• No results found

Maternal Transmission Ratio Distortion at the Mouse Om Locus Results From Meiotic Drive at the Second Meiotic Division

N/A
N/A
Protected

Academic year: 2020

Share "Maternal Transmission Ratio Distortion at the Mouse Om Locus Results From Meiotic Drive at the Second Meiotic Division"

Copied!
8
0
0

Loading.... (view fulltext now)

Full text

(1)

©

DOI: 10.1534/genetics.104.039479

Maternal Transmission Ratio Distortion at the Mouse

Om

Locus Results From

Meiotic Drive at the Second Meiotic Division

Guangming Wu,*

,1

Lanping Hao,* Zhiming Han,* Shaorong Gao,*

,2

Keith E. Latham,*

,†

Fernando Pardo-Manuel de Villena

and Carmen Sapienza*

,§,3

*Fels Institute for Cancer Research and Molecular Biology,§Department of Pathology and Laboratory Medicine andDepartment of Biochemistry, Temple University School of Medicine, Philadelphia, Pennsylvania 19140 andDepartment of Genetics, Lineberger Comprehensive Cancer

Center, Carolina Center for Genome Sciences, University of North Carolina, Chapel Hill, North Carolina 27599-7264 Manuscript received December 9, 2004

Accepted for publication January 28, 2005

ABSTRACT

We have observed maternal transmission ratio distortion (TRD) in favor of DDK alleles at the Ovum mutant (Om) locus on mouse chromosome 11 among the offspring of (C57BL/6⫻DDK) F1females and C57BL/6 males. Although significant lethality occurs in this backcross (ⵑ50%), differences in the level of TRD found in recombinantvs.nonrecombinant chromosomes among offspring argue that TRD is due to nonrandom segregation of chromatids at the second meiotic division,i.e., true meiotic drive. We tested this hypothesis directly, by determining the centromere andOm genotypes of individual chromatids in zygote stage embryos. We found similar levels of TRD in favor of DDK alleles atOmin the female pronucleus and TRD in favor of C57BL/6 alleles atOmin the second polar body. In those embryos for which complete dyads have been reconstructed, TRD was present only in those inheriting heteromorphic dyads. These results demonstrate that meiotic drive occurs at MII and that preferential death of one genotypic class of embryo does not play a large role in the TRD.

W

HEN females of the DDK inbred mouse strain are segregate as a single locus (Ovum mutant, Om) and have been mapped to a small region of mouse chromo-mated with males of many other inbred strains,

up to 95% of the resulting embryos die prior to the some 11 (Baldacciet al. 1996;Pardo-Manuel de Vil-lenaet al. 1997; F.Pardo-Manuel de Villenaand C. completion of preimplantation development (

Waka-sugi1974). The reciprocal crosses, between DDK males Sapienza,unpublished results).

Two of the four F1 backcrosses, that between DDK

and non-DDK females, are fully viable and fertile

(Wakasugi1974). This unusual system of polar, preim- females and (C57BL/6⫻ DDK) F1 males and that

be-tween (C57BL/6 ⫻ DDK) F1 females and C57BL/6

plantation lethality has been termed the “DDK

syn-drome” (Babinet et al. 1990). Ovary transfer experi- males, exhibit intermediate levels of lethality ( Waka-sugi1974;Pardo-Manuel de Villenaet al. 1999). We ments (Wakasugi1973), genetic experiments using F1

backcrosses (Wakasugi1974), and pronuclear transfer observed transmission ratio distortion (TRD, defined as a statistically significant departure from the Mendelian experiments (Mann1986;RenardandBabinet1986)

all indicate that the preimplantation lethality results ratio expected) in favor of DDK alleles at theOmlocus in both of the semilethal F1backcrosses. In the case of

from the interaction of a DDK ovum gene product with

a non-DDK paternal gene. the backcross between DDK females and F1 males, the

high level of TRD (⬎80%) was due to death of embryos The failure to segregate the gene encoding the DDK

maternal product and the lethally interacting paternal inheriting the lethally interacting “alien” (C57BL/6) paternal allele from their F1fathers. [In fact, we mapped

gene among a modest number of F1backcross offspring

ledWakasugi(1974) to propose that the genetic factors the location ofOmto chromosome 11 by determining the position of maximum TRD in surviving offspring responsible for DDK syndrome resided at the same

lo-cus. Consistent with this interpretation, both the mater- from this backcross (Sapienzaet al. 1992).]

nal factor and the lethally interacting paternal gene We also observed TRD atOmamong the offspring of (C57BL/6⫻DDK) F1females and C57BL/6 males in

multiple independent experiments (Pardo-Manuel de Villenaet al. 1996, 1997, 2000a,b). The level of TRD

1Present address:Max Planck Institute for Molecular Biomedicine,

Muenster, Germany 48149. in favor of maternal DDK alleles in this backcross (as well 2Present address:Department of Animal Science, University of

Con-as those involving additional strains of males;Pardo

-necticut, Storrs, CT 06269-4040.

