Page 1 of 15
An ABC pleiotropic drug-resistance transporter of
Fusarium graminearum with a role in crown and root
diseases of wheat
Running title: Fusarium ABC transporter important for wheat disease
Donald M. Gardiner1, Amber E. Stephens1,2, Alan L. Munn2,3 and John M. Manners4
1
CSIRO Plant Industry, Queensland Bioscience Precinct, 306 Carmody Road, St. Lucia, Brisbane, QLD 4067, Australia. 4PO Box 1600, Canberra, Australian Capital Territory, 2600, Australia.
2
The Institute for Molecular Bioscience, The University of Queensland, QLD 4072, Australia
3
School of Medical Science and Molecular Basis of Disease Program, Griffith Health Institute, Griffith University (Gold Coast Campus), Southport, QLD 4222, Australia.
Keywords: Fusarium head blight, Fusarium root rot, Fusarium crown rot, BOA, phytoalexin
Page 2 of 15
Abstract
FgABC1 (FGSG_04580) is predicted to encode a pleiotropic drug resistance-class ABC
transporter in Fusarium graminearum, a globally important pathogen of wheat. Deletion mutants of FgABC1 showed reduced virulence towards wheat in crown and root infection assays but were unaltered in infectivity on barley. Expression of
FgABC1 during head blight and crown rot disease increases during the necrotrophic
phases of infection suggestive of a role for FgABC1 in late infection stages in different tissue types. Deletion of FgABC1 also led to increased sensitivity of the fungus to the antifungal compound benalaxyl in culture but the response to known cereal defence compounds, gramine, 2-benzoxazalinone and tryptamine, was un-altered. FgABC1 appears to have a role in protecting the fungus from antifungal compounds and is likely to help combat as yet unidentified wheat defence compounds during disease development.
Page 3 of 15
Introduction
The pathogen F. graminearum causes Fusarium Head Blight (FHB) disease in wheat and other small grain crops (Goswami & Kistler, 2004, Walter et al., 2010, Kazan et
al., 2012). Fusarium Crown Rot (FCR) and Fusarium Root Rot (FRR) are also important
diseases of wheat that can be caused by Fusarium pathogens, including
F. graminearum (Mudge et al., 2006, Dyer et al., 2009). The symptoms of FCR consist
of a spreading dark necrotic lesion at the stem base and crown. As the plant matures the development of white heads with empty grain is observed (Burgess et al., 2001). FRR causes necrosis on roots with the fungus found in the cortex but not stele after artificial inoculation (Beccari et al., 2011). In general, there is much less known about host-pathogen interactions associated with FCR and FRR than for FHB. Trichothecene toxins are well known as virulence factors for FHB facilitating the spread of the pathogen through the infected head (Jansen et al., 2005) and are also produced at high concentrations during FCR where they contribute to stem colonisation (Mudge
et al., 2006). Infection of the stem base following inoculation with conidia of F. graminearum has suggested that there is phasic infection during FCR reflected in
biomass differences and differences in pathogen gene expression profiles (Stephens
et al., 2008). Using the Affymetrix global gene expression analysis arrays that are
available for F. graminearum (Güldener et al., 2006) many fungal genes were identified that were expressed in much higher levels during the infection process when compared to expression in axenic culture (Stephens et al., 2008). Several genes that are highly expressed in planta had putative detoxification functions and this included the putative ATP Binding Cassette (ABC) transporter gene (FGSG_04580) which we have termed FgABC1. The recently sequenced genome of
F. pseudograminearum has an almost identical copy of FgABC1, termed FpABC1
(Gardiner et al., 2012).
Many studies have shown that ABC transporters, particularly those with multi-drug resistance (MDR) or pleiotropic drug resistance (PDR) domains, are important in the resistance of fungal pathogens to xenobiotics (Kretschmer et al., 2009). Transporters in fungi have recently been reviewed (Coleman & Mylonakis, 2009), but for the
Page 4 of 15 majority of those encoded in fungal genomes the specific substrate(s) is/are unknown. Transporters responsible for efflux of plant-derived defence compounds have been characterised in a small number of species. These include the Botrytis
cinerea BcatrB which transports camalexin from Arabidopsis and resveratrol from
grape, NhABC1 from F. solani f. sp. pisi which transports pisatin from pea, the F.
