similarity to PIF-I2 was
shown underlined.
observed throughout the 1634
bp
of PIF-6 sequence that was obtained for this study.Timing of
PIF
excision: The r-x:124Y2902 derivative contains a PIFinsertion within R-sc, an rgene that colors the aleurone laver of the seed and the embryo. Two typical homozygous r-x:124Y2902ears are shown in Fig- ure 7. M7e used this derivative to facilitate assessment of the pattern of PIFexcision. Homozygous r-sc124Y2902 females were crossed to males homozygous for R-q& a pale aleurone derivative of R-r that is distinguishable from both full colored (X-sc revertants) and colorless (r-.sc:124Y2902) aleurone. Progeny from these crosses were screened for full colored and spotted aleurone and for colored embryo. A single atypical ear bearing a large multikernel sector was observed (not shown); kernels from this ear were not included in this analysis. The tabulated results from these crosses are given in Table 1. Appearance of aleurone or embryo color is an indication of PIFexcision from r-,sc:124Y2902. Full color and spotted kernels occur at a frequency of 3.68% and 3.34%, respectively. This ratio is strikingly different from the pattern of germinal us. somatic reversion o h688
A
E. L. Walker rt 01.
Spm
END N O N - S ~ sequence SPm END
/
B
/
/ /
/
/ \
/ \
/ \
/ \
/ \ \
\
\ \
\
.
g=::ymg*
2307ttagag * taaaga
1 4 3 - 1368
FIGL’RE .+.-(A) T h e structrlre of the dSpn/EnI element, Irma. The element contains S/m/EnI-derived sequenced at its ends that include the consenred terminal inverted repeats of Spm/Enl. Irma also contains sequences that are not derived from Spm/ E n l . \Vithin this foreign DNA, a small region was found that shares sequence similarity with the PIF-I2 elcmcnt. (R) Comparison of the sequence of PF-12 with a portion of the dSpm/Enl element, Irma (Sul.r.nlm rt al. 1991; M V S ~ S K I ct nl. 1993). I’F-12 is shown as the top sequence in the comparison; the PIFlike element at Irma is the bottom sequence. Sequences flanking IWare shown in lowercase. PIFsequences are shown in uppercase. T h e region of Irma shown is numbered according to M ~ s n ~ s K 1 rl
nl. (1993) and is located within a larger, non-.rj,m/l~~nI-homologous insertion within Irma.
tect aleurone or embryo sectors in the majority of ker- nels in heterozygous r-sc:124Y2902 is therefore a strik- ing indication that excision occurs at a much higher rate in premeiotic and/or meiotic lineages than in the aleurone. Nonconcordant colored embryo (colorless al- eurone) kernels occur much less frequently (0.15%) but their appearance suggest. that PlFis active in post- meiotic cell lineages during embryo sac development.
To examine the postmeiotic timing of PlF excision further, a population of colored (revertant) aleurone kernels were grown to maturity and test-crossed to ho- mozygous r-D902, a colorless rdeletion allele (ALLEMAN and I(ERMICLE 1993). This cross allows determination of the frequency of genetic concordance between the endosperm and embryo. Nonconcordance of embryo and endosperm from this cross would indicate that PlF excision occurred postmeiotically during the three h a p loid mitotic cycles of embryo sac development. The re- sults are shown in Table 2. A substantial proportion of the kernels tested were nonconcordant, i.p., the r derivative in the e m b n o was nonrevertant and presum-
ably still contained PlFat it. original position. Extrapo- lating these frequencies to the total sample, concordant colored kernels occurred at a frequency of 2.27%
(3.68% X 0.616), while nonconcordant kernels with a revertant aleurone and nonconcordant embryo oc- curred at a frequency of 1.28% (3.34% X 0.384). This high rate of nonconcordance indicates that PlF fre- quently excises during development of the megaspore into the embryo sac.
