• No results found

Is the Rate of Insertion and Deletion Mutation Male Biased?: Molecular Evolutionary Analysis of Avian and Primate Sex Chromosome Sequences

N/A
N/A
Protected

Academic year: 2020

Share "Is the Rate of Insertion and Deletion Mutation Male Biased?: Molecular Evolutionary Analysis of Avian and Primate Sex Chromosome Sequences"

Copied!
10
0
0

Loading.... (view fulltext now)

Full text

(1)

Is the Rate of Insertion and Deletion Mutation Male Biased?: Molecular

Evolutionary Analysis of Avian and Primate Sex Chromosome Sequences

Hannah Sundstro

¨m, Matthew T. Webster and Hans Ellegren

1

Department of Evolutionary Biology, Evolutionary Biology Centre, Uppsala University, SE-752 36 Uppsala, Sweden Manuscript received July 24, 2002

Accepted for publication January 25, 2003

ABSTRACT

The rate of mutation for nucleotide substitution is generally higher among males than among females, likely owing to the larger number of DNA replications in spermatogenesis than in oogenesis. For insertion and deletion (indel) mutations, data from a few human genetic disease loci indicate that the two sexes may mutate at similar rates, possibly because such mutations arise in connection with meiotic crossing over. To address origin- and sex-specific rates of indel mutation we have conducted the first large-scale molecular evolutionary analysis of indels in noncoding DNA sequences from sex chromosomes. The rates are similar on the X and Y chromosomes of primates but about twice as high on the avian Z chromosome as on the W chromosome. The fact that indels are not uncommon on the nonrecombining Y and W chromosomes excludes meiotic crossing over as the main cause of indel mutation. On the other hand, the similar rates on X and Y indicate that the number of DNA replications (higher for Y than for X) is also not the main factor. Our observations are therefore consistent with a role of both DNA replication andrecombination in the generation of short insertion and deletion mutations. A significant excess of deletion compared to insertion events is observed on the avian W chromosome, consistent with gradual DNA loss on a nonrecombining chromosome.

T

HERE is compelling evidence from humans and 1987). The mammalian Y chromosome is transmitted through the male germline only and the evolutionary other organisms that the mutation rate for

nucleo-rate of neutral sequences on this chromosome should tide substitution is higher among males than among

thus solely reflect the male mutation rate. The female females (Hurst and Ellegren 1998). However, the

mutation rate can be obtained by studying the evolution-precise extent of this excess of male point mutation

ary rate of X-linked sequences and by taking advantage (␣m) in humans has been an issue of debate (Shimmin

of the fact that the X chromosome spends two-thirds of

et al. 1993;McVeanandHurst1997;Bohossianet al.

the time in the female germline. Also, comparison of 2000;Crow2000a;Ebersbergeret al. 2002;Ellegren

the evolutionary rate of autosomal sequences with either 2002;MakovaandLi2002). In addition, it is not

unrea-Y- or X-linked sequences allows␣mto be estimated. Such

sonable to think that different organisms may vary with

molecular evolutionary approaches have been used in respect to the relative excess of male mutation. Overall,

a number of studies on sex-specific mutation rates in however, a male-biased point mutation rate is consistent

humans and other mammals, the most recent estimate with the higher number of germline cell divisions in

of␣m for point mutation in the human lineage being

spermatogenesis than in oogenesis seen in many

organ-3–5 (Ebersbergeret al. 2002; Makova andLi 2002). isms (VogelandMotulsky1996) and the assumption

A similar approach has also been used in studies of that DNA replication is important for germline

muta-organisms with female heterogamety. In birds, the W tion.

chromosome is transmitted through females only and While the idea of male-biased mutation was first

the evolutionary rate of neutral, W-linked sequences reached through indirect observations on X-linked

hu-should thus specifically reflect the rate of female muta-man genetic disorders (by J. B. S. Haldane;Haldane

tion. Avian studies suggest␣mfor point mutation isⵑ2–4

1947) and later supported by molecular analysis of the

(Ellegren andFridolfsson 1997; Kahn andQuinn

parental origin ofde novomutations at disease loci,

mo-1999;Carmichaelet al. 2000). lecular evolutionary approaches have been crucial for

However, all data on the parental origin of spontane-addressing sex-specific mutation rates (Miyata et al.

ous mutation causing human genetic disease are not supportive of a strong male-biased rate (Hurst and

Ellegren1998). For two well-studied X-linked recessive

Sequence data from this article have been deposited with the Gen- disorders in particular, Duchenne muscular dystrophy Bank Data Library under accession nos. AF525971–AF526097.

(Grimmet al. 1994) and hemophilia B (Ketterlinget

1Corresponding author:Department of Evolutionary Biology,

Evolu-al. 1994; Sommer et al. 2001), maternal transmissions

tionary Biology Centre, Uppsala University, Norbyva¨gen 18D, SE-752

36 Uppsala, Sweden. E-mail: hans.ellegren@ebc.uu.se are at excess among new mutations. Importantly, it has

(2)

TABLE 1

been demonstrated that this female bias is associated

with deletion mutations, not point mutations. More- A summary of the expected effects of DNA over, for some dominant autosomal disorders caused replication and recombination on the by short deletion mutations, like neurofibromatosis type rate of mutation in mammalian and

avian sex chromosomes

1 (La´zaroet al. 1996) and Williams syndrome (Pe´rez

-Juradoet al. 1996), mutation rates of males and females

DNA replication Recombination

are about the same. These observations have led to the

idea that deletion (and perhaps insertion) mutations Z in general are not replication dependent or at least do W not correlate to the number of DNA replications in Y ⫹ ⫺