Manuel de Villenaet al. 2000a;Kim et al. 2005) was

3Corresponding author:Fels Institute for Cancer Research and

Molecu-modest, ranging from 56 to 62.8% in individual

experi-lar Biology, Temple University School of Medicine, 3307 N. Broad

St., Philadelphia, PA 19140. E-mail: sapienza@temple.edu ments (summarized inPardo-Manuel de Villena et

(2)

oviduct with sharp tweezers. Adherent cumulus cells were

re-al. 2000a). Although there was significant embryonic

moved by repeated pipetting through a small-bore glass

pi-death in the backcross of (C57BL/6⫻DDK) F1females pette after 5 min of enzyme treatment and one-cell embryos

to C57BL/6 males, we also considered the possibility were washed and cultured in CZB medium (Chatotet al. that TRD was not due to preferential loss of offspring 1989) for 2–5 hr before microsurgery. CZB culture drops were

equilibrated in a humidified incubator (37⬚, 5% CO2in air)

of one genotypic class. We formulated a genetic test,

for at least 1 hr before embryo culture.

based on the expectations of a single-locus lethality

Micromanipulation and DNA preparation: One-cell

em-model and an alternative em-model of nonrandom

segrega-bryos were transferred into CZB medium containing 10␮g/ml

tion of chromosomes during the first or second meiotic cytochalasin B and 0.4g/ml demecolcine drop and placed in division (Pardo-Manuel de Villenaet al. 2000a). We the incubator for 20–30 min before microsurgery. Enucleation was performed in M2 medium containing cytochalasin and

found that the level of TRD differs among surviving

demecolcine using pipettes of 20-␮m outer diameter on a

offspring, being significantly greater when they inherit

Leitz micromanipulator with Piezo-drill controller PMM-150

a recombinant (nonparental) than a nonrecombinant (Prime Tech, Ibaraki, Japan). To distinguish between mater-(parental) chromosome 11 (Pardo-Manuel de Vil- nal and paternal pronuclei, the embryo was held in such a lenaet al. 2000a). This observation was not consistent way that the second polar body was at the one o’clock or five o’clock position and both pronuclei were seen clearly at the

with the expectations of a single-locus lethality model

same time (Figure 1). The maternal pronucleus was selected

but was consistent with the possibility that TRD atOm

as the one closer to the second polar body and smaller in size

was due to meiotic drive at the second meiotic division. than the male pronucleus. Each polar body or pronucleus We have tested the meiotic drive hypothesis directly, was transferred separately into eight-strip 0.2-ml PCR tubes by removing the female pronucleus and second polar containing 1␮l of 17-␮msodium dodecyl sulfate (SDS) and 2␮l of 125-␮g/ml proteinase K (Holdinget al. 1993) overlaid

body from zygote stage embryos and determining the

with a drop of paraffin oil and then incubated at 37⬚overnight

genotype of the single chromatid contained in each

followed by 15 min at 95⬚to inactivate the enzyme.

meiotic product at markers linked closely to the centro- Microsurgery was attempted on a total of 378 zygotes. Three mere and to Om. We find that TRD is present at the hundred ten of the zygotes were from the cross (C57BL/6J

DDK) F1 ⫻C57BL/6J, 40 zygotes were from (C57BL/6J ⫻

zygote stage and occurs reciprocally and to the same

DDK) F1⫻PANCEVO/EiJ, and 28 zygotes were from (C57BL/

level in the maternal pronucleus and second polar body.

6J⫻DDK) F1⫻PERA/EiJ. There was no significant difference

Furthermore, TRD occurs only in dyads (the pair of

in the distribution of genotypes atOmbetween the maternal

chromatids that compose one chromosome of a biva- pronucleus and second polar body among the three strains lent) in which one chromatid has recombined between of males (␹2 1.45, P 0.05); therefore, the data were

combined.

the centromere and Om; i.e., TRD occurs only in ova

The PANCEVO/EiJ and PERA/EiJ strains were selected for

in which it is possible to make a segregational choice

use in this experiment because males of these strains had been

between DDK and C57BL/6 alleles at Om at meiosis

pretested for TRD among live-born offspring (to determine

(M)II. The results of this experiment are consistent the paternalOm phenotype of additional strains; Kimet al. with the interpretation that nonrandom segregation of 2005). Once significant TRD was demonstrated among the offspring of these males; they (i.e., the same individuals) were

chromosomes between the oocyte and second polar

used as sires in the present experiment.

body is responsible for TRD.