The potential for PlFexcision in tissues of the mature sporophyte was also examined. Because PlF insertions into the
Rp
component disrupt pigmentation of only a small subset of plant parts (coleoptile, anther walls, and roots), it is difficult to assess the timing of PlF excision with these derivatives. Simple visual inspection of R-g NCO lines known to have high rates of germinal PlF excision failed to detect somatic sectors in either coleoptiles or anthers (DOONER 1971; DEMOPULOS1985). This result suggest. that somatic excision is a
rare event, or alternatively, that somatic excision occurs very late. Genomic blotting experiment. were not suc- cessful at detecting empty target sites generated follow- ing PlF excision in leaf DNA, again suggesting that so- matic excision is rare. To examine this issue further, a
Spontaneous Mutations at the r LOCUS
PIF-6 PIF-12
PIF-6 PIF-12
PIF- 6 PIF-12
PIF-6 PIF-12
PIF-6 PIF-12
PIF-6 PIF-12
PIF-6 PIF-12
PIF-6 PIF-12
PIF-6 PIP-12
PIF-6
-
-3800 bp not shownPIF-12 926 bp not shown
PIF-6
PIF-12 ACAGGCCGGCGCTCGGGGAGGA ...
PIF-6 PIF-12
FIGURI.: (i.-XNucleotide sequence comparison of PIF-I2 and the elemcnt at l<-g:6, 1’11% Thc srquencetl portions o f each cnd of PIF-6 are shown compared to the corresponding regions HF-12.
with high rates of germinal reversion (14.8% and 8.7%, respectively). Blot.. were prepared from the resulting PCR products and were hybridized to the HE0.7 probe. The results of this analysis are shown in Figure 8. Two products were detected: the full target site, a large frag- ment corresponding to the 2.3-kb PlFelement and its flanking sequences, and the empty target site, a small
F I G ~ R I . : 7.-Ears homozygous for the r-sc: 124Y2902 deriva-
tive. Each ear shows several colored revertant kernels and kernels hearing sectors of aleurone pigmentation.
fragment of the molecular weight expected following PIF excision from r+. Thus, PIF excision does appear to occur in somatic (leaf) cells. (Note that leaf blades are not colored by the R+ gene.) However, it is im- portant to realize that the smaller molecular weight fragment observed could also result from amplification across a stem-loop structure consisting of the PIF in- verted repeats (stem) and looped out (and unampli- fied) PIFinternal sequences. The PCR conditions used included relatively short polymerization times (of SO sec) to favor the production of the short, empty target site fragment over the production of the much longer full target site fragment. U‘e speculate that PIFexcision in leaves, coleoptiles and anthers occurs either very late, very infrequently, or both. Alternatively, somatic PIF excision may occur only in certain lineages; for example in aleurone (detected by visual inspection) but not in anthers and coleoptiles (undetected by visual inspec- tion).
DISCUSSION
690 E. L. Walker et al.
TABLE 1
Progeny of r-sc:124Y2902/r-s~:124Y2902 females X R-g:8 (pale)/R-g:8 (pale) males
Pale Full colored Spotted aleurone Full colored
aleurone aleurone" or embryo embryo Total
Number 20,778 825 749 33 22,389
Frequency (%) 92.80 3.68 3.34 0.15
a Includes concordant and nonconcordant kernels.
complex triplicate structure (ROBBINS et al. 1991; WALKER et al. 1995). Crossover ( C o ) type mutants arise through displaced synapsis of the duplicated segments followed by crossing over between them. This results in loss of intervening r components and is observed concomitantly with exchange of flanking markers. A large percentage of the mutations of R-r cannot be at- tributed to this mechanism. These are referred to as noncrossover (NCO) mutants. Certain lines carrying R-
g
NCO ( r$ R-s) derivatives are unstable, i.e., they show high rates of reversion to R-r (R-p R-s) (DEMOPULOS1985; DOONER and KERMICLE 1974; DOONER 1971). We have shown that the unstable R-g NCO mutants, R-g:6,
R-g:lZ, R-g:13, and R-g:14 are the result of insertion of a PIF transposable element.
