Rearrangements of the tal-1 locus as clonal
markers for T cell acute lymphoblastic
leukemia.
O G Jonsson, … , G R Buchanan, R G Smith
J Clin Invest.
1991;
87(6)
:2029-2035.
https://doi.org/10.1172/JCI115232
.
Normal and aberrant immune receptor gene assembly each produce site-specific DNA
rearrangements in leukemic lymphoblasts. In either case, these rearrangements provide
useful clonal markers for the leukemias in question. In the t(1;14)(p34;q11) translocation
associated with T cell acute lymphoblastic leukemia (T-ALL), the breakpoints on
chromosome 1 interrupt the tal-1 gene. A site-specific deletion interrupts the same gene in
an additional 26% of T-ALL. Thus, nearly one-third of these leukemias contain clustered
rearrangements of the tal-1 locus. To test whether these rearrangements can serve as
markers for residual disease, we monitored four patients with T-ALL; three of the leukemias
contained a deleted (tald) and one a translocated (talt) tal-1 allele. These alleles were
recognized by a sensitive amplification/hybridization assay. tald alleles were found in the
blood of one patient during the 4th mo of treatment but not thereafter. Using a quantitative
assay to measure the fraction of tald alleles in DNA extracts, we estimated that this month 4
sample contained 150 tald copies per 10(6) genome copies. The patient with t(1;14)
(p34;q11) (talt) leukemia developed a positive assay during the 20th mo of treatment. By
standard criteria, all four patients remain in complete remission 11-20 mo into treatment. We
conclude that tal-1 rearrangements provide useful clonal markers for approximately 30% of
T-ALLs.
Research Article
Rearrangements of the
tal-1 Locus
as
Clonal
Markers
for T Cell Acute Lymphoblastic Leukemia
OlafurG.Jonsson,*Richard L.
Kitchens,*
Richard J.Baer,'
GeorgeR.Buchanan,*andR. GrahamSmith*
Departments of*Pediatrics, tInternalMedicineandMicrobiology, University ofTexas SouthwesternMedical Center, Dallas, Texas 75235
Abstract
Normal and aberrantimmunereceptor geneassembly each producesite-specificDNA rearrangements in leukemiclympho-blasts. In either case, these rearrangements provide useful clonal markers for the leukemias in question. In the
t(l;14Xp34;q1l)translocationassociated with T cellacute lym-phoblastic leukemia(T-ALL),thebreakpointsonchromosome 1interruptthe tal-i gene. Asite-specificdeletioninterruptsthe
samegene inanadditional 26% of T-ALL.Thus, nearly
one-third oftheseleukemias contain clustered rearrangements of thetal-)locus.Totestwhetherthese rearrangementscan serve as markers for residual disease, we monitored four patients
withT-ALL; threeoftheleukemias containedadeleted(tald)
and one atranslocated (tal) tal-i allele. These alleles were
recognized by a sensitiveamplification/hybridization assay. tald alleleswerefoundin the bloodofonepatient duringthe 4th mooftreatmentbutnotthereafter.Usingaquantitativeassay
to measure the fraction oftald alleles in DNA extracts, we
estimatedthat this month 4samplecontained 150
tall
copiesper106genome
copies.
Thepatientwitht(1;14Xp34;q11)
(tat)
leukemiadeveloped apositiveassayduringthe20thmo of
treatment.By standardcriteria,allfourpatients remainin
com-plete remission 11-20 mo into treatment. We conclude that
tal-irearrangementsprovide usefulclonal markersfor - 30%
ofT-ALLs.(J. Clin.Invest.1991.87:2029-2035.)Key words: minimal residual disease * helix-loop-helix proteins
Introduction
T cell acute lymphoblastic leukemia (T-ALL)' comprises
- 15%ofall casesofALL. Featuresthatdistinguish this
dis-ease from B-lineage ALLinclude higher incidence in males,
oldermeanageatdiagnosis, highmeanbloodleukocytecount,
andthe
frequent
presence ofa mediastinalmass(1-3). Al-though theprognosis for both children (4, 5)andadults (6, 7)hasimproved with increased therapeutic intensity, - 40% of
childrenand at least60% ofadultsstillrelapse and dieof
drug-resistant disease.
Addresscorrespondence andreprint requests to R. Graham Smith,
Department of InternalMedicine,University ofTexas Southwestern
Medical Center,Dallas, TX 75235-8852.
Dr. Jonsson'scurrentaddressisDepartmentofPediatrics, St. Jo-seph'sHospital,Landakot, 101 Reykjavik, Iceland.
Receivedforpublication 2 October 1990and in revisedform 9 Jan-uary1991.
1.Abbreviationsused in this paper: T-ALL,T cell acute lymphoblastic leukemia;taldt,deleted,translocatedtal.
Because induction of complete remission is achieved in the vastmajority of patients, current effortstopreventtreatment
failure focus upon modifications of postremission consolida-tion and/or maintenance chemotherapy. Unfortunately, the disease isnotdetectable by routine analysis during the remis-sion period; thus, the effect of therapy on tumor burden is difficultto assess.A sensitiveclonal assay for the residual leu-kemicpopulation during remission would help guide therapeu-ticdecisions beyond the induction period.
A number ofchromosomal translocations are associated with T-ALL (8-10). Theoretically, the underlying molecular rearrangementscould form the basis for sensitive clonal assays for minimal residual disease, justasBCR-ABL gene fusions have servedasmarkers in chronicmyelogenous leukemia (1
1-15). However, nosingletranslocation is found inmorethan 5-10% of cases, and 20-30% of these leukemias display no
karyotypicabnormalitiesatall(8-10).Thiscytogenetic
hetero-geneitysuggests thatanumber ofloci will needtobe
character-izedindetail beforespecificmolecularprobessuitable for de-tection of occult leukemia in themajorityofcases canbe
pre-pared.