sambucinum GpABC1 which exports rishitin from potato and GcABC-G1 which
transports terpenes from pine in Grosmannia clavigera (Schoonbeek et al., 2001, Fleißner et al., 2002, Stefanato et al., 2009, Coleman et al., 2011, Wang et al., 2012). Other ABC transporters have roles in virulence and PDR but specific substrates related to their hosts are yet to be identified. These include the Magnaporthe oryzae transporters ABC1 and ABC4 that impart resistance to phytoalexins isolated from non-host species suggesting a role in MDR and potential export of unknown rice phytoalexins (Urban et al., 1999, Gupta & Chattoo, 2008). Likewise, in F. culmorum and Mycosphaerella graminicola ABC transporters are involved in virulence towards wheat (Stergiopoulos et al., 2003, Skov et al., 2004). In F. solani f. sp pisi NhABC1 acts with another detoxification mechanism (chemical modification) to provide tolerance to the pea phytoalexin pisatin (Coleman et al., 2011). If similar multiple-faceted detoxification systems exist in other fungi, identification of specific plant-derived defence chemicals that are substrates for these transporters may be difficult. A recent analysis of the F. graminearum genome has identified 62 potential ABC transporter genes (Kovalchuk & Driessen, 2010). Only one of these (FgABC2) has been studied functionally and it does not have a role in FHB of wheat (Goswami et
al., 2006). In the present study, we have investigated the function of FgABC1 using
knock-out mutants, chemical screening assays and heterologous expression in yeast. This work aimed to investigate the function of FgABC1 in protecting against antifungal compounds and in virulence towards wheat during root and crown infection.
Page 5 of 15
Materials and Methods
Isolates and FgABC1 deletion
The Australian F. graminearum isolate CS3005 was used (Akinsanmi et al., 2006). The
FgABC1 gene replacement was created by the PCR split marker method using PCR
primers shown in Supplementary Table 1 (Fairhead et al., 1996, de Hoogt et al., 2000). The strategy and primer binding positions are shown in Fig. 1. All fungal transformations were completed according to Desmond et al. (2008). Hygromycin-resistant transformants were screened by multiplex PCR amplification (Supplementary Table 1).
Phenotype microarrays
Phenotype microarrays were performed as previously described in defined minimal media with 5 mM glutamine as the nitrogen source and 3% sucrose as the carbon source (Gardiner et al., 2009). In total 96 different compounds were screened in PM plates PM21A, PM22, PM24A and PM25 from Biolog (CA, USA). Full tables of compounds present in these plates can be found at www.biolog.com. Macroconidia for inoculation were produced as described by Stephens et al. (2008). OD600 was
used as a measure of fungal growth.
Chemical sensitivity assays
Benalaxyl, BOA (2-benzoxazolinone), gramine and tryptamine were purchased from Sigma. Compounds were dissolved in dimethyl sulfoxide (benylazyl and BOA) or ethanol (gramine) at a concentration of 50 mg mL-1. Half strength potato dextrose agar plates containing the test compounds were prepared on the day of use from fresh preparations of the compounds added just prior to pouring. Final concentrations were 0.2 and 0.5 mg mL-1 with DMSO or ethanol added to control plates at the same final concentration in all treatments. Plates were spot inoculated with 5 μL of spore suspensions prepared at 106, 105, 104 and 103 spores mL-1 using every second tip of an eight channel pipette. Parental and mutant strains were inoculated on opposite halves of the same plate. Plates were allowed to dry in a laminar flow cabinet, sealed with sealing film (PhytoTechnology Laboratories) and
Page 6 of 15 maintained in the dark at room temperature. Each assay was performed in triplicate and photographed 3 days post inoculation. Assays with benalaxyl were performed on two separate occasions with similar results.
Virulence assays
Root rot assays were performed and scored as previously described for
F. pseudograminearum (Gardiner et al., 2012). Wheat cultivar Kennedy and barley
cultivar Golden Promise were used. Both are highly susceptible to stem base infection. Stem base (crown rot) assays were conducted as previously described (Mitter et al., 2006) in a constant temperature (24°C) walk in growth chamber using fluorescent lighting (16/8 hours day/night) at the CSIRO Plant Industry containment facility. The susceptible wheat cultivar Kennedy was used. Barley was not tested as a host in these assays.
Gene expression analysis
Publically available gene expression data was accessed and analysed at www.plexdb.org. Experiments FG1, FG12, FG15 and FG19 (Güldener et al., 2006, Stephens et al., 2008, Lysøe et al., 2011, Zhang et al., 2012) were used. ABC-G subfamily members (19 in total) gene identifiers were extracted from the analysis conducted by Kovalchuk and Driessen (2010) and converted to probe set identifiers corresponding to the F. graminearum Affymetrix GeneChip using the mappings available from the F. graminearum database (FGDB) hosted by the Munich information center for protein sequences (Güldener et al., 2006). The expression data were extracted from the analysis at www.plexdb.org and exported to Microsoft Excel. Presented data represent the log transformed average of biological replicates. Heatmaps were generated using the conditional formatting options in Microsoft Excel and exported to Adobe Illustrator CS5.1 for annotation with the most recent gene identifier entries in FGDB.