X ⫺ ⫹

the germline (VogelandMotulsky1996;Crow1997, 2000b). One possibility is that insertion and deletion mutations (hereafter referred to as indel mutations or just indels) are somehow related to meiotic

recombina-and CHD1Z genes were sequenced (or available from our

tion (Baumeret al. 1998;Lo´ pez-Correaet al. 2000). If previous work) in a number of avian species. The full exon-so, their rate should mainly reflect the rate of recombi- intron structure of these genes has not been elucidated so we arbitrarily designate the introns A–E. However, their location

nation rather than the time a particular sequence

relative to the full-length chickenCHD1ZcDNA sequence

(Gen-spends in the male and female germlines, respectively.

Bank no. AF004397) can be identified through the primer

se-Observations of sex-specific mutation rates at human

quences in Table 2 or the references provided therein. Templates

disease loci often present conflicting results. For several for DNA sequencing were obtained through PCR amplification genetic disorders caused by point mutations the male- of DNA prepared from blood. DNA sequencing was performed with Big Dye terminator cycle sequencing chemistry and analyzed

to-female mutation rate ratio differs considerably from

on an ABI377 (Applied Biosystems, Foster City, CA) DNA

se-that indicated by molecular evolutionary analysis,

quencing instrument. Sequences were deposited in GenBank

thought to represent the genome average. The pattern

(AF525971–AF526084). The data set was augmented with

se-of parental origin se-of disease mutation caused by indels quence information fromEllegrenandFridolfsson(1997), is also heterogeneous (HurstandEllegren1998) and KahnandQuinn(1999), andMontellet al. (2001). We also included sequence data (GenBank nos. AF165968–AF165971

it is likely that such mutations, which cause observable

and AF165976–AF165879) from the third intron of the

gameto-yet nonlethal phenotypic effects, are not representative

logous ATP synthase␣-subunitATP5A1ZandATP5A1Wgenes

for the overall genomic rate of spontaneous indel

muta-(Carmichaelet al. 2000). CHD1W and ATP5A1Ware both

tion. Alternative approaches are therefore needed. within the nonrecombining part of the W chromosome. In this study we present the first large-scale genetic The complete set of bird species included, from the order

Passeriformes, jackdaw (Corvus monedula), raven (Corvus corax),

analysis of sex-specific rates of indel mutation in

non-siberian jay (Perisoerus infaustus), pied flycatcher (Ficedula

hypo-coding DNA, based on evolutionary analysis of sex

chro-leuca), collared flycatcher (Ficedula albicollis), barn swallow

mosome sequences. As this approach has proved

funda-(Hirundo rustica), willow warbler (Phylloscopus trochilus), wood

mental for the understanding of rates of point mutation warbler (Phylloscopus sibilatrix), blue tit (Parus caeruleus), blue-in relation to sex, we believe it has the potential to throat (Luscinia svecica), house sparrow (Passer domesticus), oleagi-nous-hemispingus (Hemispingus frontalis), and zebrafinch (

Taeni-provide similar insight into the causes and mechanism

pygia guttata); fromGalliformes, chicken (Gallus gallus), turkey

of indel mutations in males and females. We use two

(Meleagris gallopavo), quail (Coturnix coturnix), pheasant (

Phasi-different systems to test the underlying factors affecting

anus colchius), sage grouse (Centrocercus urophasianus), and

the rate of indel mutation: the comparison of X and Y black grouse (Tetrao tetrix); fromAnseriformes, barnacle goose chromosome sequences in primates and the compari- (Branta leucposis), snow goose (Chen caerulescens), tundra swan (Cygnus columbianus), eider (Somateria mollissima), goldeneye

son of Z and W chromosome sequences in birds. If

(Bucephala clangula), redhead (Aythya americana), and

can-meiotic recombination involving crossing over is a main

vasback (Aythya valisineria); fromCharadriiformes, black-headed

cause of indel mutation, we should expect to find

rela-gull (Larus ridibundus), glaucous gull (Larus hyperboreus),

her-tively few indel mutations in the nonrecombining Y and ring gull (Larus argentatus), brown skua (Catharacta antarctica), W chromosomes (Table 1). In contrast, if the number oystercatcher (Haematopus ostralegus), dunlin (Calidris alpina), dotterel (Charadrius morinellus), adelie penguion (Pygoscels

ad-of germline DNA replications is important for the

gener-liae), Leach’s storm petrel (Oceanodroma leucorrhoa), and

north-ation of indels (KunkelandBebenek2000), similar to

ern fulmar (Fulmarus glacialis); from Falconiformes, sparrow

the case for point mutations, we should expect to find

hawk (Accipiter nisus), merlin (Falco columbarius), goshawk (

Ac-an excess of indels on the male-specific mammaliAc-an Y cipiter gentilis), Galapagos hawk (Buteo galapagoensis), golden chromosome but a deficit on the female-specific avian eagle (Aquila chrysaetos), black vulture (Aegypsis monachus), kes-trel (Falco tinninculus), and merlin (Falco columbarius); from

W chromosome.