Nested PCR and genotype determination:The genotypes

of the samples were determined using nested PCR, as de-scribed byEl-Hashemiteet al.(1997), with minor modifica-tions (see below). Two sets of specific primer pairs (outer and MATERIALS AND METHODS

inner primers; Table 1) were designed for each microsatellite

Mouse crosses and embryo collection: The DDK inbred marker:D11Mit71, linked closely to the centromere [at

posi-strain was a gift of Charles Babinet (Institute Pasteur, Paris) tion 1.1 cM (http://www.informatics.jax.org/) and physical posi-and has been maintained in a specific pathogen-free facility tion 6825228–6825411 (NCBI m33)], andD11Spn1orD11Spn4. at Temple University Medical School since 1997. C57BL/6J, D11Spn1is at position 47 cM and physical position 81773654– PERA/EiJ, and PANCEVO/EiJ strains were purchased from 81773802 bp [http://www.ensembl.org/Mus_musculus/ (NCBI The Jackson Laboratory (Bar Harbor, ME). In all crosses de- m33)] and is very closely linked to Om (Pardo-Manuel de

scribed in the text, the dam is listed first and sire second. Villena et al. 2000a). D11Spn4 is just proximal to Om (at (C57BL/6J ⫻ DDK) F1 females (8–16 weeks old, bred in position 46.5 cM;F. Pardo-Manuel de Villena, unpublished house) in natural estrus were set up for mating with C57BL/ results) and at physical position 81612112–81612303 bp [http:// 6J, PERA/EiJ or PANCEVO/EiJ males in the afternoon. All www.ensembl.org/Mus_musculus/ (NCBI m33)]. PCRs with the of the males used as sires had been tested previously for TRD D11Spn1marker were not as robust as with theD11Spn4marker in favor of the inheritance of DDK alleles atOmamong their in the PANCEVO/EiJ strain. On days when PANCEVO/EiJ offspring and similar levels of TRD favoring the transmission plugs were obtained, theD11Spn4marker was substituted in of the maternal DDK allele at Omare observed in all three all PCRs for that day, including those with pronuclei/polar crosses (Pardo-Manuel de Villenaet al. 2000a;Kim et al. bodies from C57BL/6J or PERA/EiJ plugs.

(3)

TABLE 1

Primer sequence information for nested PCRs

Nested

Microsatellite product

marker Outer primer Inner primer size (bp)

D11Mit71 Forward catacctggtagcgtgttcc tgaccctgtgtaattgtgatcc

Reverse gtagattcaaacacca gtaagtg aattttcagatgtagccataagcc 184 D11Spn1 Forward cccttgctcttgctgacatct atagaaccacagcctgtaagcc

Reverse catgtggaaagcgtgcag tggcaggatgtggattttctccc 149 D11Spn4 Forward cgcgcaacaactttcaatta gtcttctggaaacctgaaagc

Reverse agctggtgggggtgttagaac gagaattgagggaaaattgtc 192

and dTTP), 0.05 units/␮lTaqpolymerase, and 0.1␮meach male pronucleus, and second polar body were removed outer primer. Cycling conditions were an initial 3-min denatur- from zygote stage embryos by microsurgery (see materi-ation at 95⬚, followed by 25 cycles, each consisting of a 30-sec

als and methodsand Figure 1) and genotypes at the

denaturation at 94⬚, a 45-sec annealing at 55⬚, and a 1-min

centromere and atOmof each chromatid were inferred

extension at 72⬚. These 25 cycles were followed by a 7-min

extension at 72⬚. Nested amplifications used 1.2␮l of the by PCR for informative loci linked closely to the

centro-primary PCR product as the template in a total reaction vol- mere and toOm(seematerials and methods). ume of 12␮l. Amplifications contained 250␮meach

deoxy-The nested PCRs used proved very robust, and we

nucleoside triphosphate (dATP, dCTP, dGTP, and dTTP),

achieved 86% success in determining all four relevant

0.05 units/␮lTaqpolymerase, and 0.1␮meach inner primer.

Nested cycling conditions were as described for the primary genotypes;i.e., both the centromere genotype and the

amplification, except that 35 cycles were used. Reaction prod- Omgenotype in both the maternal pronucleus and the ucts were subsequently maintained at 4⬚until they were ana- second polar body were determined for 326 out of the lyzed by 2% agarose gel electrophoresis.

378 zygotes tested (a representative example is shown

Negative controls were included in each experiment and

in Figure 2). We also determined the centromere and

paternal pronuclei acted as an internal positive control in that

DDK alleles should never be amplified. The genotype of each Omgenotypes in⬎90% of the paternal pronuclei and

sample at each locus was assigned according to the nested we did not observe a DDK allele in any case, indicating PCR product size difference between C57BL/6J and DDK

that confusion of maternal and paternal pronuclei

oc-alleles found in the female pronucleus and second polar body

curred rarely, if at all (seematerials and methods).

(Figure 2).