Expression of FpABC1 in yeast
The FpABC1 cDNA was amplified from wheat root samples infected with
Page 7 of 15 (Supplementary Table 1) using Phusion DNA polymerase (Finnzymes). The PCR product was cloned into the HindIII and XbaI sites of the yeast expression plasmid pYES2 (Life Technologies). Yeast strains used were BY4743 (purchased from Life Technologies) and AD12345678 which lacks eight different PDR transporters (MATα,
PDR1–3, ura3, his1, Δsnq2::hisG, Δpdr5::hisG, Δpdr10::hisG, Δpdr11::hisG, Δycf1::hisG, Δpdr3::hisG, Δpdr15::hisG) (Decottignies et al., 1998). AD12345678 has
previously been used to characterise fungal ABC transporters (Zwiers et al., 2003, Del Sorbo et al., 2008). Strains were transformed as previously described (Gietz & Schiestl, 2007). Xenobiotic sensitivity assays were performed by growing overnight cultures of the yeast strains either containing an empty vector (pYES2) or FpABC1 construct in synthetic dropout media (Sigma) lacking uracil with glucose as a carbon source. Sensitivity to benalaxyl was assessed in BY4743 and other compounds in BY4743 and AD12345678. Overnight cultures were centrifuged (5000g 5 minutes),
washed twice in sterile water and resuspended to a final OD600 of 0.05 units in
synthetic dropout media lacking uracil with galactose as the carbon source. Compounds were dissolved in DMSO at either 50 (benalaxyl) or 100 mg mL-1 (BOA, gramine, tryptamine). Dilution series of compounds were created in a 96 well microtitre plates by consecutive 1.5 fold dilutions across the plates leaving the final column as DMSO control. Concentrations at which there was approximately 90% inhibition of growth of the vector alone containing strains compared to DMSO control were used to determine whether the FpABC1 could impart resistance to the test compound. Each well of the microtitre plate contained 200 μL of media with DMSO at a final concentration of 4% (v/v). Plates were incubated at 28°C for 3 (BOA, gramine and tryptamine) or 4 (benalaxyl) days prior to reading OD600 using an iEMS
plate reader (Thermo Fisher).
Results and Discussion
FgABC1 is a member of an ABC transporter family that in other
Fusaria is important for virulence
FgABC1 encodes a 1,489 amino acid protein that contains the conserved domains
Page 8 of 15 Organisation scheme for classification of ABC transporters, FgABC1 belongs to the ABC-G subfamily, a class often associated with pleiotropic drug resistance (Kovalchuk & Driessen, 2010). BLASTp searches (Altschul et al., 1997) of the non-redundant database of the National Center for Biotechnology Information (NCBI) using the FgABC1 as a query indicated that FgABC1 shares 90% amino acid sequence identity with the predicted protein Gpabc1 of F. sambucinum, which has a role in virulence on potato and resistance to the phytoalexin rishitin (Fleißner et al., 2002) and 80% amino acid sequence identity with NhABC1 from F. solani that is required for virulence on pea and tolerance to the phytoalexin pisitin (Coleman et al., 2011). FgABC1 also has 62% amino acid sequence identity to the ABC1 transporter of
Magnaporthe grisea, which is required for pathogenicity on rice (Urban et al., 1999).
However, there are matches to ABC transporters of non-pathogens with similar levels of sequence identity. A region of FgABC1 (aa residues 1123 to 1487) has 95% amino acid sequence identity to a partial protein sequence from F. culmorum that corresponds to a partially-characterised gene termed FcABC1, which has has a role in aggressiveness in FHB (Skov et al., 2004). As the complete sequence of FcABC1 is not available, the full extent of amino acid sequence identity to FgABC1 cannot be determined. Nonetheless, taken together, these sequence comparisons would suggest that FgABC1 falls within a group of transporter genes related in sequence, some of which have demonstrated roles in virulence towards plants. Coleman et al. (2011) also demonstrated that FgABC1, GpABC1 and NhABC1 form a
Fusarium-specific clade of ABC transporters. Interestingly, FgABC1 is located towards
one end of chromosome 2 in an area of high SNP density and it has been suggested that these regions are enriched in genes involved in virulence and may be evolving more quickly compared to genes in other parts of the genome (Cuomo et al., 2007).
FgABC1 is important for disease of wheat but not barley
The homology of FgABC1 to transporters from other Fusaria that contribute to pathogen virulence suggested that FgABC1 may also be important in diseases caused by F. graminearum. To test for this role, the FgABC1 gene was deleted and replaced with a hygromycin selectable marker gene by homologous recombination (Fig. 1). Using PCR for verification, independent homologous recombinant mutants for
Page 9 of 15
FgABC1 were obtained (Fig. 1). No obvious defects in conidiation or perithecia
formation were observed in any of the three independent FgABC1 mutants and each of these mutants had similar radial growth rates on either defined synthetic nutrient poor (SNA) or complete (V8 juice) nutrient agar medium when compared to wild type (Fig. 1). To test the role of FgABC1 in plant disease, an assay using root inoculation was used. Shoot elongation after six days was used as a measure of disease severity. The assay showed a clear role for FgABC1 in disease on wheat, but this was not observed when barley was used as the host (Fig. 2). The wheat and barley assays presented in Fig. 2 are from plants inoculated at the same time from the same inoculum source indicating that the mutation in FgABC1 does not affect general virulence of F. graminearum per se, but rather specifically affects wheat infection. Similarly, a specific role in wheat head infection, but not barley, was observed for the F. culmorum transporter FcABC1 (Skov et al., 2004), suggesting that FgABC1 and FcABC1 may be orthologous and transport an unidentified compound either uniquely produced by wheat or a fungal compound only required for infection of wheat. In addition, a role for FgABC1 in virulence towards wheat was demonstrated using an independent stem base infection assay (Fig. 3). Production of specific phytoalexins is typically restricted to individual species of plants which could explain the difference observed between the importance of FgABC1 during wheat and barley infection. Taken together these results indicate that the importance of FgABC1 for virulence is not restricted to a specific plant tissue type and that the role of FgABC1 in virulence is likely to be similar to those of other transporters in this class in other fungi described in the introduction.