We have recently isolated and sequenced thebreakpoint regions derived from one recurrent cytogenetic defect in T-ALL, namely the t(l ;l4Xp34;qI1)translocation (16, 17).In six
cases analyzed in detail, the breakpoints on chromosome 1 clustered within a 1-kbregion. This translocation cleaves the
tal-igeneonchromosome1,separatingits 5' end from therest
of the gene, which is transposed into the Tcell receptora/6 locusonchromosome 14.Thetal-Igenepotentiallyencodes a
protein containingahelix-loop-helix domain, which isfound
in agrowing number of highlyconserved DNAbinding pro-teins involved in the regulationofgrowthand development (18).Severalgenes inthis familyareknown to bedisruptedin subsets of ALL(19-23). Althoughofpotential pathogenic
sig-nificance, the t(1;14)(p34;ql1)translocation is foundin only
3% of T-ALLs (24).
To investigatethe possibility ofa widerrole forthe tal-i
gene inT-ALL,wesearchedforrearrangementsof thisgene in theblastcellsfromagroupof 50 patients withT-ALL.These
leukemias didnot harborthet(l;l4Xp34;ql 1) translocation. Surprisingly, 13(26%) of these leukemiascontained
rearrange-ments atthis locus, all of whichwereidenticalatthe levelof
Southern hybridization analysis (25). Detailed analysis re-vealeda
site-specific
- 90-kb deletiononchromosome1,
one end of whichlies -1 kb from theclustered translocation breakpointsinthet(1;l4)(p34;ql
1) cases. As demonstrated bynucleotidesequenceanalysis, thedeletions are all remarkably
site-specific, differingattheir ends by onlyafewbasesfromone
leukemiatoanother.Thesedeletionswere notfoundin remis-sionperipheral blood leukocytes and therefore appear to be
leukemia specific.Thus,site-specificrearrangements atthe tal-I locus characterize
nearly
30% of T-ALLs: 3% areduetotranslocation
(talt
alleles), while 26% result fromaninterstitialJ.Clin. Invest.
K TheAmerican Society forClinicalInvestigation, Inc. 0021-9738/91/06/2029/07 $2.00
deletion that istoo smalltobe detectedcytogenetically (tald alleles). Theserearrangementsprovide the opportunityto de-velopsensitive clonalassaysfor the relevant leukemias. In this
paper, wedescribeassaysthatcandetect 10rearranged tal-1 cells inabackground of 106 normal cells. Moreover,a modifica-tion of theassay is presented which quantitates tald alleles. Using theseassays, wehave monitored fourpatients with T-ALLwhoarecurrently in remission.
Methods
Patientsand cells. Four patients(L14, L23, L54, and L8 1) with T-ALL were studied. Ages at diagnosis were 10, 7, 9, and 28 yr, respectively. Theimmunophenotype of these leukemias wasCD5 + CD7 + CD19
-TdT+(terminal deoxynucleotidyl transferase). Patients were treated
accordingtoPediatric Oncology Group protocol 8704 (26) (patients L14, L23, and L54) or a minor modification of the Linker regimen for adult ALL (27) (patient L8 1). Normal peripheral blood mononuclear cellswereobtained from consenting adults. Small samples of thymus wereobtained from children (ages 1-20 mo) undergoing cardiac sur-gery. Verterbral bone marrow was obtained at autopsy from young adultaccident victims within 12 h postmortem. T-ALL cell lines RPMI 8402 (28) and MOLT 16 (29) were grown in RPMI 1640 medium containing 10% fetal bovine serum. Blood and bone marrow leuko-cytes werelysed with ammonium chloride and high molecular weight DNApurified by standard methods (30).
DNAamplification. PCR werecarried out as recommended by the manufacturer (Perkin-Elmer Cetus Corp., Norwalk, CT), except thatI
Uof Perfect Match (Stratagene Inc., San Diego, CA) was included in eachreaction.Inearlyexperiments,apairofoligonucleotideprimers, C and D,wereusedtoamplifyatald fragmentof - 225 bp (25). To
increasespecificityofamplification,two newamplimers, P1 and P2, wereconstructedfrom the nucleotide sequences on either side of the
commondeletion(Fig. I A).Relativetotheorientationof the tal-i gene,oligonucleotide P1 begins76 bases 3'tooligonucleotideC, and
oligonucleotide P2 is displaced 12 bases 3' to oligonucleotide D. Oligo-nucleotides P1 and P2, amplifying tatd fragments of - 165 bp, were
routinely used for the detection and quantitation assays reported in this study. Anothersetofoligonucleotides, Xl and X2,wasprepared for the detection of thetaP translocation in leukemia L23 (Fig. 2). These oligomers amplify a 251-bpfragment from the L23 leukemia.High molecularweight DNA (0.1-10 Mg) was added to PCR mixtures and the corresponding number of genome copieswascalculated assuming that 1.5X I05diploid cells containI /gDNA.Amplificationwas
ac-complished inaPerkin-Elmer Cetus Corp. thermalcyclerin 60 cycles. Thefirst cycle consisted of 3 min at 940,1minat610 and 2minat72°; in subsequent cycles the melting step lasted I min. Control PCR
mix-tures were runwith everyexperiment and'included normal liveror
thymus DNA and- Ing tatd DNA.OligonucleotidesP1and F(Fig.I
A) were used toconfirm the integrity of theDNAsamples; all samples containatleastonenormalgermline chromosome Ip, which yieldsa
250-bpfragmentuponPCRcontainingthese primers.Standard pre-cautionsweretakentoavoid contamination of PCR reaction mixtures with PCR products (31).
Hybridization. Aliquotsofthe PCR mixtureswereseparatedon3% NuSeive/1% SeaKemGTG agarose gels (FMCBioproducts,Rockland, ME), denatured, transferredtoHybond-N filters (Amersham Corp., Arlington Heights, IL) and fixedtothe filterby baking. Two kinds of
oligonucleotideswereused forhybridization.Thefirst,oligonucleotide H,was an18-merwhichdetected all tat" alleles (Fig.IA). The second were 4 oligonucleotides which detected specific rearrangements in thetat"leukemias L14, L54 and L81 (Fig. IB)orthetal' leukemia L23(oligonucleotide H2;Fig. 2). End labeling of oligonucleotides, hy-bridization andstringent washingwascarried out aspreviously de-scribed (32).
