EXPERIENCE AND REASON—Briefly Recorded
‘‘In Medicine one must pay attention not to plausible theorizing but to experience and reason together. . . . I agree that theorizing is to be approved, provided that it is based on facts, and systematically makes its deductions from what is observed. . . . But conclusions drawn from unaided reason can hardly be serviceable; only those drawn from observed fact.’’ Hippocrates: Precepts. (Short communications of factual material are published here. Comments and criticisms appear as letters to the Editor.)
Steroid Therapy of a Proliferating
Hemangioma: Histochemical and
Molecular Changes
ABSTRACT. Objectives. Hemangioma is a primary tumor of the microvasculature in which angiogenesis is initially excessive, followed by regression of the newly formed vessels. Intervention is necessary in up to 20% of cases, high-dose systemic or intralesional steroids being the first-line treatment. As the mechanism of action of steroids is unknown, we undertook an investigation of the cellular and molecular effects of their action.
Study Design. A unique opportunity to study the ef-fect of steroid treatment was presented when biopsy material was obtained from an infant with an ulcerated proliferating hemangioma before and after intralesional triamcinolone injection, which resulted in an accelerated regression of the lesion. Histochemical quantitation of mast cells, molecular analysis by reverse transcriptase-polymerase chain reaction (RT-PCR) for 7 growth factor transcripts and differential display PCR (DD RT-PCR) were conducted.
Results. After steroid therapy, the mast cell number increased (untreated x¯52.226.27 [standard error of the mean {SEM}]; treated x¯58.76.71 [SEM] mast cells per field, respectively; P < .0001; n 5 40 fields for each group), and the transcriptional expression of cytokines: platelet-derived growth factor-A and -B; interleukin-6; transforming growth factor-b1 and -b3 decreased, while that ofbasicfibroblast growth factor (bFGF) and vascular endothelial cell growth factor remained unaltered. Ele-vated urinarybFGF levels noted in cases of proliferating hemangioma, persisted even after steroid treatment. Us-ing DD RT-PCR an amplicon that shared 100% sequence homology with the human mitochondrial cytochromeb gene was detected in the hemangioma biopsy after ste-roid treatment.
Conclusions. The regression of this hemangioma sub-sequent to steroid therapy was accompanied by a signif-icant increase in mast cell density, reduced transcription of several cytokines, and an enhanced expression of the mitochondrial cytochrome b gene. Pediatrics 2000;105: 117–121; hemangioma therapy, angiogenesis, cytokines, differential display, cytochrome b.
ABBREVIATIONS. VEGF, vascular endothelial growth factor; bFGF,basicfibroblast growth factor; TGF-b, transforming growth factor-b; IL, interleukin; RT-PCR, reverse
transcriptase-polymer-ase chain reaction; DD, differential display; HPRT, hypoxanthine phosphoribosyl transferase; PDGF, platelet-derived growth factor; SEM, standard error of the mean; bp, base pair; cytb, cytochromeb.
H
emangioma, the most common tumor of in-fancy, affects up to 12% of whites1but is seen rarely in darker skin races.2 The incidence increases to 23% in premature infants with a birth weight,1000 g.3Girls are 3 times more likely to be affected.2 Although a positive family history has been noted in 10% of affected individuals,4based on a cohort of 118 twins, Cheung et al5recently showed that hereditary factors are not crucial in causing hemangiomas.Hemangioma is a primary tumor of the microvas-culature in which angiogenesis is initially excessive but is followed by a spontaneous regression of the neovasculature.1 The principal cellular constituents of proliferating hemangioma are endothelial cells along with accumulating mast cells, macrophages, plasma cells, and pericytes.6 A number of growth factors have been demonstrated as regulators of an-giogenesis including vascular endothelial growth factor (VEGF),basicfibroblast growth factor (bFGF), transforming growth factor-b(TGF-b), and interleu-kin-6 (IL-6).7,8Although the pathophysiology of hem-angioma is poorly understood, some of these factors may be involved in both its proliferation and invo-lution.6 For example, the angiogenic peptide bFGF has been shown to be elevated in the urine of infants with proliferating hemangiomas.9
The majority of hemangiomas require no interven-tion.4However, treatment is necessary in 10% to 20% of cases because of their location, size, or behavior.6,10 Various therapeutic modalities have been described including surgical excision,11 laser treatment,12 arte-rial embolization,1and cryotherapy.13 The mainstay treatment for hemangioma during proliferation is pharmacologic therapy with glucocorticoids or inter-feron-a.10High-dose systemic or intralesional steroid is the first-line treatment and a dramatic response has been observed in 30% of cases.10 The precise mechanism of action of steroids is unclear, although they are most likely to alter cellular functions by regulating cytokine expression either directly or in-directly.14 –17
Glucocorticoids are known to exert their effects by interacting directly with the glucocorticoid recep-tor.16 The activated steroid-receptor complex then binds to the gene it modulates at a specific sequence in its promoter known as the glucocorticoid respon-sive element, leading to altered gene transcription. In
Received for publication Jan 19, 1999; accepted May 4, 1999.