FgABC1 is likely to exert its function late in disease processes
ABC-G family transporters are typically involved in PDR. To determine the point(s) in infection at which FgABC1 acts, the expression of FgABC1 was analysed using publically available Affymetrix microarray data for FCR on wheat (Stephens et al., 2008), FHB on barley and wheat (Güldener et al., 2006, Lysøe et al., 2011) and during infection of coleoptiles of wheat (Zhang et al., 2012). FgABC1 was highly expressed in all four interactions (Fig. 4). One of the technical challenges of analysing fungal gene expression during infection is the non-homogeneous nature of the material being
Page 10 of 15 analysed. That is, some fungal cells will be at the leading edge of an infection and these will most likely have a different gene expression profile compared to cells behind the invasive hyphae. The experiment conducted by Zhang et al. (2012), where gene expression during coleoptile invasion was analysed in developmentally synchronous material, provided a high resolution representation of the phasic nature of the infection process. FgABC1 expression was highest at 64 and 240 hours post inoculation, coinciding with highly destructive colonisation of the host (Fig. 4). Slightly higher expression was also observed later in the FCR on wheat and during the middle to later time points of the FHB time courses on wheat and barley (Fig. 4). These time points are concomitant with extensive visual symptom development, which in FHB is much shorter than FCR (Mudge et al., 2006). Taken together, these data indicate that FgABC1 most likely exerts its function late in the infection of all tissue types. Given ABC-G family transporters are involved in the transport of xenobiotics, the expression of all 19 ABC-G transporters in F. graminearum was analysed (Fig. 4). Most family members appeared to have similar expression dynamics in each of the four experiments despite the different host and tissue types (Fig. 4). This suggests that the F. graminearum program of pathogenesis on different tissues, at least in part, shares many commonalities despite very different rates of disease symptom expression. A number of other ABC-G family transporters were highly expressed during infection (e.g. FGSG_08309 and FGSG_16825) and these may also have roles in F. graminearum virulence.
FgABC1 is important for resistance to xenobiotics but not known
grass defence molecules
Transporters within the ABC family have been reported to transport a range of compounds and PDR-type transporters often provide protection to cells by via efflux of toxic compounds (Gulshan & Moye-Rowley, 2007, Kretschmer et al., 2009). As a primary screen for a role in resistance to toxic compounds, the phenotype array system (Biolog, CA, USA) was used to identify potential substrates. The compound benalaxyl had a strong inhibitory effect on a selected mutant (ΔFgABC1.4) when compared to wild type in this primary screen (data not shown). Salicylanilide also was identified in the primary screen as showing differences between the mutant and
Page 11 of 15 wild type but subsequent assays revealed both the wild type and mutant were highly sensitive to this compound (data not shown). The inhibitory effect when the mutant was grown on benalaxyl was confirmed using a drop inoculation on half-strength potato dextrose agar (Fig. 5). Benalaxyl is a commercial systemic acylanilide fungicide primarily used against Oomycete pathogens in horticultural crops, but it also has some inhibitory activity against Ascomycete fungi (Meneau & Sanglard, 2005). Benalaxyl is not known to have a structural equivalent in plants, but these findings demonstrate that FgABC1 provides protection against antimicrobial compounds. To test a role for FgABC1 in transporting putative grass defence compounds, spore droplet germination assays were also performed against the wheat compound 2-benzoxazolinone (BOA), the barley compound gramine and the more widely distributed tryptamine (Smith, 1977, Niemeyer, 2009). These compounds were not present in the phenotype arrays. While F. graminearum appears moderately sensitive to all three compounds, the FgABC1 mutant and parental strain showed no differential sensitivity (Fig. 5). Whilst the virulence assays clearly show a role for FgABC1 during disease and the in vitro assays suggested BOA, gramine and tryptamine were not the targets of FgABC1, there remained the possibility that in the less complex in vitro environment alternative detoxification mechanisms, such as other PDR transporters may provide sufficient tolerance to these compounds. To rule this out the F. pseudograminearum homologue of FgABC1 was expressed in yeast under the control of the galactose inducible promoter GAL1. Whilst FpABC1 was able to impart increased resistance to benalaxyl in a wild type yeast background (Fig. 6), this gene could not provide increased tolerance to BOA, gramine or tryptamine in either a wild type strain (data not shown), or the PDR mutant strain AD12345678 which lacks eight different PDR transporters (Decottignies et al., 1998) (Fig. 6).