Characteristics of the PIF family of transposable ele- ments PIFis not a member of any previously character- ized transposon family. Certain features associated with PIFare, however, reminiscent of other transposable ele- ment families. PIF has short terminal inverted repeats
(14 bp) and creates a 3-bp target site duplication upon insertion. Both of these features are also true of the CACTA superfamily of elements that includes En/Spm of maize (PEREIRA et al. 1986; MASSON et al. 1987), Tam1 of snapdragon (NACKEN et al. 1991), T p l of soybean
(RHODES and VODKIN 1985), and Pis1 of pea (SHIRSAT 1988). While we are not suggesting that PIF represents
a member of the CACTA family, it is interesting to speculate that the 3-bp target site duplication and possi- bly also the length of the terminal inverted repeat were features present in a common ancestral group of ele- ments.
PIF displays a marked target site specificity; seven of seven independent PIF insertions at r occurred at the six nucleotide sequence (TTAGAG) and caused dupli- cation of the trinucleotide TTA upon insertion. An
eighth example of a PIFlike element was identified as a 364bp insertion found in the dSprn/Enl element, Irma (SULLIVAN et al. 1991; MUSZYNSKI et al. 1993). While the six nucleotide target sequence is not found for this insertion, the 3-bp target duplication, TTA, is found. Of the seven PIF insertions examined at r, six were located at the same nucleotide position within the large second intron of r, including one in a different r gene
(R-sc)
.
The seventh was located in the R-1, gene 585 bp downstream of the other insertions, but still within thesame intron. The site preference shown by PIF is even more remarkable when one considers that the TTA-
GAG motif is present a total of eight times within this 585-bp section of the second intron of R-p (E. WALKER, unpublished data), yet six of seven insertions were in an identical position. Thus, in addition to its apparent sequence preference, PIFalso exhibits selectiveness that may extend beyond the 6-bp motif noted here. Remark- ably, two different PIFelements were found at the same position within r. Thus the site preference noted above seems to be a general characteristic of this family of transposons. Weak consensus target site specificity has been reported in a number of transposable element systems including Ac/Ds (MORENO et al. 1992), Mu1 (CRESSE et al. 1995) and Tourist (BUREAU and WESSLER 1992) of maize, and Tcl (MOM et al. 1988) and Zc5 (COLLINS and ANDERSON 1994) of Caenorhabditis elegans. The Drosophila transposable element Mariner has an absolute target site sequence requirement of the dinu- cleotide TA (BRYAN et al. 1990), which is duplicated on insertion.
Of the seven PIF insertions examined, four were a 2.3-kb element, and three were of a larger 5.2-kb ele- ment. Each of the 5.2-kb PIF elements examined con- tained the same single nucleotide difference at the first nucleotide of its left (in each case distal; see Figure 3) inverted repeat. Likewise, each of the 2.3-kb PIF ele- ments examined were identical for at least -100 bp of their ends (not shown). It is possible that there are internal sequence differences among these 2.3-kb ele- ments. The occurrence of so many independent PIF insertions into r raises the question of whether PIF is exhibiting a preference for inserting at r. Other trans- posable elements, including Mutator in maize (HARDE- MAN and CHANDLER 1993), and the P (BERG and SPRADLINC 1991; KASSIS et al. 1992) and Hobo (SMITH et
al. 1993) elements in Drosophila, have been postulated to transpose to preferred chromosomal locations. Alter- natively, the abundance of PIF insertions found at r
could be the result of the particular W22 inbred stock used, or could reflect the presence of a nearby PIF donor element that preferentially transposes over short distances. The occurrence of both PIF-12 and PIF-6 in- sertions, however, is not readily explained by transposi- tion of a nearby element.