QuantitativePCR assayfor taldalleles. PCRwascarriedoutas
describedabove, except that internal standard DNAswereaddedto
each reaction(33, 34).The standardswerechosentoyieldanamplified
productthatdiffered insizefrom the targetproduct by -10bp.Thus,
RPMI8402 DNAwasusedasastandard in assays for L14alleles,while MOLT-16 DNAwasused in assays for L54 alleles(Fig. 1 B).DNA standardswereseriallydiluted into normal liverorthymusDNA(12
-centromere germlineip
TTTGCAGTCGATAACGTGCCATTTAAGTTGTTTTTACGGTGGGAATTTCTTGAGGACTGAAACCTTGAATGCTCGCTCTTGCATTCCTCACATTTCTGGCTCACACTCTGCTACGTAGT...ACGGTGTCTGGGAGAAGGTTTCACAGAGGAAGTGA
oligonucleotide F d
taL junction rearranged
TTTGCAGTCGATAACGTGCCATTTAAAGTTGTTTTTACGGTGGGAATTTCTTGAGGACTGAAACCTTGAATGCTCGCTCTTGCATTCCTCACAATTTCcgratcaaaTCATTTCTTCTTCGTGGTTGTGTGCATGCGGTGGGATTGTGAGAGTGCGTTC
No- site <
oLigonucLeotideP1 oLigonucleotide N oligonucLeotideP2
germline1p telomere0
germline centromeric lp
Cell line RPMI 8402 MOLT 16
Patient L14 L54 L81
CATTCCTCACAATTTCTGGCTCACACTCTGCTACGTAGTAAGGG CATTCCTCACAATTTC
CATTCCTCACAATTTCTGGCTCTA CATTCCTCACAATTTCTGG CATTCCTCACAATTTCTGGC CATTCCTCACAATTTCTGG
cggatcaaa ttaggggttc gaaacgactt
g
TCATTTCTTC
GGTTTTCATTTCTTC
TTGGTTTTCATTTCTTC
GTTGGTTTTCATTTCTTC GGTTTTCATTTCTTC
germline telomeric lp
Figure1. (A) Sequence of the deletedtal-i (tald)allelederived from the culturedT-ALL celllineRPMI8402.Thegermlinesequencesof the
centromeric(top line)and telomeric(bottom line) sides of therearrangementarealigned with thetald allele (middle line). About 90 kb of the
normalsequenceisdeleted duetotherearrangement(reference 25). The distal end of this deletion liesinthe first intron ofthetal-igene. Junc-tionalnucleotidesnotfound in thegermlinesequencesareinlowercaseletters. OligonucleotidesP1andP2areusedtoamplifytaldalleles. Oli-gonucleotidesP1 and Famplifya250-bp fragmentonthe 5'(centromeric)side of normaltal-Ialleles andserve ascontrolprimersinPCRassays.
OligonucleotideHis usedtodetectamplified talt alleles inhybridizationassays.Dots(... ) in thetoplinesignifynucleotides omitted from thefigure. (B)taldalleles from fiveT-ALLs, includingthreepatients currentlyinremission(L 14, L54,L81)andtwocell lines(RPMI8402 and MOLT16).Asin A, thetaldsequences arealigned with germline centromeric(topline)andtelomeric (bottom line)sequences,and nongermline nucleotidesareshowninlowercaseletters.The sizes of fragments amplified with oligonucleotidesP1and P2areshownattheright.
159 bp
172 bp
170 bp 162 bp
159 bp
TGCCGCCGCCCCTCZ.GCCTCGGAGACTCTCTTCCTTCCTTCCCCCTTTTCCTTACGCAATATACAGAAATGCGCGAGGCTGTGGTTGGTTTTCATTTCTTCTTCGTGGTTGTGTGCATGCGGTGGGATTGTGAGAGTGCGTTC
- centromere germLine 1p
AAACACCTGCAGTTGGGGGCGGAAAGCTGTTTG.. .AAACTCGCT1TTGGGCGCGGCAGATCGCCCAGGACCACACCGCAGCGTMCTGCAG
der ip AAACACCTGCAGTTGGGGGCGGAAAGCTGTTTG....AA
oligonucLeotideXl
I D62 JS1
RACTCGCTTTGGGCGCGGCAGATCGCCCAGGmawangagcgagatggACTGGGGG&ATtttaagaATACTCATCTTTGGAAAGGAACCCGTGTGACTGTGGAACCAAGTAA
oligonucLeotide H
germl ine14q
2
...
2D82
otigonucleotideX2
... ....teLomere
-kCCTGTACAAAAACTGCAGGGGCAAAAGT
Figure 2. Sequence of the translocated tal-i(talP)allele in T-ALL frompatientL-23. Chromosome I p(top line)and 14q (bottomline) sequences
arealignedwith thetaltallele(middle line).ThebreakpointonchromosomeIpis in the first known intron of thetal-Igene, 2.5 kb 3' of the distal side of thetalt rearrangements(references 16 and 17). Thetranslocationcreates aderIp chromosome,whichjoinsthe firstexonof the tal-I geneto arearranged D62-J51 geneonchromosome 14q11.Nongermlinejunctional nucleotidesareshown in lower case letters.D62and
J61 segmentsareoverlined. Heptamer-nonamer recombination sequencessurroundingthegermlineD62 segmentarehighlightedwithoverlying
dots.OligonucleotidesXl and X2areusedtoamplifythe L23talt allele; oligonucleotideH2 is usedtodetect thisamplified productina
hy-bridization assay. Dots(... )in the top and middle linessignifynucleotides omitted from thefigure.
yg/ml). The dilutions of standardDNA wereaddedtoPCRmixtures containingtargetDNAswhosetaldallelesweretobequantitated.The productswereseparated byelectrophoresisthrough 10%
polyacryl-amide gels and visualizedby stainingwith ethidiumbromide. The
origi-nal number of targettaldalleleswasestimatedbydensitometric
com-parison ofstainingintensities of the standard and targetproducts.
Equal numbers of standard and target alleles presentatthe startof
amplificationwereshowntogenerateequalyieldsofproducts.Refined estimates of target allele numberwereobtainedbyrepeatingassays in the presence ofanarrowrange of twofolddilutionsof standard DNAs.