Reprint requests to (S.T.T.) Swee Tan Plastic Surgery Trust, Bowen Hospital, Churchill Drive, Crofton Downs, Wellington, New Zealand. E-mail: sweetan@plastsurg.co.nz
each cell, the number of genes directly regulated by steroids is estimated to be between 10 and 100, but many genes are indirectly regulated through an in-teraction with other transcription factors.18
We were presented with a unique opportunity to make clinical and experimental observations in a case of ulcerated proliferating hemangioma before and after intralesional steroid therapy. The effect of steroid therapy on the mast cell number, cytokine expression, and the identification of possible gene(s) modulated by steroids in vivo was investigated by histochemistry, reverse transcriptase-polymerase chain reaction (RT-PCR) and differential display re-verse transcriptase-polymerase chain reaction (DD RT-PCR).
METHODS Case Report
A female infant, born at 34 weeks gestation (birth weight 1765 g) developed a pink macule on her left axilla that enlarged rapidly and became ulcerated. The lesion continued to proliferate and the ulcers failed to heal despite treatment with antibiotics and dressings (Fig 1A). At 3.5 months, under general anesthesia, the hemangioma was treated with intralesional triamcinolone ace-tonide (4mg/kg), which was repeated 5 weeks later. An incisional biopsy was obtained just before each of the steroid injections, and hence samples from the same patient before and at 5 weeks after the initial steroid injection were available for analyses. Urine samples were collected concurrently for determination ofbFGF levels using an enzyme-linked immunoabsorbent assay kit (R and D Systems, Minneapolis, MN). Urinary bFGF level was 6.28 pg/mL and 5.11 pg/mL before and after treatment, respectively. Both values are above the normal levels for children (median: 1.84 pg/mL; range: .67–2.40 pg/mL).9
Tissue Samples
Fresh operative hemangioma biopsy specimens were obtained according to a protocol approved by the Wellington Ethics Com-mittee and used for histochemical and molecular studies.
Histochemistry
The operative samples were fixed in neutralized 4% buffered formalin and subsequently embedded in paraffin. Sections (5mm) were cut and mounted on polyL-lysine coated glass slides (Sigma Chemical, St Louis, MO). Sections were deparaffinized, stained with hematoxylin-eosin for histologic analysis, and Csaba stain was used to identify and quantitate mast cells as described previ-ously.19 For mast cell quantitation, 20 fields per section were
counted independently by 2 observers (Q.H. and S.G.P.) at 403 magnification using an Olympus microscope (Olympus Optical Co, Ltd, Japan).