Currently, the function that FgABC1 plays in disease development is unknown. Fungal toxins can be exported from fungal plant pathogens by ABC transporters (eg Gardiner et al., 2005) and it has also been shown that the PDR transporter of yeast, Pdr5p, is able to export the Fusarium toxin deoxynivalenol, a known virulence factor (Mitterbauer & Adam, 2002). FgABC1 is unlikely to be involved in deoxynivalenol efflux as this is mediated by a major facilitator protein TRI12 (Alexander et al., 1999).
Page 12 of 15 Wheat can produce a large spectrum of molecules with potential antimicrobial activity (Moraes et al., 2008). The production of defence metabolites in barley roots has been shown to be induced by F. graminearum (Lanoue et al., 2010) and wheat genes that encode enzymes involved in secondary metabolism that can potentially produce defence metabolites are also transcriptionally induced during FCR (Desmond et al., 2008). Likewise the entire tryptophan pathway including a final step converting tryptophan to tryptamine is up regulated during the mid to late phases of barley FHB (Boddu et al., 2006). It is therefore probable that FgABC1 protects the fungus from specific host defence molecules. Future work should focus on assessing the relative sensitivity of the ΔFgABC1 deletion mutants to specific wheat metabolites produced during infection. However, at present there appears to be a dearth of information surrounding phytoalexins produced by wheat.
Acknowledgements
AES acknowledges the support of a CSIRO/IMB postgraduate scholarship. DMG and ALM acknowledge support from the Australian Research Council (DP0985486 and DP110100389, respectively). DMG was also supported by the Australian Grains Research and Development Corporation. We thank Andrew Beacham, Rothamsted Research, UK for the kind gift of pHYG4.1 and Professor Frederick Roth, University of Toronto, for providing yeast strains AD12345678.
References
Akinsanmi OA, Backhouse D, Simpfendorfer S & Chakraborty S (2006) Genetic diversity of Australian Fusarium graminearum and F. pseudograminearum. Plant
Pathol. 55: 494-504.
Alexander NJ, McCormick SP & Hohn TM (1999) TRI12, a trichothecene efflux pump from Fusarium sporotrichioides: gene isolation and expression in yeast. Mol.
Gen. Genet. 261: 977-984.
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389-3402.
Beccari G, Covarelli L & Nicholson P (2011) Infection processes and soft wheat response to root rot and crown rot caused by Fusarium culmorum. Plant Pathol. 60: 671-684.
Page 13 of 15 Boddu J, Cho S, Kruger WM & Muehlbauer GJ (2006) Transcriptome analysis of the barley-Fusarium graminearum interaction. Mol. Plant-Microbe Interact. 19: 407-417. Burgess LW, Backhouse D, Summerell BA & Swan LJ (2001) Crown rot of wheat.
Fusarium, (Summerell BA, Leslie JF, Backhouse D, Bryden WL & Burgess LW,
eds.), pp. 271-294. APS Press, St Paul, MN, USA.
Coleman JJ & Mylonakis E (2009) Efflux in fungi: la pièce de résistance. PLoS
Pathog. 5: e1000486.
Coleman JJ, White GJ, Rodriguez-Carres M & VanEtten H (2011) An ABC transporter and a cytochrome P450 of Nectria haematococca MPVI are virulence factors on pea and are the major tolerance mechanisms to the phytoalexin pisatin.
Mol. Plant-Microbe Interact. 24: 368-376.
Cuomo CA, Güldener U, Xu J-R, et al. (2007) The Fusarium graminearum genome reveals a link between localized polymorphism and pathogen specialization. Science 317: 1400-1402.
de Hoogt R, Luyten WH, Contreras R & De Backer MD (2000) PCR- and ligation-mediated synthesis of split-marker cassettes with long flanking homology regions for gene disruption in Candida albicans. BioTechniques 28: 1112-1116.
Decottignies A, Grant AM, Nichols JW, de Wet H, McIntosh DB & Goffeau A (1998) ATPase and multidrug transport activities of the overexpressed yeast ABC protein Yor1p. J. Biol. Chem. 273: 12612-12622.
Del Sorbo G, Ruocco M, Schoonbeek H-j, Scala F, Pane C, Vinale F & De Waard MA (2008) Cloning and functional characterization of BcatrA, a gene encoding an ABC transporter of the plant pathogenic fungus Botryotinia fuckeliana (Botrytis
cinerea). Mycol. Res. 112: 737-746.