Spontaneous Mutations at the r Locus
TABLE
2Germination tests of full colored kernels from t-se:124Y2902/t.s~:124Y2902 females X
R"8 (pale)/R"8 (pale) males
Concordant Nonconcordant Total
53 (61 .ti) 33 (38.4) 86
Values in parentheses are percentages.
ends, but
PIF-12
is not a simple deletion derivative of PIF-6. Many small differences were observed including small insertions and deletions as well as nucleotide sub- stitutions. Because bothPIF-12
and PIF-6 apparently be- come inactive in certain genetic backgrounds (DEMOPULOS 1985; DOONER 1971; DOONER and KERMICLE 1974), it seems likely that neither is an autonomous element. However, it is possible that the elements are subject to epigenetic inactivation (NEUFFER 1966; SCHM~ART~. and
DENNIS
1986; CHOMET d af. 1987; FEDOROFF and
BANM
1988) rather than segregation of an autonomous factor. Further genetic studies will be nec- essary to identify the autonomous PIFelement. Based on genomic blotting experiments (not shown), there are -20-50 copies ofPIF
in the maize "22 genetic background used in these studies.Timing
of
PZFexcision: Perhaps the most interesting aspect of the behavior of PIFis the timing of excision. The PIIcinduced derivatives that were first identified each contain PIF in the R-p gene ofR-r,
a gene that colors the coleoptile and anthers. Although germinal reversion of these r-p derivatives to R-p was frequent, red somatic sectors were rare or absent in coleoptiles and anthers, even in lines that exhibited high germinal reversion rates. This suggested that PIFexcision might be limited to certain cell lineages. Analysis of PFexci- sion by a sensitive PCR-based aqsay suggests that PIF could be active in leaf tissue, but if it is, that excision is probably either infrequent or occurs very late in leaf development. Failure to detect visual somatic sectors in coleoptile and anther walls could likewise reflect a very small sector size or very small number of sectors.The subsequently identified derivative
r-sc:124Y2902,
in which PIFhas inserted into the R-scgene, has allowed a more extensive examination of the pattern of
PIF
excision. The R-sc gene colors the aleurone and the e m b v o of the seed, thus, in testcross ears from homo- zygousr-sc:124Y2902
plants,PIF
excision is visible ascolored aleurone sectors in aleurone and embryo. The pattern of aleurone pigmentation in self-pollinated ho- mozygous
r-sc:124Y2902
ears is strikingly different from patterns caused by insertions of other wellcharacter- ired maize transposons (eg., Ac/D.$ or Spm/Enl). A typi- cal Ac- or Spm/Enl-containing allele exhibits revertant sectors in any tissue in which the cognate gene is ordi- narily expressed. A typical homozygousr-sc124Y2902
1
3.3
kb
-
0.8 kb
-
69 1
2
3 4
-
2.5 kb
-
0.2
kb
FIGURE 8.-PCR-based PfF excision accay. Genomic DNA was prepared from leaves of plants homozygous for the r- p 1 4 6 g 9 0 1 and r - p 4 6 g 9 0 3 derilatives. This DNA was used as the template for PCR with primer sets oR29 and oR30 (r- g:n46g901 derivative, lanes 3 and 4), and oR30 and oR37 (r-g:n46@3 derivative, lanes 1 and 2). (.&?e MATERMIS h S D METHOIS for a detailed description of primers.) The resulting products were separated bv gel electrophoresis, transferred to a filter and hybridized with the HE0.7 probe. The larger band in each lane (2.5 kb for r-g:n46g901 or 3.3 kb for r- g:n46g903) corresponds to the fragment containing a 2.3-kb PfF-12 element and flanking r sequences. The smaller band in each lane (0.2 kb for r-g:n46g901 and 0.8 kb for r-gm46g903) corresponds to the size fragment that would be expected to result from excision of the IWeelement.