Results
Basisfor detection oftal/- gene rearrangementsinT-ALL.The rearrangements ofthe tal-I gene exploited in this study are shown inFigs. 1 and2. The
tald
alleles are the consequence ofan 90 kbdeletion which amputatesatleastoneexonof the
tal-igeneonchromosome lp
(25).
The5'and3'ends of thesedeletionsareremarkablyclustered withinafew basepairsinall
tald
allelessequencedsofar (25).Forthefive T-ALLsstudied herein, thesequences near these ends areshown inFigure 1B.Each
tald
allele differs by several nucleotidesattheproximal anddistalendsof the deletionand in the sequence of the extranongermline nucleotides that replacethedeletion. These
fea-tures enablethe
specific
detection ofthesealleles by PCRandhybridization
assays, asdescribedinMethods.Asimilar strat-egy was used to detect thet(l14Xp32;q
11)(tal')
allele inmate-rialfrom patientL23(Fig. 2).
Distribution of tald alleles. Using Southern hybridization
analysis,
wepreviously reported that thetald rearrangement wasfoundin13of 50T-ALLdiagnostic bloodorbonemarrowsamples (25). Inthis study,wefounda
perfect
correlation be-tweenresultsoftheSouthernandPCRassaysofthese50leuke-mias. A sample ofthe data is shown in Fig. 3. In Southern
hybridization to atal-i probe, two
tald-positive
leukemias(lanes 4 and8)yieldeda novel4.5-kbEcoRI fragment. PCR assayscontaining oligonucleotidesC and D generated products
- 225bpinlength from the same twoleukemias(see
Mieth-ods) (25). The other seven leukemias shown in Fig. 3 were
negative byboth Southern and PCRanalysis.
In orderforthe
tald
PCR assay to be ausefultool for thedetection of minimalresidual disease,
talt-bearing
cellsshouldnotbefound innormalhematopoietic tissues. UsingthePCR
assay, wefoundnoevidence of suchcellsinnormalperipheral
blood mononuclear cells (n = 40), thymus(n = 5), or bone
marrow(n =5) (datanotshown). Thesensitivityof this assay was 5-10 genomecopies(cells) per 106. Therefore, within the limitsofdetection ofthisassay,taldrearrangements arespecific for leukemic cells.
Detection
ofresidual
diseasein T-ALL.Fourpatients
withT-ALLwerestudied. Threeoftheseleukemias (L14,L54,and L8 1) contained the
tald
deletion, whilethefourth(L23)hadthe talt translocation. The results of surveillance for taldalleles areshowninFig.4andsummarizedinTableI. All fourpatients
were in complete remission at the time of collection ofthe
samples forassay.
Characteristicbandsrepresenting tald fragmentswere
am-plified in PCRs containing the diagnostic bonemarrow sam-plesfromeachofthese threepatients (Fig.4, lanes 1, 6, and10). These bands differ slightly in size, as predicted from the se-quencesofthe corresponding taldalleles(Fig.1B). Oligonucle-otideprobesHand P1, butnotP2,hybridizedto faster-migrat-ing bandsaswell(Fig.4 C, lanes 1, 3, 4, and 7;and data not
shown). Therefore,these faster-migratingbands areprobably single-stranded
tald
DNA produced during the PCR reaction (35). Dilution experiments demonstratedasensitivity ofdetec-tion of10
copies
per 106(Fig.4 AandC, lanes 2-4).tald
alleleswere not detected in blood or bone marrow samples drawn
from patients L14and L81 between the 4th and 20th mo of
1 2 3 4 5 6 7 8 9 Figure3.Assayfortalt
A alleles in bonemarrow samplesobtainedatthe
225-
time
of diagnosis frompatientswith T-ALL. (A) Products of PCR
re-B actions containing
oli-250- gonucleotides C andD,
which amplifyatald C fragmentof 225 bp
(reference 25). Size
4.4
- markers(bp)areshown byhorizontallinesattheleft side of the fig-2.0 - ure. (B)PCRproducts
amplifiedwith oligonu-cleotides PI andF toconfirmDNAintegrity. (C) Southern analysis ofgenomicDNAdigestedwithEcoRIandhybridized withtal-i probeB2EE-2.0(reference25). Size markers (kb) are shown by hori-zontallinesattheleft side of thefigure.
..-I ... ---
L14
L54 L81 appearance of a minimal tumor burden rather late in thecourseoftreatmentof patient L23. Furtherobservation is
nec-essary to understand the significance of this finding.
LO~t
LO LO LOco>LOt LO)
co)
Quantitativeassayfor
tald alleles. Theavailability
ofsev-0 0 0 0 0 0 0 0 eraltaldalleles,eachofwhich yieldedaPCR productofdistinct x x x x x x x x size, allowed us to establish a quantitative assay for genomes O of) C
containing
these rearrangements. In this assay, known amountsofatald-containing genomic
DNAservedasinternalC] C)D
CDL
standards for themeasurementoftarget
alleles(33,
34).
Stan-dard andtargetPCR productsweredistinguishedbytheir
dif-12 3 4 5 6 7 8 9 10 11 ferent lengths on polyacrylamide gels. The ratio ofthe yields of
thetwoproductswasestimatedbyvisual inspectionand scan-ning densitometry. As shown in Figure6 A, thisassay accu-rately measured 50 and 250 copies of Ll4D
tald
alleles dilutedinto 1.2 x
106
normalthymus genomecopies.In this case, the RPMI 8402 taldallele served as theinternal standard for theLl4D target allele, the PCR products differing by 11 bp in
length (Fig. 1 B). To measure the number of
tald
alleles inbloodsample
L54F1,
MOLT 16 DNA waschosenas astan-dard. Approximately 30 copies of theL54alleleper1.9x
l01
U
genomes(150/106)
werepresent
atthis timepoint
(Fig.
6B).
Asnoted, samples obtained from patient L54 after this timewere
negative in the
amplification/hybridization
assayandtherefore contained <10 tald alleles persample analyzed (Fig. 4, Ta-bleI).