Piciformes, usambiro barbet (Trachyphonus usambiro), acorn woodpecker (Melanerpes formicivorus), and striped woodpecker (Picoides borealis); fromStrigiformes, Tengmalm’s owl (Aegolius MATERIALS AND METHODS

funereus) and long-eared owl (Asio otus); fromPsittaciformes, blue-fronted amazon (Amazon aestiva), kookaburra (Dacelo

Avian sequence data:Five different introns from the

(3)

maroon-bel-TABLE 2

Summary of loci and species used for each alignment of bird sequences and information on the incidence of indel mutation

Z copy W copy

Locus Species Length (bp) No. of indels Length (bp) No. of indels

CHD1Z/CHD1W, intron Aa Corvus corax 502 10 300 2

Ficedula albicollis Ficedula hypoleuca Hirundo rustica Perisoreus infaustus Phylloscopus trochilus

CHD1Z/CHD1W, intron Aa Centrocercus urophasianus 457 9 291 5

Gallus gallus Meleagris gallopavo Phasianus colchius Tetrao tetrix

CHD1Z/CHD1W, intron Aa Branta leucopsis 412 2 307 1

Bucephala clangula Somateria mollissima

CHD1Z/CHD1W, intron Aa Calidris alpina 505 25 251 4

Catharacta antarctica Larus argentatus Larus hyperboreus Larus ridibundus

CHD1Z/CHD1W, intron Aa Ara chloropterus 516 20 241 6

Dacelo gigas

Aratinga acuticaudata Pyrrhura frontalis

CHD1Z/CHD1W, intron Aa Aquila chrysaetos 520 8 296 7

Coragyps atratus Falco columbarius Falco tinnunculus

CHD1Z/CHD1W, intron Bb Ficedula albicollis 242 7 282 1

Ficedula hypoleuca Hirundo rustica Luscinia svecica Parus caeruleus Phylloscpous sibilatrix Phylloscopus trochilus

CHD1Z/CHD1W, intron Cc Charadrius morinellus 882 23 800 12

Fulmarus glacialis Haematopus ostralegus Larus argentatus Oceanodroma leucorhoa Pygoscels adlidae

CHD1Z/CHD1W, intron Cc Accipiter gentilis 971 17 1022 12

Accipiter nisus Falco columbarius Falco tinnunculus

CHD1Z/CHD1W, intron Cc Melanerpes formivicivorus 918 6 1043 3

Picoides borealis

(4)

TABLE 2

(Continued)

Z copy W copy

Locus Species Length (bp) No. of indels Length (bp) No. of indels

CHD1Z/CHD1W, intron Cc Aegolius funerus 967 10 950 7

Asio otus

CHD1Z/CHD1W, intron Cc Branta leucposis 938 7 964 1

Chen caerulescens

CHD1Z/CHD1W, intron Dd Aythya americana 170 10 192 3

Aythya valisineria Centrocercus urophasianus Chen caerulescens Cygnus columbianus Gallus gallus

CHD1Z/CHD1W, intron Dd Ficedula albicollis 183 7 216 8

Hemispingus frontalis Trachyphonus usambrio Taenipygia guttata

CHD1Z/CHD1W, intron Ee Corvus monedula 391 10 440 3

Ficadula albicollis Hirundo rustica Phylloscpous trochilus Passer domesticus

CHD1Z/CHD1W, intron Ee Coturnix coturnix 409 5 427 6

Gallus gallus Meleagris gallopavo Phasianus colchius

CHD1Z/CHD1W, intron Ee Catharacta antarctica 305 7 440 2

Haematopus ostralegus Larus ridibundus

CHD1Z CHD1/W, intron Ee Accipiter nisus 441 21 434 6

Buteo galapagoensis Falco columbarius

CHD1Z/CHD1W, intron Ee Aratinga acuticaudata 420 4 689 3

Bolborhynchus lineola Pyrrhura frontalis

ATP5A1Z/ATP5A1W, intron 3f Gallus gallus 916 26 868 21

Larus argentatus Larus ridibundus Meleagris gallopavo

aPCR as described byFridolfssonandEllegren(1999). bPCR as described byEllegrenandFridolfsson(1997).

cPCR with 0.2mof primers GAAGAGGGCTGAAACTCGG and GGAAAATGAGTCAGGT, 0.1mdNTP, 2.5 mmMgCl

2, and

0.005 units/␮l AmpliTaq. PCR program: 10 times [94⬚ 30 sec, 65⬚(touchdown 1⬚/cycle) 30 sec, 72⬚45 sec], 25 times (94⬚30 sec, 55⬚30 sec, 72⬚45 sec), and 72⬚5 min. The middle part of the intron could not be analyzed due to difficulties in sequencing through repeats.

dSequences are fromKahnandQuinn(1999), except those forFicedula albicollis.

ePCR with 0.2mof primers AGAAAATGAGTCAGGC and TCATCTTCATCCATATTGG, 0.1mdNTP, 2.5 mmMgCl

2, and

0.005 units/␮l AmpliTaq. PCR program: 5 times [94⬚30 sec, 62⬚(touchdown 2⬚/cycle) 30 sec, 72⬚45 sec], 27 times (94⬚30 sec, 50⬚30 sec, 72⬚45 sec), and 72⬚5 min.

(5)

TABLE 3

Loci amplified and sequenced in marmoset, and reference to the homologous human sequences (GenBank accession no.)