RNA Isolation and RT-PCR Analysis
RNA was isolated from the hemangioma biopsies using Trizol reagent (Gibco-Life Technol, Gaithersburg, MD) and quantitated using hypoxanthine phosphoribosyl transferase (HPRT) as the control gene as described previously.20The transcript expression
of the cytokines bFGF, VEGF, platelet-derived growth factor (PDGF)-A and -B, IL-6, TGF-b1 and -b3, was analyzed using the Perkin-Elmer rTth kit (Norwalk, CT) as described earlier.20,21
Briefly, a 10-minute RT step was followed by 45 cycles of 3-stage PCR with a specific annealing temperature for each primer set. The PCR products were electrophoresed on 2% agarose gels in Tris-acetic acid-ethylenediamine-tetraacetic acid buffer, stained with ethidium bromide and visualized under ultraviolet light. The design of the primers, which were synthesized by Operon Tech-nologies (Alameda, CA) and Gibco-Life TechTech-nologies, was based on the published human sequences using the Oligo program (Table 1).
mRNA Isolation and DD-PCR
Biopsy material obtained before and after steroid therapy was snap frozen in liquid nitrogen and stored at270°C. mRNA was isolated using an mRNA direct kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. DD was performed by the modified method of Jurecic et al.22mRNA was reverse
transcribed using Superscript enzyme (Gibco-Life Technologies) with anchored poly-dT primers. The resulting cDNA obtained was PCR amplified withTaqpolymerase (Qiagen) using a primer mix comprising anchored oligo-dT and arbitary primers, VEGF, PDGF-A, TGF-b1,bFGF, and IL-6 (Table 1). A 3-stage PCR was conducted under the following conditions: 1) denaturing at 94°C for 30 seconds; 2) low stringency annealing temperatures that were ramped up from 41°C to 49°C for 15 seconds for the first 9 cycles and then fixed at 50°C for 26 more cycles; and 3) extension that was at 72°C for 1 minute. Samples were amplified and elec-trophoresed in duplicate, side by side on a 10% polyacrylamide gel in TAE buffer. The gel was stained with ethidium bromide and visualized under ultraviolet light. The differentially expressed bands were excised and DNA eluted overnight at 4°C in 50mL of ultra-pure (Millipore Corporation, Bedford, MA) water. Approx-imately 5mL of this was used for reamplification using anchored oligo-dT and each of the primers mentioned above. Reamplified products were isolated from 2% agarose gel and purified using a gel purification kit (Qiagen). The DNA extracted from the gel was analyzed using automatic sequencing by Waikato University (Hamilton, New Zealand).
Statistical Analysis
Data were evaluated statistically by the Student’sttest with a Pvalue,.05 being considered significant.
RESULTS Clinical
Injection of triamcinolone acetonide (Bristol-Myers Squibb Ltd, Auckland, New Zealand) resulted in accelerated regression of the hemangioma with heal-ing of the ulcers (Fig 1B). Further regression was observed during the 6-month follow-up subsequent to the second steroid injection.
Histochemistry
Hematoxylin-eosin staining of the untreated hem-angioma specimen showed proliferating endothelial masses within the papillary and reticular dermis. In some areas the endothelial cells were organized into capillary tubes. Histologically, apart from fibrosis, few overt changes were observed after steroid treat-ment (data not shown). The Csaba stain showed that virtually all of the mast cells were of biogenic amine phenotype and their number increased significantly after steroid therapy from a mean of 2.22 6 .27 Fig 1. A, an ulcerated proliferating hemangioma in the left axilla
(standard error of the mean [SEM]) to 8.77 6 .71 (SEM;P, .0001;n 540 fields for each group).
RT-PCR
For the cytokines PDGF-A and -B, IL-6, TGF-b1 and -b3 there was a reduction in mRNA after steroid treatment, while the transcripts of bFGF and VEGF remained unchanged (Fig 2).
DD RT-PCR
DD analysis revealed the presence of an;370-base pair (bp) amplicon exclusively in the steroid treated sample (Fig 3A). Reamplification showed that this band was amplified by anchored poly-dT andbFGF primers (Fig 3B). The sequence obtained was com-pared with sequences in the Gene Bank database (National Institutes of Health, Bethesda, MD) using BLAST and showed 100% homology with the human mitochondrial cytochrome b (cyt b) gene. The up-regulation of cyt b in the biopsy obtained after ste-roid therapy was further confirmed by RT-PCR us-ing human mitochondrial cytbspecific primers.