118
-Figure 4.Detection of tald alleles by amplification/hybridization as-say.PCR mixtures contained: highmolecularweightDNAderived
frombloodorbonemarrowcells ofpatients L14, L54,orL81;and
either(A and C) oligonucleotidesP1 and P2(Fig. A)fordetection oftaldalleles;or(B)oligonucleotidesP1 andF(Fig. A)tocontrol for DNAintegrity.D indicatesdiagnostic sample;Fsamplesare
fol-low-upperipheralbloodleukocytescollectedduringclinical remission
(Table I).Thenumber ofgenomecopiesaddedtoPCRmixtures,
shown above thelanes,wascalculatedassuming I ggDNA= 1.5 x l0 genomes.Sizemarkers(bp)areshownbyhorizontal lineson
the left side of thefigure. (AandB)Ethidiumbromide-stained 10%
polyacrylamide gelsof PCRproducts. (C)Southernhybridizationof
PCRproducts amplifiedwitholigonucleotidesPI andP2,probed with oligonucleotideH(Fig. IA).
treatment(Table I). Examples of these negative assays are showninFig. 4, lanes5 and 11.Bycontrast, tald alleleswere detectedinabloodsample drawnfrompatientL54duringthe 4thmo oftherapy(Fig. 4, lane 7). However, specimens col-lected frompatient L54 from the 5th through the 11thmoof
treatmentwerenegative (Table I).
Detectionoftal'alleles in material frompatient L23 is shownin Fig. 5 and TableI. The characteristic 25l-bp band
was seenupon amplification of DNA isolated from the diag-nosticmarrow sample (Fig. 5 A, lane 1). This bandwasnot obtainedwith normalthymusDNA(lane 5) andwasdistinct fromthecontrol 250-bp fragment from the5'region ofthe tal-1 locusamplified with oligonucleotides P1 and F (B). The sensi-tivity of detection, 5-10 copies per 106, was similartothat obtainedinthe
tald
assay(lanes 2-4).Abloodsampledrawn inthe 19thmooftherapywasnegative (lane 6). However, mo
latertheassay wasclearlypositive (lane 7). Because this patient showednoclinicalorhematological signs of relapseatthetime
the latter sample was collected, this assayresult implies the
TableI.Rearranged
tal-1
AllelesinBlood andBone MarrowSamplesfrom T-ALLPatients
Monthof
Patient Sample treatment Detection
L14* Do 1 +
F1 4
-F2 17
-F3 18
-F4 20
-L54* D 1 +
F1 4 +(150/106)
F2 5
-F3 6
-F4 8
-F5 9
F6 9
-F7§ 10
-F8 11
-L81* D 1 +
F3 13
F4 14
F6 15
L23t D 1 +
F2 19
F3 20 +
DNAwasextracted fromdiagnostic(D)orfollow-up(F)peripheral
bloodorbone marrows leukocytesandassayed by the
amplification/hybridization procedurefortald (*)ortap($)alleles. +, allelesdetected; -, allelesnotdetected. Both bloodand bonemarrow
frompatient L54wereassayedatmonth 10.taldalleles insample
L54F1 werequantitatedasdescribed in Methods.
A
194
-
118-B
250
-C
-A 271
234
-B
I
250- 1
C
271 -|
234
-L23 NT L23 Figure5. Detection of
taltalleles by
amplifica-Cs Ln tion/hybridization as-X x' x say.PCR
mixturescon-C1 CD LO 0~ OC, -Cl
CO O ° 6c 6 tained:highmolecular
anaLL
weight
DNAderived
1 2 3 4 5 6 7 from blood or bone
marrowcells ofpatient L23; andeither (A and C)oligonucleotidesXl and X2(Fig. 2) for
de-5 tection oftaltalleles;or
(B)oligonucleotides PI
andF(Fig. IA)to
con-trolforDNAintegrity. Dindicatesdiagnostic sample;Fsamples arefollow-upperipheral blood leukocytes collected
duringclinical remission(TableI).NTindicates normalthymus
DNA.The numberofgenomecopiesadded to PCRmixtures,shown above thelanes, was calculatedassuming 1jugDNA= 1.5X l0
genomes.(A andB) Ethidium bromide-stained 10%polyacrylamide
gel of PCR products. (C) Southernhybridizationof PCRproducts
amplified witholigonucleotidesXlandX2,probed with
oligonucle-otide H2(Fig. 2).
Discussion
Although significant improvements in longterm disease-free survival have resulted fromcontemporary
therapeutic
pro-grams, - 40%of childrenand60%of adults withT-ALLstillrelapseanddieofdrug-resistant leukemia.Atthe same
time,
anincreasing variety of therapeutic modalitieshasappeared, in-cluding novel doses and schedules of existing drugs, newer agents such aspentostatin
(deoxycoformycin), biologic
re-sponsemodifiers suchasa-interferon, immunotoxins,
andallo-geneic or autologous bone marrow
transplantation.
Because thetotalpoolofpatients is relatively smallandprognostic strati-fication isnotwelldeveloped, progress inselection ofoptimal
therapy for individualpatientshasbeen limited.Accurate
de-tection andquantitation ofdisease
during
the intensivepostin-duction phase of therapy could facilitate selection ofthe best
consolidation/maintenance approach foreach individual
pa-tient.