[MgCl2] Annealing Human

Locus Primer sequences (5⬘-3⬘) (mm) tempa homolog

DBXintron 2 CCTAGACCTGAACTCTTCAG 2 70⬚ NT_011793

TTCTCGGTTCCTTAAATGAG

DBYintron 2 GAAAAACAGAGTGGAGGAGC 2.5 65⬚ AC004474 TTCTCTGTTCCTTAAGTGAG

DBXintron 4 ACTCCCACCAAGTGAACG 2.5 60⬚ NT_011793

TGTTGCCTCCAGAAAAGAGT

DBYintron 4 TGATGGTATTGGYRRTCGTGA 2.5 65⬚ AC004474 CGGTTGCCTCTACTGGTATA

SMCXintron 18 ACCCTGACTGAGCTCCGGGC 2.5 65⬚ NT_011799 TAGGCCTCCACCTGTTCCAG

SMCYintron 18 CTTGACTGAACTCCGGGTCC 2.5 60⬚ AF273841 TAGGCCTCCACCTGTTCCAG

SMCXintron 19 CTGGGAGGAGAAAGCCCACC 2.5 65⬚ NT_011799 GAACAGGGATGTTTTCCGCT

SMCYintron 19 GGGAAGAAAAGGCTCATTTC 2.5 65⬚ AF273841 GAACAGGGATGTTTTCTGTC

SMCXintron 20 AGGCTCTTGCTAAGGCCCGG 2.5 65⬚ NT_011799 GGCCCTCCAAGTCATCCAGG

SMCYintron 20 AAGCTCTGACTAAGGCACAA 2.5 60⬚ AF273841 GGCCCTCCAAGTCATCTAGA

ZFXintron 5 CACTTGCAGTGCCATTCCGG 2.5 65⬚ NT_011820 CAATGAAATCAAAACCTTCA

ZFYintron 5b CACTTGCAGTGCCATTCCGG 2.5 65NT_011896 GGATGAAATGAAAACCTTCG

aThe annealing temperature at the start temperature of an initial 10-cycle touchdown profile (1/cycle). bThe middle part of the intron could not be analyzed due to difficulties in sequencing through repeats.

lied conure (Pyrrhura frontalis), and barred parakeet (Bolbur- mura two-parameter correction (Kumar et al. 2001). From hynchus lineola). these trees indels were subsequently assigned to branches.

Primate sequence data:DNA was prepared from tissue sam- Furthermore, separate alignments of both X- and Y-linked

ples from male marmosetCallithrix jacchususing a standard gametologous sequences from humans and a single or several proteinase K and phenol-chloroform extraction protocol. Six primate species were constructed, using the species shown in different introns from three gametologous genes (DBX/DBY, Table 4. In all cases, the same species were used in alignments SMCX/SMCY, and ZFX/ZFY) shared between the X and Y of gametologs on both sex chromosomes.

chromosomes were amplified with the primers described in A gap in one or several of the sequences within an alignment Table 3 and sequenced as above. Sequences were deposited was considered the result of one or more indel mutations. in GenBank (AF526085–AF526097). In addition, we used pub- However, length differences in tandemly repetitive DNA were lished sequence data from the third intron of the amelogenin excluded, using the criterion of not considering gaps in re-AMELX/AMELY genes in human, orangutan (Pongo pyg- gions with three or more repeat units present in any of the meaus), and Bolivian squirrel monkey (Saimiri boliviensis; species. We also excluded gaps from regions with sequence X14439, X14440, U88979, and U88981–U88983). For the last homology to known interspersed repetitive elements, identi-intron of the ZFX/ZFY genes we obtained sequences from fied through BLAST searches against avian and primate se-human, orangutan, baboon (Papio cynocephalus), and Bolivian quences. In a few cases the alignment algorithm suggested squirrel monkey (X58930–X58932, X58935, X58936, X72698, the presence of two gaps separated by a single nucleotide. To U24118, and AF02232). DBY, SMCY, ZFY, and AMELY are be conservative in the estimation of rates of indel mutation located within the nonrecombining part of the Y chromosome. we manually realigned such regions to minimize the number

Analysis of sequence data:Alignment of intron sequences of indels. Measures of divergence (nucleotide substitution)

of bird and primate species was made with the ClustalW algo- were estimated in MEGA 2.1 using Kimura two-parameter rithm using default settings. Separate multiple alignments of correction (Kumaret al.2001). We obtained a mean estimate both Z- and W-linked gametologous sequences from a number for each alignment by averaging all pairwise divergences be-of different groups be-of related avian species (generally species tween sequences included in the alignment.

within the same order) were constructed as specified in Table For all data sets, the lengths and number of indels found 2. For 18 of 20 alignments more than two bird species were in alignments were resampled using a bootstrap procedure used and in these cases phylogenetic trees were constructed to calculate confidence intervals for estimates of␣m (for

(6)

TABLE 4

Summary of loci and species used for alignment of primate sequences and information on the incidence of indel mutation