Statistical analysis:Departure from 1:1 allelic ratios in each If the TRD we observed in previous experiments

comparison class for the predictions of meiotic drive (i.e., (Pardo-Manuel de Villenaet al. 1996, 1997, 2000a,b) reciprocal TRD in female pronuclei and second polar bodies

occurred as a result of meiotic drive rather than

embry-and TRD in heteromorphic dyads) was evaluated using the

chi-onic death associated with the DDK syndrome, TRD

square test with 1 d.f.

Note on terminology:The designation of a dyad as “hetero- should be present at the zygote stage;i.e., there should

morphic” or “homomorphic” refers only to recombination be more OmDDK alleles thanOmC57BL/6 alleles in female events between the centromere andOm. Because of the risk pronuclei. To test this prediction we used all maternal of nondisjunction in so-called E0tetrads, recombination has

pronuclei for whichOmgenotype was determined

suc-occurred, in all likelihood, betweenOmand the telomere on

cessfully (in 353/378 zygotes, or 93% success),

regard-those dyads designated as homomorphic (seeBromanet al.

2002;de la Casa-Espero´ net al.2002). Note, also, that dyads less of whether the genotype at the centromere or either

composing one nonrecombinant chromatid and one chroma- polar body genotype was determined successfully (Table tid on which two recombination events have occurred between

2). A significant excess of DDK alleles was found in

the centromere andOm are also considered homomorphic

maternal pronuclei (␹2 ⫽ 5.24; P0.05, Table 2), for the purposes of the predictions of the genetic model [see

Pardo-Manuel de Villenaet al.2000a, Figure 1, for a de- consistent with this prediction.

tailed consideration (provided as supplementary material at Our previous genetic data (Pardo-Manuel de Vil-http://www.genetics.org/supplemental/)]. Finally, we do not

lenaet al. 2000a) also predicted that meiotic drive was

intend to imply that theResponder(the locus acted upon by

occurring at the second meiotic division rather than at

theDistorterto create transmission ratio distortion in this

sys-the first. This hyposys-thesis makes sys-the fursys-ther prediction

tem) andOmare identical, although the two are linked closely

(Pardo-Manuel de Villenaet al.2000c). that TRD should be present in both the maternal

pronu-cleus and the second polar body, but in opposite direc-tions (Pardo-Manuel de Villenaet al. 2000a). To test

RESULTS

this prediction we used all of the second polar bodies for whichOmgenotype was determined successfully (in

Reciprocal TRD atOmis observed in the female

(4)

Figure 1.—A representative enucleation series. Top left: a zy-gote positioned so that both ma-ternal and pama-ternal pronuclei are visible, with maternal pronucleus closer to the second polar body. Top right: the embryo after re-moval of the maternal pronucleus (maternal pronucleus is posi-tioned in the enucleation pi-pette). Bottom left: the embryo after removal of the paternal pro-nucleus (in enucleation pipette). Bottom right: the embryo after re-moval of the second polar body (in enucleation pipette).

results were, again, consistent with this prediction (␹2⫽ C57BL/6 allele to the second polar body. This situation

occurs at MII only when the dyad remaining in the 5.58 ;P⬍0.05, Table 2). There was significant TRD in

favor of DDK alleles in the maternal pronucleus and ovum after MI is heteromorphic;i.e., there has been a recombination event between the centromere andOm

also significant TRD in favor of C57BL/6 alleles in the

second polar body. on one chromatid and no recombination event between the centromere and Omon the other (see materials TRD is observed only in embryos that contain

hetero-morphic dyads at MII:The data in Table 2 demonstrate and methods and Pardo-Manuel de Villena et al. 2000a, Figure 1).

that TRD was present in the embryos before any lethality

due to the DDK syndrome had taken place, indicating We reconstructed the dyad present in the ovum after MI (i.e., successful determination of centromere and that nonrandom segregation of chromatids occurred at

MII. If this is the case, then TRD must occur as a result Omgenotype in both maternal pronucleus and second polar body) in 326 cases (Table 2). There was no evi-of preferential segregation evi-of the chromatid carrying a

DDK allele atOm to the maternal pronucleus and the dence of TRD among embryos that inherited a homo-morphic maternal dyad, consistent with the interpreta-preferential segregation of the chromatid carrying a

Figure 2.—Representative

(5)

TABLE 3 TABLE 2

InferredOmgenotype of individual chromatids segregated to Comparison of female pronuclearOmgenotypes

in complete dyads maternal pronuclei or second polar bodies

No.OmDDK No.OmC57BL/6 Total No.OmDDK No.OmC57BL/6 in female in female

Maternal pronucleus 198a 155 353

pronucleus pronucleus Total

Second polar body 159 204b 363

Heteromorphic dyads 156a 120 276

Total 357 359 716

Homomorphic dyads 24 26 50

All successful D11Spn1 or D11Spn4 determinations are Total 180 146 326

shown.