Desmond OJ, Manners JM, Schenk PM, Maclean DJ & Kazan K (2008) Gene expression analysis of the wheat response to infection by Fusarium
pseudograminearum. Physiol. Mol. Plant Pathol. 73: 40-47.
Desmond OJ, Manners JM, Stephens AE, et al. (2008) The Fusarium mycotoxin deoxynivalenol elicits hydrogen peroxide production, programmed cell death and defence responses in wheat. Mol. Plant Pathol. 9: 435-445.
Dyer AT, Johnston RH, Hogg AC & Johnston JA (2009) Comparison of pathogenicity of the Fusarium crown rot (FCR) complex (F. culmorum, F.
pseudograminearum and F. graminearum) on hard red spring and durum wheat. Eur. J. Plant Pathol. 125: 387-395.
Fairhead C, Llorente B, Denis F, Soler M & Dujon B (1996) New vectors for
combinatorial deletions in yeast chromosomes and for gap-repair cloning using 'split-marker' recombination. Yeast 12: 1439-1457.
Fleißner A, Sopalla C & Weltring K-M (2002) An ATP-binding cassette multidrug-resistance transporter is necessary for tolerance of Gibberella pulicaris to
phytoalexins and virulence on potato tubers. Mol. Plant-Microbe Interact. 15: 102-108.
Gardiner DM, Jarvis RS & Howlett BJ (2005) The ABC transporter gene in the sirodesmin biosynthetic gene cluster of Leptosphaeria maculans is not essential for sirodesmin production but facilitates self-protection. Fungal Genet. Biol. 42: 257-263. Gardiner DM, Kazan K & Manners JM (2009) Nutrient profiling reveals potent inducers of trichothecene biosynthesis in Fusarium graminearum. Fungal Genet. Biol. 46: 604-613.
Gardiner DM, McDonald MC, Covarelli L, et al. (2012) Comparative pathogenomics reveals horizontally acquired novel virulence genes in fungi infecting cereal hosts.
Page 14 of 15 Gietz RD & Schiestl RH (2007) High-efficiency yeast transformation using the
LiAc/SS carrier DNA/PEG method. Nat. Protocols 2: 31-34.
Goswami RS & Kistler HC (2004) Heading for disaster: Fusarium graminearum on cereal crops. Mol. Plant Pathol. 5: 515-525.
Goswami RS, Xu J-R, Trail F, Hilburn K & Kistler HC (2006) Genomic analysis of host–pathogen interaction between Fusarium graminearum and wheat during early stages of disease development. Microbiology 152: 1877-1890.
Güldener U, Mannhaupt G, Munsterkotter M, et al. (2006) FGDB: a comprehensive fungal genome resource on the plant pathogen Fusarium graminearum. Nucl. Acids
Res. 34: D456-458.
Güldener U, Seong K-Y, Boddu J, et al. (2006) Development of a Fusarium
graminearum Affymetrix GeneChip for profiling fungal gene expression in vitro and in planta. Fungal Genet. Biol. 43: 316-325.
Gulshan K & Moye-Rowley WS (2007) Multidrug resistance in fungi. Eukaryot. Cell 6: 1933-1942.
Gupta A & Chattoo B, B. (2008) Functional analysis of a novel ABC transporter ABC4 from Magnaporthe grisea. FEMS Microbiol. Lett. 278: 22-28.
Jansen C, von Wettstein D, Schafer W, Kogel K-H, Felk A & Maier FJ (2005) Infection patterns in barley and wheat spikes inoculated with wild-type and
trichodiene synthase gene disrupted Fusarium graminearum. Proc. Natl. Acad. Sci.
USA 102: 16892-16897.
Kazan K, Gardiner DM & Manners JM (2012) On the trail of a cereal killer: recent advances in Fusarium graminearum pathogenomics and host resistance. Mol. Plant
Pathol. 13: 399-413.
Kovalchuk A & Driessen A (2010) Phylogenetic analysis of fungal ABC transporters.
BMC Genomics 11: 177.
Kretschmer M, Leroch M, Mosbach A, et al. (2009) Fungicide-driven evolution and molecular basis of multidrug resistance in field populations of the grey mould fungus
Botrytis cinerea. PLoS Pathog. 5: e1000696.
Lanoue A, Burlat V, Henkes GJ, Koch I, Schurr U & Röse USR (2010) De novo biosynthesis of defense root exudates in response to Fusarium attack in barley. New
Phytol. 185: 577-588.
Lysøe E, Seong K-Y & Kistler HC (2011) The transcriptome of Fusarium
graminearum during the infection of wheat. Mol. Plant-Microbe Interact. 24:
995-1000.
Meneau I & Sanglard D (2005) Azole and fungicide resistance in clinical and environmental Aspergillus fumigatus isolates. Med Mycol 43 Suppl 1: S307-311. Mitter V, Zhang MC, Liu CJ, Ghosh R, Ghosh M & Chakraborty S (2006) A high-throughput glasshouse bioassay to detect crown rot resistance in wheat germplasm.