Y copy X copy

Length No. of Length No. of

Locus Species (bp) indels (bp) indels

AMELX/AMELYintron 3 Homo sapiens 1420 15 1415 6

Pongo pygmaeus Saimiri boliviensis

DBX/DBYintron 2 H. sapiens 644 7 943 19

Calidris jacchus

DBX/DBYintron 4 H. sapiens 84 2 106 0

C. jacchus

SMCX/SMCYintron 18 H. sapiens 592 3 808 8

C. jacchus

SMCX/SMCYintron 19 H. sapiens 455 7 654 6

C. jacchus

SMCX/SMCYintron 20 H. sapiens 463 8 512 4

C. jacchus

ZFX/ZFYintron 5 H. sapiens 707 9 530 3

C. jacchus

ZFX/ZFYfinal intron H. sapiens 867 9 1227 17

Pongo pygmaeus Papio cynocephalus S. boliviensis

and number of indels derived from all of the alignments of one of baboon, orangutan, squirrel monkey, or

marmo-each individual intron on both sex chromosomes were first set), 6195 bp of X chromosome and 5232 bp of Y chro-randomly resampled with replacement. The resulting totals

mosome sequence were derived in eight alignments,

for each intron were then randomly resampled with

replace-always using the same species for the alignment of a

ment and a value of ␣m was calculated from each resultant

particular gametologous intron. In birds, 11,065 bp of

data set. Confidence intervals (95%) were estimated from the

distribution resulting from 10,000 replicates of the bootstrap- Z chromosome and 10,435 bp of W chromosome

se-ping process. To calculate confidence intervals from the pri- quence were obtained in the same way, in 20 different mate alignments of gametologs, the values for the length and

alignments.

number of indels found in each aligned intron on both sex

Numbers of indels on the respective chromosomes

chromosomes were resampled with replacement in 10,000

are summarized in Table 5. The incidences of indels

replicates. Ninety-five percent confidence intervals for␣m(for

indels) were generated from the resultant distribution. on primate X and Y were similar, occurring at a rate of

We refer to the Y and W chromosomes as nonrecombining 1% per base pair in our set of alignments (X0.0102, although both have at least one small pseudoautosomal region

Y⫽0.0117;P ⫽0.47, Fisher’s exact test). In contrast,

(PAR) in which recombination takes place during meiosis.

indels were about twice as common in alignments

de-However, all sequences analyzed in this study are from outside

rived from the avian Z chromosome as in those derived

the PAR and thus from regions with no meiotic recombination.

from the W chromosome (Z⫽0.0211,W⫽0.0108;P

0.001). There was a higher incidence of indels on Z than

RESULTS

on W in 18 out of 20 avian alignments of gametologous introns (P ⬍ 0.001), while there was no obvious bias

Rates of indel mutation on sex chromosomes: We

for primate introns (5 with more indels on Y, 3 with used intron sequences of gametologous genes shared

more on X; P ⫽ 0.438). The primate data set seems between the Z and W chromosomes of birds (Table 2)

homogeneous with respect to which species are used for and the X and Y chromosomes of primates (Table 4),

comparison; for instance, using only the most divergent to infer the incidence and character of indel mutation

(7)

TABLE 5

Total number of indel mutations identified in primate and bird sex chromosome sequences

Length of No. of indels sequence (bp)

Z 234 11065

W 113 10435

Y 61 5232

X 63 6195

similar (data not shown). Converting the observed fre-quencies of indel mutation in different chromosomes to male-to-female mutation rate ratios, estimates of␣m

for indels of 2.43 (95% confidence interval 1.51–3.85) for birds and 1.24 (0.67–4.26) for primates are obtained. Sex-specific rates for point mutation were also esti-mated from the aligned sequences of gametologous in-trons. In primates, observed mean pairwise divergence of 0.079 for X chromosome and 0.174 for Y chromo-some sequences translates into an estimate of ␣m for

point mutation of 5.61. The corresponding estimate in birds was ␣m ⫽ 2.31, derived from mean pairwise

divergence in multiple species alignments of 0.123 on Z and 0.0663 on W. These estimates agree reasonably well with those obtained in earlier studies (Ellegrenand

Fridolfsson1997;Ebersbergeret al. 2002;Makovaand

Li2002). We thus conclude that in primates there seems to be no clear difference in the rate of indel mutation on X and Y although the rate for point mutation is male biased. In birds, however, the rates of indel as well as point mutation are higher on Z than on W.

For the primate data set indel mutations comprised 6.3% (the Y chromosome) and 11.4% (X) of the total number of mutations, consistent with previous observa-tions suggesting that less than one-tenth of all mutaobserva-tions in the human genome are indels (Nachmanand

Cro-Figure1.—Relative size distributions of indel mutations on

well2000). Indels were slightly more common in avian

(A) avian Z, (B) avian W, (C) primate Y, and (D) primate X

chromosomes, making up 14.4% (Z) and 13.9% (W) chromosomes. of all mutations. Birds therefore seem intermediate to

human and Drosophila, where indels constituteⵑ20% of all mutations (PritchardandSchaeffer1997;Petrov

andHartl1998, 1999). bp indels (Z/W⫽1.49,␣m⫽ 1.82;P⫽0.025, Fisher’s

exact test). There is also a difference in the relative

Character of indel mutation:Figure 1 depicts the size

distribution of DNA sequences being inserted or deleted incidence of indel mutation on X and Y when analyzing the data in this way. For 1-bp indels,Y/Xis 1.54 while on sex chromosomes of primates and birds. A strong

dominance of events involves very short sequences, in it is 0.92 for indels ⬎1 bp (P ⫽ 0.204). One-base-pair indels thus seem particularly common on avian Z and particular 1-bp indels. There is no significant difference

(Kolmogorov-Smirnov test) in the size distribution of mammalian Y.