DISCUSSION
All hemangiomas eventually involute. However, treatment is indicated during infancy in 10% to 20% of cases. Steroids are effective in treating a number of conditions including proliferating hemangiomas. In-tralesional corticosteroid is regarded as the treatment of choice for localized hemangiomas.23 The cellular and molecular biology of hemangiomas and their spontaneous or therapy-induced regression are still
largely unexplored. Understanding of the molecular pathways that are active in these tumors could lead to more effective therapies because molecules that could be contributing to the proliferation or involu-tion of these tumors could be targeted.24 It is well established that cytokines play an important role in normal physiology as well as in the pathophysiology of disease.25 Cytokines are putative regulators of hemangioma proliferation and involution. Alteration of the cytokine milieu or of the expression of specific genes within the lesion by steroid therapy, provides insight into the possible mechanism by which hem-angiomas respond to steroids.
Hemangioma is characterized by the proliferation of capillary endothelial cells with multilamination of the basement membrane and accumulation of cellu-lar elements, including macrophages, plasma cells, pericytes, and mast cells.6,26The number of mast cells increases in late proliferating and involuting phas-es.1,26It has been suggested that one of the functions of mast cells is to release factors leading to regression of the neovessels.10The fourfold increase of mast cell number after steroid treatment observed in this study supports this hypothesis and indicates that in this clinical condition the glucocorticoids are altering the developmental time course resulting in acceler-ated involution.
High urinary bFGF levels have been noted in in-dividuals with proliferating hemangioma.9The ele-vated level observed in this case persisted after ste-roid therapy. Concurrent with this observation was the finding that bFGF transcripts in the biopsies re-TABLE 1. The Genes Analyzed and the Primer Sequences Used for RT-PCR and DD-PCR
Gene Primers (Sense and Anti-sense) Product
Size
Annealing Temperature
HPRT 59CCTTTGGGCGGATTGTTGT39 395 bp 52°C
59TTTTTTTTTTTTTTAAATTTTTGGGAAT39
PDGF-A 59CCTGCCCATTCGGAGGAAGAG39 225 bp 61°C
59TTGGCCACCTTGACGCTGCG39
PDGF-B 59GAAGGAGCCTGGGTTCCCTG39 217 bp 61°C
59TTTCTCACCTGGACAGGTCG39
TGF-b1 59GGAAACCCACAACGAAATCTATGAC39 301 bp 56°C
59TTCCCCTCCACGGCTCAAC39
TGF-b3 59CTGGCGGAGCACAACGAACT39 312 bp 56°C
59GGACTCTCTTCTCAACAGCCACTCAC39
IL-6 59GAGAAAGGAGACATGTAACAAGAGTAA39 319 bp 61°C
59GGCATTTGTGGTTGGGTCAG39
bFGF 59AGCGACCCTCACATCAAGC39 145 bp 61°C
59AAAAGAAACACTCATCCGTAACACA39
VEGF 59AGTACGAGGGCCTGGAGTGTG39 434 bp 56°C
59AGATCCGCAGACGTGTAAATG39
mained unaltered after treatment. The mRNA for another proangiogenic peptide, VEGF, was also un-altered. These results suggest that the production and metabolism of bothbFGF and VEGF, which are considered to be involved in the pathogenesis of hemangioma,6 are relatively unaffected by the ad-ministration of triamcinolone. However, the tran-scripts for the cytokines PDGF-A and -B, IL-6, TGF-b1 and -b3 were reduced by the steroid. The
decrease in transcription of the PDGFs, which are considered to promote cell proliferation, indicates that steroid may cause accelerated regression of the proliferating hemangioma via inhibition of these cy-tokines. The decrease in mRNA of IL-6, another growth factor that plays a role in angiogenesis,7was observed after therapy. This cytokine has been re-ported to be attenuated by glucocorticoids.14The re-duction in the transcripts of the 2 isoforms of TGF-b was not unexpected as steroids have been shown to alter the expression of this growth factor.25
DD RT-PCR allows identification of differentially expressed genes in various cell types and under de-fined physiologic conditions. The amplicon identi-fied, isolated, and sequenced from the hemangioma sample after steroid treatment using the DD ap-proach was that of the human mitochondrial gene, cyt b. Sekeris27 proposed that the mitochondrial ge-nome is a primary site of action of steroid hormones. Although the influence of steroids on mitochondrial transcription is well documented, the mechanism of action has only recently been elucidated.28It has been demonstrated that mitochondrial DNA contains se-quences in close proximity to the cyt b gene which share similarity to the glucocorticoid responsive ele-ments.29 It is interesting to note that an elevated expression of cyt b has been reported recently in senescent human cells30and in the involuting lactat-ing mammary gland followlactat-ing weanlactat-ing.31 These studies and our findings suggest that the steroid treatment enhances cyt b expression, which may have a role in the regression of hemangioma. Ele-vated cellular respiration, characterized by raised levels of mitochondrial respiratory chain compo-nents including cytb, may be responsible for inhib-iting angiogenesis as increased oxygen metabolism inhibits angiogenesis.32,33 Further study will be re-quired to understand the functional role of cyt bin the steroid-induced regression of hemangioma.
