De invloed van bias op de keuze van een middelbare school leraar om deel te nemen aan onderwijsverandering : een onderzoek naar de invloed van onderbuikgevoelens op het maken van keuzes

However, to the extent that it would be possible to operate a department store or a manufacturing plant by capi- talizing the enterprise with deductible

Web content mining though uses data mining techniques; it differs from data mining because Web data are mostly unstructured and/or semi-structured, while data mining deals

Mechanical cues can stimulate the expression of an osteogenic phenotype, enhance matrix and mineral deposition, and infl uence tissue organization to improve the functional

With transfection of miR-21 inhibitor, the expression of α-SMA and vimentin get a significant decrease and the expression of E-cadherin get a significant increase

Histopathological changes in tibiotarsal joints (10X magnification) A- Normal control, B- Arthritis control, C- Diclofenac treated group, D- FCP treated group. Histopathological

The common cold was defined by the presence of at least two of the following 10 symptoms: sneezing, rhinorrhoea, nasal congestion, headache, myalgia, throat

PDGFRA EXON PRIMER DOG1 EXON PRIMER EXON 1 FORWARD gccccattgattctttcatc EXON 1 FORWARD cggaaaatctgaccggcg EXON 1 REVERSE aactgccactggagagcatt EXON 1 REVERSE tgagctcttggttgggctc EXON

Urai Mathirai Preprocess coarse powder, polyvinyl pyrrolidone (sigma), Talc (sigma), all other reagents were obtained from Siddha Central Research Institute,