Generally more than two species were available in indels between mammals and birds. Moreover, the

over-all size distribution of indels does not differ between X avian alignments and from established phylogenies the ancestral state of indel sequences could be obtained by and Y or between Z and W. However, when 1-bp and

⬎1-bp indels are treated separately, there is a more parsimony principles. On the whole, deletions outnum-bered insertion events (deletion/insertion ratio⫽2.57; pronounced excess of mutations on Z compared to W

(8)

chromo-somes differed considerably in this respect with only a indels on Y. Our data suggest that meiotic recombina-tion and the relatively low number of DNA replicarecombina-tions moderate excess on Z (1.85,P ⫽0.0146) and a much

more distinct bias on W (7.25, P ⬎ 0.0001), the two of X introduce indel mutations at about the same rate as the larger number of replications of Y. Moreover, we ratios being significantly different (P⫽0.0189, Fisher’s

exact test). As most of the primate data were obtained hypothesize that in systems with female heterogamety meiotic recombination and replication should both con-from pairwise alignments (i.e., without an outgroup) we

were unable to perform a similar analysis for the X and tribute to a higher incidence of indels on Z than on W, as found in birds.

Y chromosomes.

It should be noted that our data do not exclude the possibility that there are other sources of indel mutation

DISCUSSION

apart from replication and recombination and that al-ternative mechanisms could affect the two sexes (or The main observations from this study can be

summa-rized as follows: (i) Indel mutations are frequent on the the two sex chromosomes) equally. For example, indels might be introduced from DNA damage. The contribu-Y chromosome of primates and the W chromosome of

birds; (ii) the rate of indel mutation is similar on the tion of another mechanism(s) could potentially be indi-cated from the fact that in birds the excess of indels X and Y chromosomes of primates, indicating no bias

with respect to sex; (iii) in birds, the rate of indel muta- on Z compared to W is similar to the excess of point mutations on Z vs. W. This may be unexpected ac-tion is about twice as high on the Z as on the W

chromo-some, indicating a moderate male bias; (iv) 1-bp indels cording to the hypothesis that both replication and re-combination cause indels while point mutations are of-seem particularly common on primate Y and avian Z;

and (v) the W chromosome has relatively more deletions ten considered replication dependent. However, recent analyses of large-scale genome sequence data suggest than Z. As a consequence of ii and iii, the sex-specific

rates of indel and point mutation may be different in that recombination might introduce point mutations too (Lercher andHurst2002). It therefore remains primates, while they appear similar in birds. Below we

discuss these observations with respect to the possible to be demonstrated that other mechanisms do play a role in the generation of indel mutation.

mechanistic basis for indel mutation.

Analyses of flanking markers in cases ofde novodele- Replication errors are a likely mechanistic explana-tion for the effect of number of cell divisions on rate tion mutations at human disease loci have provided

evidence for processes involving meiotic recombination of indel mutation, although other factors could also be invoked (see below). DNA replication is known to in the generation of indel mutations (La´zaroet al. 1996;

Baumeret al. 1998;Lo´ pez-Correaet al. 2000). However, introduce short insertion and deletion mutations through various forms of strand misalignment (Kunkel

our data indicate that indels in noncoding DNA also

arise frequently in regions of chromosomes that do not andSoni1988;Osheroffet al. 2000). Template-primer slippage during replication of iterated sequences, like recombine at meiosis. These observations, consistent

for both mammals and birds, demonstrate that meiotic microsatellites, is one obvious example but misalign-ment can also occur in unique sequences (Kunkeland crossing over cannot be the main, and certainly not the

sole, cause of short insertions and deletions in noncod- Bebenek2000; also note that repetitive sequences were excluded from our analyses). For a unique sequence, ing DNA.

The contrasting ratios between sex chromosomes there is experimental evidence that length mutations involving single nucleotides dominate (Kunkel 1990). seen for rates of indel mutation in primates and birds

might be informative for elucidating the origin of indel We can therefore make the prediction that if meiotic recombinationandreplication are important for indel mutations. As indicated above, if meiotic recombination

is the most important factor for rate of indel mutation mutation in noncoding DNA, length mutations involv-ing only 1 bp should be particularly common when we should expect more indels on X than on Y and more

on Z than on W. In contrast, if the number of cell replication is at high rates. Our data are consistent with this prediction: 1-bp indels were more common on Y divisions has a large effect we should expect more indels

on Y than on X and more on Z than on W (Table than on X and on Z than on W. This adds further support to an overall role of DNA replication in intro-1). Our data are not consistent with either of these

predictions. As similar rates of indels were observed on ducing indel mutation in noncoding DNA.

It is important to note that a correlation between X and Y a possible scenario is therefore that

recombina-tion and number of cell divisions both play a role for number of DNA replications and rate of indel mutation does not necessarily imply that mutations induced prior indel mutation. Specifically, we hypothesize that in

sys-tems with male heterogamety and where the number to meiosis are by replication errors. Recombination-like processes are involved also during mitosis, in particular of cell divisions in spermatogenesis significantly exceeds

that in oogenesis, meiotic recombination and replica- for the repair of incorrectly introduced nucleotides or of lesions in DNA. Although the propensity for 1-bp tion may be important for the generation of indels on

(9)

errors, we cannot conclusively distinguish between repli- organisms with female heterogamety but may arise with more similar rates in males and females in organisms cation errors and recombination-like processes for the

with male heterogamety. generation of indels prior to meiosis.