aH0: equal transmission ofOmDDKandOmC57BL/6to maternal Homomorphic dyads are those for which theOmgenotype is the same in both female pronucleus and second polar body. pronucleus;␹2⫽5.24,P0.05.

bH0: equal transmission ofOmDDKand OmC57BL/6to second Heteromorphic dyads are those for which theOmgenotype differs between female pronucleus and second polar body. polar body;␹25.58,P0.05.

aH0: equal transmission of OmDDKandOmC57BL/6 in hetero-morphic dyads;␹24.70,P0.05.

tion that nonrandom segregation of chromosomes did not take place at MI in this system (49.9⫾1.9%OmDDK

occurs at MII, while the nonrandom segregation of uni-alleles present at MI). There was, however, significant

valent X chromosomes and Robertsonian translocations TRD in embryos that inherited a heteromorphic

mater-occurs at MI. Higher levels of maternal TRD (ⵑ80%) nal dyad (␹24.70 ;P0.05, Table 3), consistent with

have been observed in favor of chromosome 1 con-the expectations of meiotic drive at MII.

taining a large homogeneously staining region ( Agul-nik et al. 1990); however, preferential segregation of

DISCUSSION this chromosome appears to occur at both MI and MII so

that the exploitation of some common aspect of spindle We tested the hypothesis that TRD at Om occurs as

asymmetry in this system is also not ruled out. a result of meiotic drive at MII (Pardo-Manuel de

Although we have demonstrated that TRD is present

Villenaet al. 2000a). Our results demonstrate the

fol-in both zygotes (this report) and live-born offsprfol-ing (sum-lowing: (1) significant TRD in favor of DDK alleles is

marized inPardo-Manuel de Villenaet al.2000a), cer-present at the zygote stage in female pronuclei; (2)

tain aspects of the zygote data exhibit unexpected charac-significant and reciprocal TRD in favor of C57BL/6

teristics that may not preclude some postzygotic selection alleles is present in second polar bodies; and (3)

signifi-against one class ofOmC57BL/6/OmC57BL/6 embryo. Table 4

cant TRD occurs only in embryos that contain

hetero-compares the number of parental/nonparental chro-morphic dyads at MII. We stress that the first two

conclu-mosomes observed in live-born offspring (data from sions represent independent tests of the meiotic drive

Pardo-Manuel de Villenaet al. 2000a) with the num-hypothesis; if the null hypothesis was that TRD is due to

ber of each type found in the maternal pronucleus in preferential death of embryos carryingOmC57BL/6alleles,

the present experiment. Although the two sets of obser-TRD in favor ofOmC57BL/6in second polar bodies is not

vations do not differ significantly (␹2⫽6.3, 3 d.f.,P

a predicted result of this experiment. Overall, all three

0.05), three aspects of the comparison bear mention: of these results demonstrate that TRD in favor of DDK

(1) there are significantly more C57BL/6 centromeres alleles atOmoccurs as a result of nonrandom

segrega-than DDK centromeres in the live-born data set (␹2⫽

tion of chromatids at MII.

4.37, P ⬍ 0.05) but there are not significantly more We note that the level of TRD observed in zygotes

C57BL/6 centromeres in the zygote data set; (2) the (56.1%, Table 2), as well as the level of reciprocal TRD

fraction of nonparental chromosomes in the live-born observed in second polar bodies (56.2%, Table 2), was

data set is 0.44⫾0.013, while it is 0.49⫾ 0.027 in the similar to that observed in live-born offspring (56–

zygote data set; and (3) the level of TRD in parental 62.8%; Pardo-Manuel de Villena et al. 1996, 1997,

chromosomes and nonparental chromosomes does not 2000a,b) and similar to the level of nonrandom

segrega-differ in the zygote data set while the level of TRD in tion of univalent X chromosomes observed in the mouse

the nonparentals is significantly higher in the live-born at MI (62.2%; LeMaire-Adkins and Hunt 2000), as

data set (Pardo-Manuel de Villena et al. 2000a). If well as the level of TRD observed in both mouse (59.6%)

we use the live-born data set to predict which class of and human (58.7%) female Robertsonian translocation

observation is the cause of these three discrepancies, carriers (summarized in Pardo-Manuel de Villena

we would conclude that the nonparental chromosome andSapienza2001a). The relative quantitative

unifor-class that has a DDK centromere and a C57BL/6 allele mity of these results suggests that some common feature

atOmis overrepresented in the zygote data set (i.e.,⬍71 of oocyte meiotic spindle asymmetry is being exploited

(6)

TABLE 4

Comparison of parental and nonparental chromosomes in live-born offspring and zygotes