Site-specificDNA rearrangementsinALLcellsprovide
clonal markersforthedetection of
residual
disease.These rear-rangements areoftwo sorts:physiologic immunereceptor gene rearrangementsandpathologic recombinationaleventssuchaschromosomaltranslocations,
deletions,
andinsertions.Exam-ples oftheformerprocess areTCRbVDJ segment rearrange-mentswhich havebeenexploitedasclonal markers forT-ALL
populations
(36, 37). Potentialdisadvantages
of this approach include the requirement for specific probes for each clone, the dominance ofnewrearrangementsduring
clonalprogression,
and doubtsregarding true tumor
specificity
of the particular rearrangementbeing
monitored. Use of thelatter,
pathological
kinds ofrearrangements asclonal markersmay overcomethese limitations, especially ifasite-specific abnormalitywerefound inalarge
fraction
ofT-ALLs.The
t(1;14)(p34;ql
1) translocation is foundinonly 3% ofT-ALL(24). Thefinding ofagene
tal-i,
encodingacandidatehelix-loop-helix
DNAbinding proteinatthe site of thebreak-points
onchromosome 1 p,raisedthequestionwhether other,nontranslocational rearrangements of thisgene mightbe in-volved in leukemias of this type. Remarkably, 13 of 50 such
leukemias were found to contain nearly identical deletions of
- 90 kb from the upstream region of this gene (25). The
dele-tions were not found in remission peripheral blood leukocytes, indicating that tald alleles are not germline genetic polymor-phisms in these patients (25). The site of this common rear-rangementwithinthefirstknownintron ofthetal/- locus is -1 kb 5' of a cluster of breakpoints found in the
t(l;l4Xp34;ql 1) translocations inT-ALL(25).Inadditionto adding strong circumstantial evidence for a role of thesetal-i
rearrangementsin the pathogenesisofT-ALL, the remarkably focused natureof therearrangementsprovidesanopportunity
tomonitortheleukemiccloneswith straightforwardgenomic PCR assays. A single pair of amplimers sufficed for all tald
alleles,whileafewadditional pairs should be adequate to
de-tectthetaltcases.Atotalof 30%of T-ALLs should thus be amenable todisease monitoring based upon thesetal-i rear-rangements.
The successof thisapproach depends upon the absenceof
tal-i rearrangementsin normalhematopoieticcells. The site-specificnatureofthese rearrangements raisesthequestion whetherthey could play a roleinnormal T cell development or
function. Moreover, aberranttrans-rearrangements involving immune receptor genes have been demonstrated by PCR of
normalthymocyte DNA (38). Sincebothkinds of tal-i rear-rangementsstudied hereinmayoriginate from misdirected
ac-A
L14D
K
RPMI8402 CD
194-U
50 250
10 0 LO C) a
cmc0 LO 10 c 0Ln 10
CY) cam c C\ cm u \rL
C)
C)
-L14D
-RPMI8402
L14D U1 h,- I c
RPMI8402 60
B
L54F1
F
MOLT 16
co14 10 0 C) 0 ) C\4
6 C) C)
C.o
1.9x10
5.
1
COCo
co CD
-
MOLT 16
-
L54Fl
L54F1
MOLT1 6
CY) r'- v- (.0
c:i IC)
Figure 6. Quantitationoftaldallelesusinganinternal standard in PCR assay. (A)Quantitationof L14Dtaldalleles.Varyingamounts
ofRPMI 8402 DNA, shownasgenomecopiesabove thelanes,were
addedtoPCR mixturescontainingeither 50or250 genomecopiesof LI4D DNA. Theproductswereanalyzedon a10%polyacrylamide gelandstained withethidium bromide. The L14D and RPMI 8402 productsaremarkedontherightsideof thefigure;asize marker
(194bp) is shownontheleft. The band intensitieswerequantitated
tion of the immune receptor recombinase, we examined cell
populations containingmature and developing T lymphocytes
for evidence oftalt alleles. Usingthe
amplification/hybridiza-tionassay,whichdetects 10 rearranged alleles among 106 cells, wedidnot detect any
talt
alleles in normal mature ordifferen-tiating hematopoietictissues.Thus,it is unlikelythat rearrange-ments atthetal-I locus play any important developmental or
functional roleinnormalTcells.Of practicalsignificance, the low backgroundoftheserearrangementsin normal
hematopoi-etic cells shouldnotinterfere with sensitiveand specific
detec-tionof the leukemic clones.
Inthisstudy, we have tested in four patients the suitability
oftal-Igene rearrangements as clonal markers for T-ALL. Of
the threesubjects withtalt leukemia, evidence ofresidual dis-ease wasfoundearlyinremissionin one (L54). However, the
leukemic
talt
marker was not detected during an ensuing fol-low-up periodof7mo. On the other hand, the one patient witht(l;14)(p32;ql 1)
(talt)
disease hadapositive PCR assay in his20thmooftreatmentwhichwas preceeded by a negative assay.
Onlyfurther observation of these and other patients willtest
thepredictivepowerof theseassaysfor diseaserecurrence.
Previous experiencesuggeststhat theabilitytoquantitate thesealleles inserial samples should increase the
reliability
of relapseprediction.Forexample, inpatients with chronicmy-elogenous leukemia followed aftermarrowablation and alloge-neicbone marrowtransplantation, the finding of isolated Ph' translocations either by
cytogenetic
orPCRassayhasnotpre-dicted subsequent relapse. On the otherhand, serial increases in the Ph'markerorits molecular
equivalent
havecorrelated withhematologic relapse (1 1-15, 39).Therefore,wesoughttodevelopa
quantitative
assayfortalt allelesbasedonthe PCR method. The modified assay relies on an internal standard which contains a second tald alleledistinguishable from
thefirst
basedonthesizeof theamplified product.
Thereliability
of thisassaydependsonthe
assumption
thatamplification
of thesetwoclosely relatedsequencesisequally
efficientthrough-outthe PCR.Under these
conditions,
therelativeyield
of thetwoproducts
depends solely
uponthe ratio ofcopies
presentatthe startof the reaction
(33, 34).
Thisassumption
shouldbe trueifnocis-acting
factors favor theamplification
ofonealleleoverthe other. To ensure such
equality,
we usedonly
rigor-ously
purified
DNAsamples
inthisassay.Under thesecondi-tions,
thequantitative
assayaccurately
measured 50 to 250copies
oftalt
allelespresentinalarge
excessof
normalDNA.30
copies (150/106)
of the L54talt
allele were found in the L54F1 sampleduring
the 4th mo of treatment. We arecurrently
adapting
thisapproach
tothedsetection
oftattaswellas
talt
alleles.Nowthat
talt-
rearrangements havebeen showntobefeasi-bleclonalmarkersfora
large
subsetofT-ALLs,
expanded
clini-caltrialsare
appropriate
to testthe accuracyofrelapse
predic-tion. One
ancillary question
tobeaddressedinsuchtrials is thestability
of theserearrangementsasclonal markersduring
dis-ease
progression.
Asmall subset ofT-ALLpatients relapse
withordevelopde novo
myeloid
leukemia(40).