CONCLUSION
In summary, we have shown that triamcinolone, which resulted in accelerated regression of a prolif-erating hemangioma, increased the mast cell num-ber, reduced the transcription of the growth factors, PDGF-A and -B, IL-6, TGF-b1 and -b3 but did not affect bFGF and VEGF. In addition, there was up-regulation of the mitochondrial cyt b gene expres-sion. To our knowledge, this is the first report on the cellular and molecular effects of steroid therapy on hemangioma.
Qurratulain Hasan, PhD* Swee T. Tan, MBBS, FRACS*‡ Jason Gush, BSc§
Sue G. Peters, BSc* Paul F. Davis, PhD*
*Department of Medicine, Wellington School of Medicine
‡Swee Tan Plastic Surgery Trust
§Malaghan Institute of Medical Research Wellington, New Zealand
ACKNOWLEDGMENTS
This work was supported by grants from the University of Otago Internal Research Fund, the Wellington Medical Research
Foundation, the Reconstructive Plastic Surgery Research Founda-tion, the Maurice and Phyllis Paykel Trust, Lottery Health Re-search, and the Health Research Council of New Zealand.
We are grateful to C. Marstella for her assistance in the prep-aration of this manuscript.
REFERENCES
1. Mulliken JB, Young AE.Vascular Birthmarks: Hemangiomas and Vascular Malformations.Philadelphia, PA: WB Saunders; 1988:41–103
2. Hidano A, Nakajima S. Earliest features of the strawberry mark in the newborn.Br J Dermatol.1972;87:138 –144
3. Amir J, Metzker R, Krikler R, Reisner SH. Strawberry haemangioma in preterm infants.Pediatr Dermatol.1986;3:131–132
4. Margileth AM, Museles M. Cutaneous hemangiomas in children: diag-nosis and conservative management.JAMA.1965;194:523–552 5. Cheung DSM, Warman ML, Mulliken JB. Haemangioma in twins.Ann
Plast Surg.1997;38:269 –274
6. Takahashi K, Mulliken JB, Kozakewich HPW, Rogers RA, Folkman J, Ezekowitz RAB. Cellular markers that distinguish the phases of hem-angioma during infancy and childhood.J Clin Invest.1994;93:2357–2364 7. Folkman J, Klagsbrun A. Angiogenesis factors. Science. 1987;235:
442– 447
8. Folkman J. Angiogenesis in cancer, vascular, rheumatoid, and other diseases.Nature Med.1995;1:27–31
9. Fishman SJ, Mulliken JB, MacDonald DM, Folkman J. Urinarybasic
fibroblastic growth factor is useful in differentiating hemangiomas from vascular malformations. Proceedings of the 11th International Work-shop on Vascular Anomalies; Rome, Italy; June 23–26, 1996; page 14 10. Mulliken JB, Boon LM, Takahashi K, Ohlms LA, Folkman J, Ezekowitz
AB. Pharmacologic therapy for endangering hemangiomas.Curr Opin Dermatol.1995;109 –113
11. Zide BM, Glat PM, Stile FL, Longaker MT. Vascular lip enlargement: part I. Hemangiomas—tenets of therapy.Plast Reconstr Surg.1997;100: 1664 –1673
12. Landthaler M, Hohenleutner U, Abd El-Raheem T. Laser therapy of childhood haemangiomas.Br J Dermatol.1995;133:275–281
13. Cremer H. The importance of contact cryosurgery in early therapy of hemangiomas in infancy. Proceedings of the 11th International Work-shop on Vascular Anomalies; Rome, Italy; June 23–26, 1996; page 6 14. Breuninger LM, Dempsey WL, Uhl J, Murasco DM. Hydrocortisone
regulation of IL-6 protein production by purified population of human peripheral blood monocytes. Clin Immunol Immunopathol. 1993;69: 205–214
15. Almawi WY, Beyhum HN, Rahme AA, Rieder MJ. Regulation of cyto-kine and cytocyto-kine receptor expression by glucocorticoids.J Leukoc Biol.