Parental Nonparental

DDK- C57BL/6-C57BL/6 DDK C57BL/6 DDK Total

Live-borna 363 476 235 429 1503

Figure3.—Schematic of complete dyads scored. The dyads Zygotes 75 96 71 93 335 were reconstructed after individual testing of maternal pronu-Total 438 572 306 522 1838 clei and second polar bodies. In each dyad, solid circles repre-sent C57BL/6 centromeres, open circles reprerepre-sent DDK cen-H0: live-born offspring differ from zygotes;␹2⫽6.3, 3 d.f.,

tromeres, and hatched circles represent instances in which the P⬎0.05. TRD in live-borns⫽ (476⫹429)/1503⫽0.602, maternal pronucleus and second polar body were of different ␹2 ⫽ 62.7, P10⫺6; TRD in zygotes(9693)/335

genotype atD11Mit71. (Such instances are interpreted to rep-0.564,␹2⫽5.52,P0.05. Fraction of parentals, 0.44 in

live-resent recombination betweenD11Mit71and the centromere borns, 0.49 in the present experiment; TRD in parentals, 0.57 or premature separation of sister chromatids. It is not possible in live-borns, 0.56 in the present experiment; TRD in nonpa- to infer centromere genotype in either case.) Nonrecombi-rentals, 0.65 in live-borns, 0.57 in the present experiment. nant (i.e., parental—D11Mit71andD11Spn1/D11Spn4

geno-aData for live-born offspring were taken from

Pardo-types the same) C57BL/6 chromatids are represented as

con-Manuel de Villenaet al.(2000a). tinuous straight lines, nonrecombinant DDK chromatids are

represented as continuous wavy lines, recombinant chroma-tids (i.e., nonparental—D11Mit71andD11Spn1/D11Spn4 ge-notypes differ) that carryOmDDKare represented as straight lines adjacent to centromeres and wavy lines below, while

their relative representation in the live-born data set).

recombinant chromatids that carryOmC57BL/6are represented

If fewer of this nonparental class were observed in the as wavy lines adjacent to centromeres and straight lines below. zygote data set, then the fraction of each type of chromo- The chromatid on the left of each dyad was segregated to the some would more closely approximate that found in the maternal pronucleus, and the chromatid on the right was

segregated to the second polar body.

live-born data set: the fraction of the total chromosomes containing C57BL/6 centromeres would be higher, the

fraction of nonparental chromosomes would be lower, classes represent dyads in which theD11Mit71genotypes and the level of TRD in favor of DDK alleles at Om of the second polar body and maternal pronucleus

dif-in nonparental chromosomes would be higher. That a fer. This may occur as a result of recombination between smaller fraction of this nonparental chromosome class the centromere and D11Mit71 [expected to occur in is found in live-bornsvs.zygotes suggests the possibility 1.1% of dyads (http://www.informatics.jax.org/); in Fig-that some embryonic loss of this genotypic class may ure 3 they represent 3.1% of dyads] or in instances in occur. which the centromere genotypes truly differ because of Interestingly, more detailed analysis of complete dy- premature separation of sister chromatids at MI. Al-ads that contain this particular nonparental chromo- though the frequency at which the latter event occurs some does not rule out this possibility. Figure 3 shows is likely to be low (e.g.,Hodges et al. 2001), it is not all of the dyads that could be reconstructed on the basis precluded by the number of indeterminate dyads ob-of successful genotypes at both the centromere andOm served. Because of the uncertainty in centromere

geno-in both maternal pronuclei and second polar bodies. type in these classes, we cannot determine whether the From the standpoint of being able to choose either the five dyads that segregated DDK alleles atOmto the ovum

OmC57BL/6 or

OmDDK allele at MII, the first four classes

and C57BL/6 alleles to the second polar body belong and the last three classes are heteromorphic. As stated in the first class or the third class. Similarly, we cannot previously in Table 3, there is significant TRD in favor determine whether the five dyads that segregated of DDK alleles in the total of these seven classes of dyad. C57BL/6 alleles to the ovum and DDK alleles to the However, by inspection, there appears to be substantial polar body belong in the second class or the fourth TRD in those embryos that contain heteromorphic dy- class. In the “best” case for the possibility that meiotic ads that have C57BL/6 centromeres (first two classes on drive occurs in both C57BL/6 centromere-containing the left) but little TRD in those that have heteromorphic and DDK centromere-containing dyads, the level of TRD dyads with DDK centromeres (next two classes), al- in the C57BL/6 centromere case would be 83:57 and the though the difference in the level of TRD is not statisti- level of TRD in the DDK centromere dyads would be cally significant (␹2⫽2.48,P0.05). In addition, this 73:63. Under the scenario that only C57BL/6 centromere

interpretation must be tempered by the fact that there dyads exhibited drive the C57BL/6 centromere dyads is some uncertainty in the precise numbers in each of could have TRD as high as 88:52 and the DDK centro-the first four categories on centro-the left, due to centro-the 10 dyads mere dyads could exhibit equal numbers (68:68) of