Studies of a number of organisms, including human, We thank Sofia Berlin, Anna-Karin Fridolfsson, and Anna Ha¨rlid mouse, and Drosophila, have indicated that spontane- for sequence data. Financial support was obtained from the Swedish Research Council. H.E. is a Royal Swedish Academy of Sciences

Re-ous deletions generally outnumber insertions (Graur

search Fellow supported by a grant from the Knut and Alice

Wallen-et al. 1989;SaitouandUeda1994;PetrovandHartl

berg Foundation.

1998; Comeron and Kreitman 2000; Vinogradov

2002). As the relative excess of deletions seems to vary between species this may be an important parameter in

LITERATURE CITED

the long-term evolution of genome size (Petrovet al.

2000;Petrov 2001). The avian data indicate that the Baumer, A., F. Dutly, D. Balmer, M. Riegel, T. Tukelet al., 1998 High level of unequal meiotic crossovers at the origin of the

insertion:deletion ratio may also vary within genomes,

22q11.2 and 7q11.23 deletions. Hum. Mol. Genet.7:887–894.

in this case with a higher proportion of deletions on W Bohossian, H. B., H. SkaletskyandD. C. Page, 2000 Unexpectedly than on Z. It is conceivable that this relates to the differ- similar rates of nucleotide substitution found in male and female

hominids. Nature406:622–625.

ent mechanisms behind indel mutation on the two

chro-Carmichael, A. N., A. K. Fridolfsson, J. HalversonandH.

Elle-mosomes as suggested above. We find this observation gren, 2000 Male-biased mutation rates revealed from Z and W consistent with the fact that W is a decaying chromo- chromosome-linked ATP synthase alpha-subunit (ATP5A1)

se-quences in birds. J. Mol. Evol.50:443–447.

some where gradual DNA loss has characterized the

Comeron, J. M., andM. Kreitman, 2000 The correlation between

evolution of W following cessation of recombination intron length and recombination in Drosophila: dynamic

equilib-rium between mutational and selective forces. Genetics 156:

with Z.

1175–1190.

Crow, J. F., 1997 The high spontaneous mutation rate: Is it a health risk? Proc. Natl. Acad. Sci. USA94:8380–8386.

Crow, J. F., 2000a A new study challenges the current belief of

CONCLUSIONS a high human male:female mutation ratio. Trends Genet. 16:

525–526.

We now return to the question of whether the two

Crow, J. F., 2000b The origins, patterns and implications of human

sexes have different rates of indel mutation. The equal spontaneous mutation. Nat. Rev. Genet.1:40–47.

Ebersberger, I., D. Metzler, C. SchwarzandS. Paabo, 2002

Ge-rates observed for X and Y would suggest that there is no

nomewide comparison of DNA sequences between humans and

male bias in the human lineage. However, extrapolating chimpanzees. Am. J. Hum. Genet.70:1490–1497.

mutation rate data from sex chromosomes to overall Ellegren, H., 2002 Human mutation—blame (mostly) men. Nat. Genet.31:9–10.

sex-specific rates requires a common mutation

mecha-Ellegren, H., andA. K. Fridolfsson, 1997 Male-driven evolution

nism that correlates with the time spent in the male and of DNA sequences in birds. Nat. Genet.17:182–184.

female germlines. The conclusion of recombinationand Fridolfsson, A.-K., andH. Ellegren, 1999 A simple and universal method for sexing non-ratite birds. J. Avian Biol.30:116–121.

replication both playing a role for indel mutation is at

Graur, D., Y.Shualiand W. H.Li, 1989 Deletions in processed

odds with this requirement. As we quantitatively cannot pseudogenes accumulate faster in rodents than in humans. J. assess the relative importance of recombination and Mol. Evol.28:279–285.

Grimm, T., G. Meng, S. Liechti-Gallati, T. Bettecken, C. R.

replication it is difficult to obtain a detailed estimate of

Mulleret al., 1994 On the origin of deletions and point

muta-the male-to-female indel mutation rate ratio. Moreover, tions in Duchenne muscular dystrophy: most deletions arise in

oogenesis and most point mutations result from events in

sperma-the situation is complicated by sperma-the fact that sperma-the

recombi-togenesis. J. Med. Genet.31:183–186.

nation rate is higher in females than in males and that

Haldane, J. B. S., 1947 The rate of mutation of the gene for

hemo-the X chromosome does not recombine in males. How- philia and its segregation in males and females. Ann. Eugen.13:

262–271.

ever, if there were a significant sex difference in the

Hurst, L. D., andH. Ellegren, 1998 Sex differences in the

muta-indel mutation rate,e.g., of similar extent as for the rate tion rate. Trends Genet.

14:446–452.

of point mutation, it seems reasonable that it should be Kahn, N. W., andT. W. Quinn, 1999 Male-driven evolution among Eoaves? A test of the replicative division hypothesis in a

heteroga-manifested by contrasting rates of indel mutation on

metic female (ZW) system. J. Mol. Evol.49:750–759.

the X and Y chromosomes. We therefore conclude that Ketterling, R. P., E. L. Vielhaber, T. J. Lind, E. C. Thorlandand our data suggest that there is no strong male bias for S. S. Sommer, 1994 The rates and patterns of deletions in the

human factor IX gene. Am. J. Hum. Genet.54:201–213.

indels in humans.