kernel is colorless; no revertant pigmented sectors are present. Only a small percentage (3.34%) of homozy- gous
r-.~c:124Y2902
kernels exhibited pigmented aleu- rone sectors. The germinal reversion frequency of ther-sc:124Y2902allele
in the stock tested for these analyseswas.
however, not strikingly different from the germinal reversion frequency for a typical Ac-, D.c, or Spm/Enl- induced allele. Thus, germinal reversion event5 from this PIFcontaining allele are relatively much more com- mon than somatic events.The precise timing of germinal PIFexcision has not been determined. Although many revertants occurred
as
isolated single kernels, others occurred side-by-side with a second revertant kernel (see Figure7).
The sin- gle kernel events can be interpreted as occurring either during meiosis or in a mitotic lineage of the ear primor- dium that gave riseto
only a single megasporocyte. The side-by-side events may represent two single kernel events that coincidentally occurred next to each other, or alternatively, an earlier somatic reversion in the ear primordium. A second striking feature ofr-sc:124Y2902
allele was the very high rate of nonconcordance of en- dosperm and embryo within a single seed. Nonconcor- dant kernels fall into two classes: colorless aleurone with colored embryo and colored aleurone with colorless embryo. The most logical interpretation of nonconcor- dance is that
PIF
excised from R-sc during femalega-
692 E. L. Walker et nl.
sion pattern of PIF in the r-sc:124Y2902 allele can be summarized as occurring just prior to, during, or just after meiosis.
We thank TOM BRLJTNEI.L and A1,ISON DELONG for helpful discus- sions during the course of this work, and LISA SHUSTER, BEVERI,Y
OASH(;AR and CAROL AI.I.EN for technical assistance. This work was supported by grants from the Department of Energy, Office of En- ergy Research (DE-FG02-86ER13627) to S.L.D. and (DE-FG02- 86ER1.7539) to J.L.K., from the National Science Foundation (Award # 9406483) to E.L.W., from Virginia Commonwealth Univer-
sity College ofHumanities and Sciences Faculty Development Award to W.B.E., and from the United States Department ofAgriculture/ National Research Initiative Grants Program (91-37301-6379) to J.L.K. and W.B.E.
LITERATURE CITED
AI.I.EMAN, M., and J. L. KERMICI.F,, 1993 Somatic variegation and germinal mutability reflect the position of transposable element
Dissociation within the tnaize R gene. Genetics 135: 189-205. ALTSCHUI., S. F., W. GISH, W. MILLER, E. W. MYERS and D. J. LIPMAN,
1990 Basic local alignment search tool.]. Mol. Biol. 215: 403- 410.
ASHMAN, R. B., 1965 Mutants from maize plants heterozygous K-r
K-st and their association with crossing over. Genetics 51: 30.5- 312.
BERG, (3. A,, and A. C. SPKXLXING, 1991 Studies on the rate and site- specificity of P element transposition. Genetics 127: 515-524. BIM:KMAN, R. K., and W. M. GEI.RART, 1990 The transposable ele-
ment hoboof Drosophila mrlanoguster, pp. in MobikDNA, edited by D. E. BERG and M. M. HOMT.. American Society for Microbiology, Washington, t)C.
BRINK, R. A,, D. F. BROWK, J. KERMICI.E and W. H. WEYERS, 1960 Lo-
cus dependence of the paramutant Rphenotype in maize. Genet- ics 45: 1297-1312.
BRYAN, G . , D. G ~ Z A and D. HAKI'I., 1990 Insertion and excision of
the transposahle element Mariner in Drosophila. Genetics 125:
103-1 14.
BURFACT, T. E., and S. R. WESSI.ER, 1992 Tourist: a large family of small inverted repeat elements frequently associated with maize genes. Plant Cell 4: 1283-3294.
CAI,\,I, 8. R., and W. M. GEI.BART, 1994 The basis for germline speci- ficity of the hobo transposable element in Dro.rophila mrlanoguster.