1996;60:563–572
16. Brattsand R, Linden M. Cytokine modulation by glucocorticoids: mech-anisms and actions in cellular studies.Aliment Pharmacol Ther.1996;10: 81–90
17. Cai J, Zheng T, Lotz M, Zhang Y, Masood R, Gill P. Glucocorticoids induce Kaposi’s sarcoma cell proliferation through the regulation of TGF-b.Blood.1997;89:1491–1500
18. Barnes PJ. Anti-inflammatory mechanisms of glucocorticoids. Trans Biochem Soc.1995;23:940 –945
19. Ru¨ger BM, Dunbar PR, Hasan Q, Sawada H, Kittleberger R, Greenhill N, Neale TJ. Human mast cells produce type VIII collagen in vivo.Int J Exp Pathol.1994;75:397– 404
20. Ru¨ger BM, Hasan Q, Greenhill NS, Davis PF, Dunbar PR, Neale TJ. Mast cells and type VIII collagen in human diabetic nephropathy. Diabetolo-gia.1996;39:1215–1222
21. Hasan Q, Dunbar PR, Murray-McIntosh RP, Neale TJ. Transforming growth factorbisoforms in human glomerulonephropathies. Nephrol-ogy.1998;4:353–359
22. Jurecic R, Nguyen T, Belmont JW. Differential mRNA display using anchored oligo-dT and long sequence-specific primers as arbitrary primers.Trends Genet.1996;12:502–504
23. Kushner BJ. The treatment of periorbital infantile hemangioma with intralesional corticosteroid.Plast Reconstr Surg.1985;76:517–524 24. Wyman LC, Fulton GP, Shulman MH. Direct observations on the
cir-culation in the hamster cheek pouch in adrenal insufficiency and ex-perimental hypercorticalism.Ann N Y Acad Sci.1953;56:643– 658 25. Border WA, Rouslahti E. Transforming growth factor-bin disease: the
dark side of tissue repair.J Clin Invest.1993;90:1–7
26. Dethlefsen SM, Mulliken JB, Glowacki J. An ultrastructural study of mast cells interactions in hemangiomas.Ultrastruct Pathol. 1986;10: 175–183
27. Sekeris CE. The mitochondrial genome is a primary site of action of
steroid and thyroid hormones.In Vivo.1990;4:317–320
28. Demonnacos C, Djordjevic-Markovic R, Tsawdaroglou N, Sekeris CE. The mitochondrion as a primary site of action of glucocorticoids: the interaction of the glucocorticoid receptor with mitochondrial DNA sequences showing partial similarity to the nuclear glucocorticoid re-sponsive elements.J Steroid Biochem Mol Biol.1995;55:43–55
29. Tsiriyotis C, Spandidas DA, Sekeris CE. The mitochondrion as a pri-mary site of action of glucocorticoids: mitochondrial nucleotide se-quences, showing similarity to hormone response elements, confer dexamethasone inducibility to chimaeric genes transfected in LATK2
cells.Biochem Biophys Res Comm.1997;35:349 –54
30. Kodama S, Yamanda H, Annale L, Barret C. Elevated expression of mitochondrial cytochromeband NADH dehydrogenase subunit 4/4L genes in senescent human cells.Exp Cell Res.1995;219:82– 86 31. Lee M, Kim H, Jeon D, et al. Iron metabolism-related genes and
mito-chondrial genes are induced during involution of mouse mammary gland.Biochem Biophys Res Comm.1996;224:164 –168
32. Knighton DR, Silver MA, Hunt TK. Regulation of wound-healing angiogenesis: effect of oxygen gradients and inspired oxygen concen-tration.Surgery.1981;90:262–270
33. Knighton DR, Hunt TK, Scheuentuhl H, Halliday BJ, Werb Z, Banda MJ. Oxygen tension regulates the expression of angiogenesis factor by mac-rophages.Science.1983;221:1283–1285
Gastric Perforation Attributable to