Whethertal-I
rear-rangementspersist during such shifts inphenotype isan
intrigu-ing issue
touching
on both thebiology
and management of theselineage-switching leukemias.
Acknowledgments
Wethank Jayne Cash for bloodsamplesfrompatientsL14,L23,and L54, BarryCooperfor bloodsamplesandclinical datafrompatient
L8 1, andEugeneFrenkelforacriticalreadingof themanuscript.
This workwassupportedbytheNational Cancer Institute(grants CA-42891, CA-44016, CA-46593, CA-47975, CA-33625,and
CA-21675[Core]),theChildren's CancerFund ofDallas,the Weekendto WipeOutCancer,and the NasherFamilyCancerResearch Fund.
References
1.Sen,L.,and L.Borella. 1975. Clinicalimportanceoflymphoblastswith T-markers inchildhood leukemia.N.Engl.J.Med.292:828-832.
2.Tsukimoto, I.,K. Y.Wong,and B. C.Lampkin.1976.Surfacemarkers and
prognosticfactorsinacutelymphoblasticleukemia.N.Engl.J.Med. 294:245-248.
3.Roper, M.,W. M.Crist,R.Metzgar,A.H.Ragab,S.Smith,K.Starling,J.
Pullen,B.Leventhal,A. A.Bartolucci,and M. D.Cooper. 1983.Monoclonal
antibodycharacterization of surfaceantigensinchildhood T-celllymphoid
ma-lignancies.Blood. 61:830-837.
4.Shuster,J.J.,J. M.Falletta,D. J.Pullen,W. M.Crist,G. B.Humphrey,
B. L.Dowell,M. D.Wharam,and M.Borowitz. 1990.Prognosticfactorsin
childhoodT-cellacutelymphoblasticleukemia:apediatric oncologygroupstudy.
Blood.75:166-173.
5.Pui,C.H.,F.G.Behm,B.Singh,M. J.Schell,D.L.Williams,G. K.Rivera,
D.K.Kalwinsky,J. T.Sandlund,W. M.Crist,and S. C.Raimondi.1990.
Hetero-geneityofpresentingfeaturesandtheirrelationto treatment outcomein 120
children withT-cellacutelymphoblasticleukemia.Blood.75:174-179. 6.Hoelzer, D.,E.Thiel,H.Lofller,T.Bitchner,A.Ganser,G.Heil,P.Koch,
M.Freund,H.Diedrich,H.RMhl,etal. 1988.Prognosticfactorsinamulticenter
studyfortreatmentofacutelymphoblasticleukemiainadults. Blood. 71:123-131.
7.Gaynor, J.,D.Chapman,C.Little,S.McKenzie,W.Miller,M.Andreeff,
Z.Arlin,E.Berman,S.Kempin,T.Gee,and B. Clarkson. 1988.Acause-specific
hazardrateanalysisofprognosticfactors among 199 adults withacute
lympho-blasticleukemia: the memorialhospitalexperiencesince 1969. J. Clin.Oncol. 6:1014-1030.
8.Raimondi,S.C.,F.G.Behm,P. K.Roberson,C. H.Pui, G.K.Rivera,S. B.
Murphy,and D.L. Williams. 1988.Cytogeneticsof childhoodT-cellleukemia. Blood. 72:1560-1566.
9.Kaneko, Y.,G.Frizzera,T.Shikano,H.Kobayashi,N.Maseki,and M.
Sakurai. 1989.Chromosomal andimmunophenotypicpatternsinTcellacute
lymphoblasticleukemia(T-ALL)andlymphoblastic lymphoma (LBL).
Leuke-mia.3:886-892.
10.Ucken,F.M.,K.J.Gajl-Peczalska,A.J.Provisor,and N.A.Heerema.
1989.Immunophenotype-karyotypeassociationsinhumanacutelymphoblastic leukemia.Blood.73:271-280.
11.Gabert, J.,I.Thuret,M.Lafage,Y.Carcassonne,D.Maraninchi,and P.
Mannoni.1989. Detectionof residualbcr/abltranslocationbypolymerasechain
reactioninchronicmyeloidleukaemiapatientsafterbone-marrow
transplanta-tion. Lancet. ii: 1125-1128.
12.Lange, W.,D.S.Snyder,R.Castro,J. J.Rossi,and K. G. Blume. 1989. Detectionbyenzymaticamplificationof bcr-abl mRNA inperipheralblood and bonemarrowcellsofpatientswith chronicmyelogenousleukemia. Blood. 73:1735-1741.
13.Delfau,M.H.,J.P.Kerckaert,M.Collyn d'Hooghe,P.Fenaux,J.L. La,
J. P.Jouet,and B.Grandchamp. 1990.Detection of minimal residual diseasein chronicmyeloidleukemiapatientsafter bonemarrowtransplantation by
poly-merasechainreaction. Leukemia.4:1-5.
14.Kohler, S.,N.Galili,J.L.Sklar,T.A.Donlon,K. G.Blume,and M. L.
Cleary. 1990.Expressionof bcr-ablfusiontranscripts followingbonemarrow transplantationforPhiladelphiachromosome-positiveleukemia. Leukemia.
4:541-547.
15.Sawyers,C.L.,L.Timson,E.S.Kawasaki,S. S.Clark,0.N.Witte,andR. Champlin.1990. Molecularrelapseinchronicmyelogenousleukemiapatients
after bonemarrowtransplantationdetectedbypolymerasechainreaction. Proc.
Natl.Acad.Sci. USA87:563-567.
16.Chen, Q.,J.-T.Cheng,L.-H.Tsai,N.Schneider,G.Buchanan,A.Carroll,
W.Crist,B.Ozanne,M.Siciliano,and R. Baer. 1990. The tal geneundergoes
chromosometranslocationinTcellleukemia andpotentiallyencodesa
helix-loop-helixprotein.EMBO(Eur.Mol. Biol.Organ.)J.9:415-424.
17.Chen, Q.,C. Y.-C.Yang,J. T.Tsan,Y.Xia,A.H.Ragab,S. C.Peiper,A.
Carroll,and R.Baer. 1990.Codingsequences of thetal-Igenearedisrupted by
chromosome translocation in human T cellleukemia.J.Exp.Med.