EMBO J. 13: 1636-1644.
CHANI)I.ER, V . L., ,J. P. R/\I)I~:EI.IA, T. P. RonnrNs, J. CHEN and D. TLIRKS, 1989 T~vo regulatory genes of the maize anthocyanin pathway are homologous: isolation of B utilizing R genomic SC- quences. Plant Cell 1: 1175-1183.
C ; 1 w h m . , P. S., S. R. WESSI.F.R and S. L. DFLIAPORTA, 1987 Inactiva- tion of the maize transposable element Activator ( A r ) is associated with its DNA modification. EMBO J. 6 295-302.
<:or.l.ln.s, J. J., and P. ANLIERSON, 1994 The Tr5 family of transpos- able elements in Chmorhnhditis ekganc. Genetics 137: 771-781. COXSONXI, G., A. \ ' ~ o - n . r , S. I,. DEI.I.MORTA and C . TONEILL 1992
cDNA nucleotide sequence of Sn, a regulatov gene in maize. Nucleic Acids Res. 20: 373.
C:RF.SSE, A. D., S. H. Hcu RERI', W. E. AKOMY, J. R. Lr~cxi and J. L.
BENNETLES, 1995 Muhebated transposable elements of maize preferelltially insert into low copy number DNA. CTenetics 140: 315-324.
DI..I,I.AIWRTA, S. I>., 1994 Plant DNA miniprep and microprep: ver- siolls 2.1-2.3., pp. 522-525 in The M a i v Handbook, edited by M. Fw.:EI.INc: and V. W.4mo.r. Springer-Verlag, New York.
DEI.1;\ronr& S. L., and M. A. MORENO, 1994 Southern blot hybrid- iration, pp. 569-571 in Thr Maizr Handbook, edited by M. FREIC-
1.1Nc; and V. W+.I.Ro'I. Springer-Verlag, New York.
DEI.IAIWRTA, S. L., I . M. GREENBIATI, J. I>. KERMICIX, J. B. Hlms and
S. R. WESSIXK, 1988 Molecular cloning of the R-rq gene by tral~sposon tagging with Ac, pp. 263-281 in Chromosome Slructurr
an(/ Furution: Impact of Nero Conctpts, edited by J. .'I GLISTAFSON
m d R. A P F ~ I . S . Plenum Press, New York.
DEMOPLJl.OS,]. T., 1985 Characterization and fine structure analysis of mutants at the R locus of maize. Ph.D. Thesis, University of Wisconsin.
D O O N E K , H. K., 1971 Recombinational analysis of the 12-r duplica- tion in maize. Ph.D. Thesis, University of Wisconsin.
DOONFX, H. K., and J. L. KERMI(:I.k:, 1971 Structure of the R-T tan- den1 duplication in maize. Genetics 67: 427-436.
DOONER, H. K., a n d J . I.. W.MIC:I.E, 1974 Reconstitution of the R-r compound allele in maize. Genetics 78: 691-701.
Doost;K, H. K., and J. L. KERMICIX, 1976 Displaced and tandem duplications in the long arm of chromowme 10 in maize. Genet- ics 82: 309-322.
DOONER, H. K., R. JOKGENSOK and T. P. ROHHINS, 1991 Genetic and developmental control of. anthocyanin biosynthesis. Annu. Rev. Genet. 25: 173-199.
EG(;I.LSI'ON, W. B., M. AILEMAN andJ. L. WKMI(;I.E, 1995 Molecular organimtion and germinal instability of K-stzppkdmaize. Genetics 141: 347-358.
ENC;EI.S, W . R., 1990 P element5 in Drosophila mrlunogaster, pp. i n
~Mobikr UNA, edited by D. E. BERG and M. M. HOU'E. American Society for Microbiology, Washington, DC;.