Plant Pathol. 55: 433-441.
Mitterbauer R & Adam G (2002) Saccharomyces cerevisae and Arabidopsis thaliana: useful model systems for the identification of molecular mechanisms involved in resistance of plants to toxins. Eur. J. Plant Pathol. 108: 699-703.
Moraes MCB, Birkett MA, Gordon-Weeks R, et al. (2008) cis-Jasmone induces accumulation of defence compounds in wheat, Triticum aestivum. Phytochemistry 69: 9-17.
Mudge AM, Dill-Macky R, Dong Y, Gardiner DM, White RG & Manners JM (2006) A role for the mycotoxin deoxynivalenol in stem colonisation during crown rot disease of wheat caused by Fusarium graminearum and Fusarium
Page 15 of 15 Niemeyer HM (2009) Hydroxamic acids derived from 2-hydroxy-2H-1,4-benzoxazin-3(4H)-one: key defense chemicals of cereals. J. Agric. Food Chem. 57: 1677-1696. Schoonbeek H, Del Sorbo G & De Waard MA (2001) The ABC transporter BcatrB affects the sensitivity of Botrytis cinerea to the phytoalexin resveratrol and the fungicide fenpiclonil. Mol. Plant-Microbe Interact. 14: 562-571.
Skov J, Lemmens M & Giese H (2004) Role of a Fusarium culmorum ABC transporter (FcABC1) during infection of wheat and barley. Physiol. Mol. Plant
Pathol. 64: 245-254.
Smith TA (1977) Tryptamine and related compounds in plants. Phytochemistry 16: 171-175.
Stefanato FL, Abou-Mansour E, Buchala A, et al. (2009) The ABC transporter BcatrB from Botrytis cinerea exports camalexin and is a virulence factor on Arabidopsis
thaliana. Plant J 58: 499-510.
Stephens AE, Gardiner DM, White RG, Munn AL & Manners JM (2008) Phases of infection and gene expression of Fusarium graminearum during crown rot disease of wheat. Mol. Plant-Microbe Interact. 21: 1571–1581.
Stergiopoulos I, Zwiers L-H & De Waard MA (2003) The ABC transporter MgAtr4 is a virulence factor of Mycosphaerella graminicola that affects colonization of
substomatal cavities in wheat leaves. Mol. Plant-Microbe Interact. 16: 689-698. Urban M, Bhargava T & Hamer JE (1999) An ATP-driven efflux pump is a novel pathogenicity factor in rice blast disease. EMBO J 18: 512-521.
Walter S, Nicholson P & Doohan FM (2010) Action and reaction of host and pathogen during Fusarium head blight disease. New Phytol. 185: 54-66. Wang Y, Lim L, DiGuistini S, Robertson G, Bohlmann J & Breuil C (2012) A specialized ABC efflux transporter GcABC-G1 confers monoterpene resistance to
Grosmannia clavigera, a bark beetle-associated fungal pathogen of pine trees. New Phytol. 197: 886-898.
Zhang X-W, Jia L-J, Zhang Y, Jiang G, Li X, Zhang D & Tang W-H (2012) In planta stage-specific fungal gene profiling elucidates the molecular strategies of Fusarium
graminearum growing inside wheat coleoptiles. Plant Cell 24: 5159-5176.
Zwiers LH, Stergiopoulos I, Gielkens MMC, Goodall SD & De Waard MA (2003) ABC transporters of the wheat pathogen Mycosphaerella graminicola function as protectants against biotic and xenobiotic toxic compounds. Mol. Genet. Genomics 269: 499-507.
Figure 1: Generation of FgABC1 mutant strains. (A) Mutation strategy using split marker homologous recombination. Regions demarked by crossover lines represent the regions used in the targeting vector to facilitate homologous recombination. Primers for amplification of the targeting fragments are indicated with sequences available in Supplementary Table 1. R5’ and F3’ have homology to M13f and M13r respectively to allow PCR mediated fusion (B) Verification of FgABC1 deletion by multiplex PCR using one common primer and primers unique for either the deleted region (generating a parental-specific band) or the hygromycin cassette (generating a vector-parental-specific band). PCR fragments of 656 bp and 844 bp were predicted to be amplified from the wild type and mutant genomic DNA, respectively, and are shown in part A. An ectopic recombination would show both bands. Marker sizes are shown to the left for the sizes relevant to the PCR products. (C) Growth of the mutant strain ∆FgABC1.4 compared to that of the parental strain CS3005 on two different media, Synthetic Nutrient Poor Agar (SNA) and Campbells V8 juice agar (V8). Assays were conducted using daily radial growth measurements on 9 cm Petri dishes. Other mutants tested (∆FgABC1.2 and ∆FgABC1.5) also showed growth indistinguishable from the parental strain (data not shown).