(7)

One final note on the potential source of any differ- does occur at MII, although the mechanism remains unknown.

ences between the live-born data set and the zygote data

set is the variable action of X-linked loci that modify This work was supported by the National Institutes of Health (NIH the overall level of recombination in F1 females (de R01GM62537 to C.S. and NIH R01HD43092 to K.E.L.), the National Science Foundation (MCB-0133526 to F.P.M.d.V.), and the Andrew

la Casa-Espero´ n et al. 2002). Because this X-linked

Mellon Foundation (to F.P.M.d.V.).

modifier locus appears sensitive to X-inactivation (de la Casa-Espero´ net al.2002), there could be true differ-ences in the level of recombination observed (the

frac-tion of nonparental chromosomes in Table 4) between LITERATURE CITED the two data sets, depending on the X-inactivation

phe-Agulnik, S. I., A. I. AgulnikandA. O. Ruvinsky, 1990 Meiotic

notypes of the females used in each set of experiments. drive in female mice heterozygous for the HSR inserts on

chromo-some 1. Genet. Res.55:97–100.

In any case, the data presented here demonstrate, by

Babinet, C., V. Richoux, J. L. GuenetandJ. P. Renard, 1990 The

direct determination of genotypes in the maternal

pronu-DDK inbred strain as a model for the study of interactions

be-cleus and second polar body, that the TRD observed tween parental genomes and egg cytoplasm in mouse

preimplan-tation development. DevelopmentS:81–87.

among live-born offspring (Pardo-Manuel de Villena

Baldacci, P. A., M. Cohen-Tannoudji, C. Kress, S. Pourninand

et al.1996, 1997, 2000a,b;Kimet al. 2005) occurs

pre-C. Babinet, 1996 A high-resolution map around the locusOm

dominately as a result of nonrandom segregation of on mouse chromosome 11. Mamm. Genome7:114–116.

Broman, K. W., L. B. Rowe, G. A. ChurchillandK. Paigen, 2002

chromatids at a single meiotic division in females. Even

Cross over interference in the mouse. Genetics160:1123–1131.

if there is some level of postzygotic selection against

Chatot, C. L., C. A. Ziomek, B. D. Bavister, J. L. LewisandI.

embryos that inherit one class of nonparental chromo- Torres, 1989 An improved culture medium supports

develop-ment of random-bred 1-cell mouse embryos in vitro. J. Reprod.

some, the data in Table 4 suggest that the contribution

Fertil.86:679–688.

of such selection to the overall TRD is minor.

de la Casa-Espero´ n, E., J. L.Osti., F.Pardo-Manuel de Villena,

These data are the first example of which we are T. L.Briscoe, J. M.Maletteet al., 2002 X chromosome effect

on maternal recombination and meiotic drive in the mouse.

aware in which nonrandom segregation has been

dem-Genetics161:1651–1659.

onstrated directly in a mammal in the absence of a

El-Hashemite, N., D. WellsandJ. D. Delhanty, 1997 Single cell

cytologically visible chromosome polymorphism (Agul- detection of beta-thalassaemia mutations using silver stained

SSCP analysis: an application for preimplantation diagnosis Mol.

nik et al. 1990) or aneuploidy (LeMaire-Adkins and

Hum. Reprod.3:693–698.

Hunt2000). Nonrandom segregation is demonstrated

Hodges, C. A., R. LeMaire-AdkinsandP. A. Hunt, 2001

Coordinat-most strongly for heteromorphic dyads containing a ing the segregation of sister chromatids during the first meiotic

division: evidence for sexual dimorphism J. Cell Sci.114:2417–

C57BL/6 centromere. In such dyads, DDK alleles atOm

2426.

were segregated to the ovum, in preference to the polar

Holding, C., D.Bentley, R.Roberts, M.Bobrowand C.Mathew,

body, by a margin of 83:52 (61.5%). 1993 Development and validation of laboratory procedures for

preimplantation diagnosis of Duchenne muscular dystrophy. J.

Female-based meiotic drive of this magnitude could

Med. Genet.30:903–909.

play a powerful role in changing allele frequencies in

Kim, K., S. Thomas, I. B. Howard, T. A. Bell, H. Dohertyet al.,

natural populations. Comparative evolutionary data in- 2005 Meiotic drive at the Om locus in wild-derived inbred

mouse strains. Biol. J. Linn. Soc.84:487–492.

dicate that it has been an important force in shaping

LeMaire-Adkins, R., andP. A. Hunt, 2000 Nonrandom segregation

the mammalian karyotype (Pardo-Manuel de Villena

of the mouse univalent X chromosome: evidence of

spindle-andSapienza 2001a). However, little is known about mediated meiotic drive. Genetics156:775–783.