Kumar, S., K. Tamura, I. B. JakobsenandM. Nei, 2001 MEGA2:

The situation is different in birds. Representing the molecular evolutionary genetics analysis software. Bioinformatics homogametic sex, males recombine at higher rates than 17:1244–1245.

Kunkel, T. A., 1990 Misalignment-mediated DNA synthesis errors.

females do. From the combined effect of high

recombina-Biochemistry29:8003–8011.

tion and large number of DNA replications, we should Kunkel, T. A., andK. Bebenek, 2000 DNA replication fidelity. Annu. expect more indels to arise in males than in females. Rev. Biochem.69:497–529.

Kunkel, T. A., andA. Soni, 1988 Mutagenesis by transient

misalign-The higher incidence of indels on Z than on W is

consis-ment. J. Biol. Chem.263:14784–14789.

tent with this expectation. We therefore end with the La´zaro, C., A. Gaona, P. Ainsworth, R. Tenconi, D. Vidaudet al.,

1996 Sex differences in mutational rate and mutational

(10)

Am. J. Hum. Genet.59:781–792. Genet.98:696–699.

Petrov, D. A., 2001 Evolution of genome size: new approaches to

Lercher, M. L., andL. D. Hurst, 2002 Human SNP variability and

an old problem. Trends Genet.17:23–28. mutation rates are higher in regions of high recombination.

Petrov, D. A., andD. L. Hartl, 1998 High rate of DNA loss in the Trends Genet.18:337–340.

D. melanogasterandD. virilisspecies groups. Mol. Biol. Evol.15:

Lo´ pez-Correa, C., H. Brems, C. La´zaro, P. MarynenandE. Legius,

293–302. 2000 Unequal crossover: a frequent cause ofNF1

microdele-Petrov, D. A., andD. L. Hartl, 1999 Patterns of nucleotide substitu-tions. Am. J. Hum. Genet.66:1969–1974.

tion in Drosophila and mammalian genomes. Proc. Natl. Acad.

Makova, K. D., andW. H. Li, 2002 Strong male-driven evolution

Sci. USA96:1475–1479. of DNA sequences in humans and apes. Nature416:624–626.

Petrov, D. A., T. A. Sangster, J. S. Johnston, D. L. Hartland

McVean, G. T., andL. D. Hurst, 1997 Evidence for a selectively

K. L. Shaw, 2000 Evidence for DNA loss as a determinant of favourable reduction in the mutation rate of the X chromosome.

genome size. Science287:1060–1062. Nature386:388–392.

Pritchard, J. K., andS. W. Schaeffer, 1997 Polymorphism and

Miyata, T., H. Hayashida, K. Kuma, K. MitsuyasuandT. Yasunaga,

divergence at aDrosophilapseudogene locus. Genetics147:199– 1987 Male-driven molecular evolution: a model and nucleotide

208. sequence analysis. Cold Spring Harbor Symp. Quant. Biol.52:

Saitou, N., andS. Ueda, 1994 Evolutionary rates of insertion and 863–867.

deletion in noncoding nucleotide sequences of primates. Mol.

Montell, H., A. K. Fridolfsson and H. Ellegren, 2001

Con-Biol. Evol.11:504–512. trasting levels of nucleotide diversity on the avian Z and W sex

Shimmin, L. C., B. H. ChangandW. H. Li, 1993 Male-driven evolu-chromosomes. Mol. Biol. Evol.18:2010–2016.

tion of DNA sequences. Nature362:745–747.

Nachman, M. W., andS. L. Crowell, 2000 Estimate of the mutation Sommer, S. S., W. A. ScaringeandK. A. Hill, 2001 Human germ-rate per nucleotide in humans. Genetics156:297–304. line mutation in the factor IX gene. Mutat. Res.487:1–17.

Osheroff, W. P., W. A. Beard, S. Yin, S. H. WilsonandT. A. Kunkel, Vinogradov, A. E., 2002 Growth and decline of introns. Trends 2000 Minor groove interactions at the DNA polymerase beta Genet.18:232–236.

active site modulate single-base deletion error rates. J. Biol. Chem. Vogel, F., andA. G. Motulsky, 1996 Human Genetics—Problems and

275:28033–28038. Approaches. Springer-Verlag, Berlin/Heidelberg/New York.

Pe´rez-Jurado, L. A., R. Peoples, P. Kaplan, B. C. HamelandU.

Figure

TABLE 2
TABLE 2
TABLE 3
TABLE 4
+2

References

Related documents

It was decided that with the presence of such significant red flag signs that she should undergo advanced imaging, in this case an MRI, that revealed an underlying malignancy, which

The annotation, molecular markers, and transcription factor of Platanus acerifolia transcriptome. GenBank, https://identifiers.org/ncbi/insdc:GGXZ00000000.2

Twenty-five percent of our respondents listed unilateral hearing loss as an indication for BAHA im- plantation, and only 17% routinely offered this treatment to children with

IL-23 measured by qPCR from RNA extracted from 24 h PPD-J stimulated PBMC isolated from HAV vaccinated (triangles) or Sham vaccinated (squares) calves, taken immediately prior to

newborn infants.’ In this study of 1,096 neonates, Pratt reported the incidence of mongolian spots, strawberry marks, and pigmented nevi, but did not differentiate the various

The wind turbine was created to leverage this free energy resource by converting the kinetic energy in the wind into mechanical power that runs a generator to

In addition to using artificial intelligence in the supply chain, its presence in financial technology can be noted, including advanced machine learning software