172:1403-1408.
18.Murre, C.,P.S.McCaw,and D.Baltimore. 1989.AnewDNAbinding
anddimerization motifinimmunoglobulinenhancerbinding, daughterless,
MyoD,and mycproteins.Cell. 56:777-783.
19.Leder, P.,J.Battey,G.Lenoir,C.Moulding,W.Murphy,H.Potter,T.
Stewart,and R. Taub. 1983.Translocationsamongantibodygenesin human
cancer.Science(Wash.DC).222:765-771.
20. Mellentin, J. D., S. D. Smith, and M. L. Cleary. 1989.Iyl-l,anovel gene alteredbychromosomaltranslocationin T cellleukemia,codes foraproteinwith
21. Mellentin, J. D., C. Murre, T. A. Donlon, P. S. McCaw, S. D. Smith, A. J. Carroll, M. E. McDonald, D. Baltimore, and M. L. Cleary. 1989. The gene for enhancer binding proteins E l 2/E47 liesatthet( 1; 19) breakpoint in acute
leuke-mias.Science (Wash. DC). 246:379-382.
22.Nourse, J., J.D.Mellentin, N. Galili, J. Wilkinson, E. Stanbridge, S. D. Smith, andM.L.Cleary. 1990. Chromosomal translocation t(I;19)results in
synthesis ofahomeobox fusionmRNAthat codes forapotentialchimeric
tran-scription factor. Cell.60:535-545.
23. Kamps, M. P., C. Murre,X. H.Sun, and D. Baltimore. 1990.Anew
homeobox gene contributes theDNAbinding domain ofthet(1; 19) translocation protein in pre-BALL.Cell.60:547-555.
24.Carroll, A., W. Crist, M. P. Link, M. D. Amylon, D. J. Pullen, A. H. Ragab, G. R. Buchanan, R. S. Wimmer, and T. J. Vietti. 1990. The t( 1; l4Xp34;q11) translocationis non-random and restricted to T-cell acute
lym-phoblasticleukemia.Blood.76:1220-1224.
25. Brown, L., J.-T. Cheng, Q. Chen,M.Siciliano,W.Crist, G. Buchanan, and R.Baer. 1990.Site-specificrecombination of the tal-l gene isacommon occurrence in human T cellleukemia.EMBO (Eur.Mol.Biol. Organ.) J. 9:3343-3351.
26. Amylon, M., S. Murphy, and J. Pullen. 1988. Treatment oflymphoid
malignanciesaccordingto immune phenotype:preliminaryresults in T-cell dis-ease.Proc. Am.Soc. Clin.Oncol.7:225a.(Abstr.)
27.Linker, C. A., L. J. Levitt, M. O'Donnell, C. A. Ries, M. P. Link, S. J. Forman, andM.J. Farbstein. 1987. Improved resultsoftreatment of adult acute lymphoblastic leukemia. Blood. 69:1242-1248.
28. Minowada, J., and G. E. Moore. 1975. T lymphocyte cell lines derived from patients with acute lymphoblastic leukemia. In Comparative Leukemia Research 1973:Leukemogenesis.Y. Itoand R. Dutcher, editors. University of Tokyo Press, Tokyo. 251-261.
29. Kohno, K, T. Otani, and J. Minowada. 1986. Human T-cell leukemia cell lines (MOLT 16 and MOLT 17): production of IL2-like factor. Proc. Annu. Meet. Jpn. Cancer Assoc. 45:203a. (Abstr.)
30.Herrmann, B.G.,and A.-M.Frischauf.1987. Isolationof genomicDNA. MethodsEnzymol. 152:180-183.
31.Kwok, S., and R. Higuchi. 1989. Avoiding false positives with PCR. Na-ture(Lond.).339:237-238.
32.Jonsson, 0.G., R. L. Kitchens, F. C. Scott, and R. G. Smith. 1990. Detection of minimal residual disease in acutelymphoblasticleukemia using immunoglobulin hypervariable region specific oligonucleotide probes.Blood.
76:2072-2079.
33.Gilliland, G., S. Perrin,K.Blanchard, andH. F.Bunn.1990.Analysisof
cytokinemRNAand DNA:detectionandquantitationbycompetitive polymer-ase chain reaction. Proc.Natl. Acad.Sci. USA. 87:2725-2729.
34. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning:A
Laboratory Manual. Cold Spring Harbor Laboratory (CSH), Cold Spring Harbor, NY. 14.30-14.33.
35.Gyllensten,U.B., and H.A.Erlich. 1988. Generationofsingle-stranded
DNAby the polymerase chain reaction and itsapplicationtodirectsequencing of
the HLA-DQA locus. Proc.Nati.Acad.Sci. USA. 85:7652-7656.
36. Hansen-Hagge,T.E., S. Yokota, and C.R. Bartram. 1989.Detectionof minimalresidual disease in acutelymphoblasticleukemia by in vitro
amplifica-tionofrearranged T-cell receptor delta chain sequences.Blood. 74:1762-1767.
37. Campana, D., S. Yokota, E.Coustan-Smith,T. E. Hansen-Hagge, G. Janossy, and C. R. Bartram. 1990.Thedetection of residualacutelymphoblastic
leukemia cells with immunologic methods and polymerase chainreaction:a
com-parative study. Leukemia. 4:609-614.
38.Tycko,B., J. D. Palmer, andJ.Sklar. 1989.Tcell receptor gene
trans-rearrangements: chimeric gamma-delta genes in normal lymphoid tissues.
Science (Wash. DC). 245:1242-1246.
39. Arthur, C. K.,J. F.Apperley,A. P.Guo, F. Rassool,L.M.Gao, and J. M. Goldman.1988.Cytogeneticeventsafter bone marrow transplantation for chronicmyeloidleukemia in chronic phase.Blood.71:1179-1186.
40.Pui, C. H., F. G. Behm, S. C.Raimondi,R.K.Dodge, S. L. George, G. K. Rivera, J. Mirro, Jr., D. K. Kalwinsky, G.V.Dahl, and S. B. Murphy. 1989. Secondaryacutemyeloidleukemia in children treated foracutelymphoid