FEDOROFF, N. V . , 1990 Maize transposable elements, pp. 377-41 1 in Mobilr DNA, edited by D. E. BERG and M. M. HOW:. American Society for Microbiology, Washington, DC.
FEDOROIT, N. V . , a n d J . A. BAKILS, 1988 Is the S u p ~ ~ ~ ~ o r - m u t u l o r e l c - ment controlled by a basic developmental regulatory mecha- nism? Genetics 120: 559-577.
FEINBERG, A. P., and B. VOGIXSI'EIN, 1984 A technique for radiola- beling DNA restriction fragments to high specific activity: adden- dum. Anal. Biochem. 137: 266-267.
HARIWMAN, K.J., and V. I>. CHANIXXR, 1993 Two maize genes are each targeted predominantly by distinct classes of Mu elements Genetics 1 3 5 1141-1150.
KASSIS,J. A., E. nor.^., E. P. VANSI<:~~I.E, W. F. OL)ENWAI.II and N. PERRI-
LION, I992 Altering the insertional specificity of a Drosophila trdnsposdbk clement. Proc. Natl. Acad. Sci. USA 89: 1919-1923.
KERMIC.1.K.:. ~ J , L., 1970 Dependence of the &mottled phenotype in maize on the mode of sexual transmission. Genetics 6 6 69-85.
KF.RMIc:I.I<, J. L., 1985 Alternative tests of allelism, pp. 491-507 in
Plant C;rnr/ics, edited by M. FKEEI.IKG. Alan R. Liss, New York.
KEKMI(:I.E, J. L., and J. D. AXIEI.I., 1981 Modification of chlorophyll striping by the R region. Maydica 26: 185-197.
Lt,nw~c;, S . R., L. F. HABERA, S . L. DF,I.IAPOKTA and S . R. WESSI.EK,
1989 f.c, a member of the maize K gene family responsible for tissue-specific anthocyanin production, encodes a protein similal- to transcriptional activators and contains the my-homology re- gion. Proc. Natl. Acad. Sci. USA 86: 7092-7096.
netic and molecular analysis of the Spm-dPl,mdrnl n-m2 alleles of the maize a locus. Genelics 177: 1 17- 137.
Mc:~l.lNI'o~:ti, B., 1958 The Su~pr~ssor-rnutator system uf control o f
gene action i n maize. (hrnegie Inst. Washington Year Book 57: 415-429.
Mc~'IIIRTI~K, K. S., and R. A. BRINK, 1962 Continuous variation in level or paramutation at the Rlocus in maize. Genetics 47: 1053-
1074.
MORWO, M. A,, J. CHEN, 1. GRKENHlATT and S. I>. DEI.IN~oRI'.~, 1992 Reconstitntional mutagenesis of the maize Pgene by short-rallge
A r transpositions. Genetics 131: 939-956.
Transposable clement 7 i 1 of (:amorhahdite.c rkgans recognizes specific target sequences for integration. Proc. Natl. Acad. Sci. USA 85: 861 -864.
M C S ~ ~ J K S K I , M. G., A . GIEKI. and P. A. PETERSON, 19% Genetic and molecular analysis of a three-component transposablevlement system in maize. Mol. Gen. Genet. 237: 105-112.
NA(:KF.S, UT. K. F., R. PIOTKXWIAK, H. SMDI.F.K and H. SOMMEK, 1991
The transposable element Tam1 from Antirrhinum malus shows structural homology to the maize transposon En/Spm and has no sequence specificity of insertion. Mol. Gen. Genet. 228: 201- 208.
NIXI'FKR, M. G., 1966 Stability of the Snpprasorelernent in two muta- tor systems at the A I locus in maize. Genetics 5 2 521-528. PEARSOY, W. R . , and D.,J. I.II"AS, 1988 Improved tools for biologi- M.%ssoN, P., R. SUKOShY,J. A. k N G S B l l R Y and N. FLI)EROFF, 1987 Ge-