Figure 2: Fusarium virulence assays performed on the FgABC1 mutants and the parental strain (CS3005) using direct root inoculation. (A and B) wheat cv Kennedy. (C and D) barley cv Golden Promise. A and C are quantitative measures of isolate virulence based on the seedling length 6 days after inoculation. Shorter shoot lengths indicate higher virulence. Images in B and D are taken 6 days post inoculation, a time at which the fungal colonization is well established. A decrease in virulence can be visually observed in B by the greater amount of plant shoot material in the mutant inoculated plants compared to the parental
strain. N = 16 with error bars representing the standard error of the mean. Letters indicate statistically significant differences in means (P value < 0.05).
Figure 3: Fusarium crown rot virulence assay performed on the FgABC1 mutants and the parental strain (CS3005) on wheat cultivar Kennedy. N = 25-30 individual plants. A higher disease index indicates higher levels of disease. Error bars represent the standard error of the mean. For ∆FgABC1.2 the P-value was 0.11 and for ∆FgABC1.4 and ∆FgABC1.5 the P-value was less than 0.01 in T-test comparisons with plants inoculated with the parental strain (CS3005). D ise a se i n d e x 0.0 0.2 0.4 0.6 0.8 1.0 C S3 0 0 5 (p a re n t) ΔF g ABC 1 .2 ΔF g ABC 1 .4 ΔF g ABC 1 .5
Figure 4: Time courses of expression of all F. graminearum genes encoding group G ABC transporters during infections of four different tissues and/or hosts. Red indicates high expression. Each experiment sampled at different time points and these are indicated across the bottom in either days post inoculation (dpi) or hours post inoculation (hpi). Data were extracted from experiments FG1, FG12, FG15 and FG19 deposited in www.plexdb.org. Values shown are the mean of 2 to 4 biological replicates, depending on the experiment.
FGSG_01388 FGSG_02847 FGSG_02870 FGSG_03882 FgABC1 FGSG_05076 FGSG_05589 FGSG_08027 FGSG_08309 FGSG_08312 FGSG_08830 FGSG_09329 FGSG_10706 FGSG_10935 FGSG_11240 FGSG_11272 FGSG_03735 FGSG_16825 FGSG_17395 FHB wheat FCR wheat FHB barley Coleoptile wheat 1 2 3 4 6 2 14 35 0 1 2 3 4 6 8 0 16 40 64 240 Time
Figure 5: The role of FgABC1 in efflux of xenobiotics. (A) Plates were spot inoculated with the indicated number of spores. The upper row in each image is the parental strain CS3005 and the lower row the FgABC1 mutant. Benalaxyl and 2-benzoxazolinone BOA were
dissolved in dimethyl sulfoxide (DMSO) and gramine in ethanol. Tryptamine was dissolved in DMSO but conducted as a separate experiment to other assays. The experiment was
conducted in triplicate with plates were photographed 3 days post inoculation and representative images shown.
Figure 6: Heterologous expression of FpABC1 in yeast under the control of the galactose inducible promoter GAL1. Data shown are for FpABC1 expressed in the wild type strain BY4743 for benalaxyl and the other compounds assayed in the PDR mutant AD12345678. Significant differences between the vector alone and FpABC1 expressing strains were only observed for benalaxyl treatment (P-value 0.002).
Bena laxy l BO A Gra min e Tryp tam ine O D6 0 0 0.0 0.1 0.2 0.3 0.4 0.5 0.6 pYES2 pYES2-FpABC1
Supplementary Table 1: Primers used to create the knock-out vector for FgABC1 gene deletion and verification and expression in yeast. Lowercase letters are used to indicate regions of homology for the generation of overlapping PCR products
Primer Name Primer Sequence Purpose
F5’ AATTCCCTCTCCTTTATGCACAAG Amplify 5’ flank of FgABC1. 1400 bp product.
R5’ gtcgtgactgggaaaaccctggcgTATGTTTGCGCTGCAAGACAG
F3’ tcctgtgtgaaattgttatccgctAACAACTTGAGAGCTCGCGC Amplify 3’ flank of FgABC1. 1495 bp product.
R3’ CCAATCTTGGGAAGAAGCTGC
M13f CGCCAGGGTTTTCCCAGTCACGAC Amplify 5’ half of hygromycin cassette from pHYG1.4
NLC38 CGTTGCAAAACCTGCCTGAA
NLC37 GGATGCCTCCGCTCGAAGTA Amplify 3’ half of hygromycin cassette from pHYG1.4
M13r AGCGGATAACAATTTCACACAGGA
ABCKOscreenR AACAAAGGCAATGACGGAGT Common primer for knockout screening
ABCKOscreenF ACCACGTTTAATCCCACCAA Wild type specific primer for knockout screening. Generates 656 bp product from the native locus with ABCKOscreenR
HygR CGGTGAGTTCAGGCTTTTTC Vector specific primer for knockout screening. Generates 844 bp product with ABCKOscreenR FpABC1f GCTAAGCTTGTCTTGCAGCGCAAACATAA Amplification of FpABC1 full length cDNA