Liquid Nitrogen Ingestion
ABSTRACT. Despite the widespread use of liquid nitro-gen in medicine and industry, there are only a few reports of injuries associated with its use. We report a case of a 13-year-old boy who developed gastric perforation after liquid nitrogen ingestion. This is a previously unreported complication. Pediatrics 2000;105:121–123; liquid nitrogen, perforation, stomach, inhalation, ingestion.
ABBREVIATION. GI, gastrointestinal.
I
njuries related to liquid nitrogen exposure are usually either attributable to direct contact (face, limbs) or a result of inhalation of the evaporated liquid (damage to the mucosa of the upper respira-tory or gastrointestinal [GI] tract). Ingestion of liquid nitrogen is extremely uncommon and gastric perfo-ration has not previously been reported. This article reports such a case.CASE PRESENTATION
A 13-year-old boy was transferred to our hospital after ingest-ing of a mixture of orange crystals with liquid nitrogen. This was a part of a science experiment in which students were given orange crystals, liquid nitrogen, and water to mix and produce a frozen drink to demonstrate the freezing effect of liquid nitrogen. After swallowing the still smoking mixture, he instantly devel-oped an intense burning sensation in the back of his throat and severe abdominal pain, followed by abdominal distention and shortness of breath. On examination in the referring hospital he was hemodynamically stable. Bilateral cervical subcutaneous em-physema was noted. There were no burns to his face, lips, or tongue. There was decreased air entrance to both lungs. The
Received for publication Jan 1, 1999; accepted May 5, 1999.
Reprint requests to (B.Z.K.) Department of Radiology, Hadassah Medical Center, PO Box 12000, Jerusalem 91120, Israel. E-mail: bkoplewitz@ hadassah.org.il
DOI: 10.1542/peds.105.1.117
2000;105;117
Pediatrics
Qurratulain Hasan, Swee T. Tan, Jason Gush, Sue G. Peters and Paul F. Davis
Changes
Steroid Therapy of a Proliferating Hemangioma: Histochemical and Molecular
Services
Updated Information &
http://pediatrics.aappublications.org/content/105/1/117
including high resolution figures, can be found at:
References
http://pediatrics.aappublications.org/content/105/1/117#BIBL
This article cites 29 articles, 3 of which you can access for free at:
Subspecialty Collections
http://www.aappublications.org/cgi/collection/coding_corner
Coding Corner
following collection(s):
This article, along with others on similar topics, appears in the
Permissions & Licensing
http://www.aappublications.org/site/misc/Permissions.xhtml
in its entirety can be found online at:
Information about reproducing this article in parts (figures, tables) or
Reprints
http://www.aappublications.org/site/misc/reprints.xhtml
DOI: 10.1542/peds.105.1.117
2000;105;117
Pediatrics
Qurratulain Hasan, Swee T. Tan, Jason Gush, Sue G. Peters and Paul F. Davis
Changes
Steroid Therapy of a Proliferating Hemangioma: Histochemical and Molecular
http://pediatrics.aappublications.org/content/105/1/117
located on the World Wide Web at:
The online version of this article, along with updated information and services, is
by the American Academy of Pediatrics. All rights reserved. Print ISSN: 1073-0397.