Mann, J. R.,1986 DDK egg-foreign sperm incompatibility in mice

the molecular mechanisms involved. Formally, meiotic

is not beween the pronuclei. J. Reprod. Fertil.76:779–781.

drive requires an asymmetric meiotic division (one

Pardo-Manuel de Villena, F., C. Slamka, M. Fonseca, A. K.

Nau-product must be a functional gamete and the other mova, J. Paquette et al., 1996 Transmission-ratio distortion

through F1females at chromosome 11 loci linked toOmin the

not), functional polarity of the meiotic spindle (there

mouse DDK syndrome. Genetics142:1299–1304.

must be an “ovum side” and a “polar body side”), and

Pardo-Manuel de Villena, F., A. K. Naumova, A. E. Verner, W. H.

a functional difference between the chromosomes in JinandC. Sapienza, 1997 Confirmation of maternal

transmis-sion ratio distortion atOmand direct evidence that the maternal

their ability to be attached to the ovum side of the

and paternal “DDK syndrome” genes are linked. Mamm. Genome

spindlevs.the polar body side (Pardo-Manuel de

Vil-8:642–646.

lenaandSapienza2001b). In the system we have inves- Pardo-Manuel de Villena, F., E. de la Casa-Esperon, A. Verner, K.

MorganandC. Sapienza, 1999 The maternal DDK syndrome

tigated, it appears that DDK alleles in the Om region

phenotype is determined by modifier genes that are not linked

enhance the ability of the chromosome to attach to

to Om. Mamm. Genome10:492–497.

the ovum side of the spindle when paired opposite a Pardo-Manuel de Villena, F., E. de la Casa-Esperon, T. L. Briscoe

andC. Sapienza, 2000a A genetic test to determine the origin

C57BL/6 allele atOm. In this regard, we have not

ob-of maternal transmission distortion: meiotic drive atOm.Genetics

served any apparent morphological differences between

154:333–342.

chromosomes in MII oocytes from F1females (G.Wu, Pardo-Manuel de Villena, F., E. de la Casa-Esperon, T. L. Briscoe, J. M. MaletteandC. Sapienza, 2000b Male offspring-specific,

unpublished results) or any of the molecular hallmarks

haplotype-dependent, nonrandom cosegregation of alleles at loci

of a “neocentromere” in the Om region (i.e., ectopic

on two chromosomes. Genetics154:351–356.

CenpE staining; G.Wu, unpublished results). Neverthe- Pardo-Manuel de Villena, F., E.de la Casa-Esperon, J. W.

Wil-liams, J. M.Malette, M.Rosaet al., 2000c Heritability of the

(8)

mapping of the responder locus in mouse. Genetics155:283–289. Morgan, 1992 The polar-lethal Ovum mutant gene maps to the Pardo-Manuel de Villena, F., and C. Sapienza, 2001a Female distal portion of mouse chromosome 11. Genetics132:241–246. meiosis drives karyotypic evolution in mammals. Genetics159: Wakasugi, N., 1973 Studies on fertility of DDK mice: reciprocal 1179–1189. crosses between DDK and C57BL/6J strains and experimental Pardo-Manuel de Villena, F., andC. Sapienza, 2001b Nonrandom transplantation of the ovary. J. Reprod. Fertil.33:283–291.

segregation during meiosis: the unfairness of females. Mamm. Wakasugi, N., 1974 A genetically determined incompatibility system Genome12:331–339. between spermatozoa and eggs leading to embryonic death in Renard, J. P.,andC. Babinet, 1986 Identification of a paternal mice. J. Reprod. Fertil.41:85–96.

developmental effect on the cytoplasm of one-cell stage mouse

Figure

TABLE 1
TABLE 2
TABLE 4

References

Related documents

Field experiments were conducted at Ebonyi State University Research Farm during 2009 and 2010 farming seasons to evaluate the effect of intercropping maize with

On the Saudi Gulf coast the major environmental effects of coastal and marine use.. are concentrated in and around, Jubayl and

/ L, and a different adsorbent mass, is shown in Figure 5. The results obtained show that the removal rate increases quickly at first, until a time of 60 min, and

The prematurely born infant almost in variably develops iron deficiency anemia unless supplemental iron is given. The ade quacy of iron nutrition of the mother,15 perinata!

In summary, we have presented an infant with jaundice complicating plorie stenosis. The jaundice reflected a marked increase in indirect- reacting bilirubin in the serum. However,

19% serve a county. Fourteen per cent of the centers provide service for adjoining states in addition to the states in which they are located; usually these adjoining states have

Several parameters affecting gene electrotransfer efficiency have been identified so far [ 7 , 30 , 31 ]: electric field distribution, which is related to the electrode

Prevalence, attributes, and outcomes of fitness and frailty in community-dwelling older adults: report from the Canadian study of health and aging.. Bandeen-Roche K, Xue QL, Ferrucci