Roman Franiczek, Barbara Krzyżanowska, Izabela Dolna,
Grażyna Mokracka-Latajka
Conjugative Transfer of Plasmid-Mediated CTX-M-Type
β-Lactamases from Clinical Strains
of
Enterobacteriaceae
to
Salmonella enterica
Serovars
Transfer koniugacyjny kodowanych plazmidowo
β-laktamaz CTX-M ze szczepów klinicznych
Enterobacteriaceae
do serowarów
Salmonella enterica
Department of Microbiology, Wroclaw Medical University, Poland
Abstract
Objectives. The aim of the study was to evaluate the transfer frequency of plasmid-mediated extended-spectrum β-lactamases (ESBLs) from clinical isolates of Enterobacteriaceae to Salmonella enterica and Escherichia coli K12 C600 recipient strains. Moreover, the susceptibility to selected antibiotics and chemotherapeutics of the donor strains and transconjugants obtained in the mating experiments was estimated.
Material and Methods. Ten ESBL-positive clinical isolates, including Escherichia coli, Klebsiella pneumoniae,
Citrobacter freundii, Enterobacter cloacae, and Serratia marcescens (two strains of each species) were used as donor
strains. Salmonellaenterica serovar Enteritidis (S. Enteritidis), S. Virchow, S. Hadar, and E. coli K12 C600 were used as recipient strains. ESBL production in donor strains and transconjugants was detected by the double disk synergy test (DDST). Transfer of ESBL-encoding plasmids was performed by a liquid conjugational method. The minimal inhibitory concentrations (MICs) of antibacterial drugs were determined by an agar dilution technique on Mueller-Hinton agar. The presence of the blaCTX-M gene in donor strains and transconjugants was determined
by PCR.
Results. A total of 40 conjugation crosses between donor and recipient strains were performed. Transconjugants were obtained in twenty-seven (67.5%) of them. E. coli K12 C600 strain was found to be the best recipient. It acquired plasmid-mediated ESBL from all of the donor strains tested. Among Salmonella enterica recipients, S. Enteritidis and S. Infantis acquired ESBL-encoding genes from 9 and 7 donor strains respectively, whereas S. Hadar acquired this gene from a single donor strain only. The effectiveness of conjugational transfer ranged from 10–6
to 10–1 per donor cell. The donor strains and their transconjugants displayed resistance patterns typical of ESBL
producers. They were uniformly resistant to cefotaxime and ceftriaxone but susceptible to carbapenems, tigecycline and oxyimino-β-lactams in combination with clavulanic acid. In addition, resistance to gentamicin, amikacin and co-trimoxazole was, in many cases, co-transferred with oxyimino-β-lactam resistance to recipients by means of conjugation. The MIC values of cefotaxime and ceftriaxone were higher than those of ceftazidime. PCR results revealed the presence of the blaCTX-M gene in all donor strains and their transconjugants.
Conclusions. The results of the study demonstrated the differences in conjugational acquisition of the blaCTX-M
gene among the Salmonella enterica serovars studied. Of the S. enterica strains, Salmonella enterica serovar Enteritidis was found to be the best recipient of plasmid-mediated CTX-M-type β-lactamases (Adv Clin Exp Med 2010, 19, 3, 313–322).
Key words: Salmonella, ESBL, CTX-M.
Streszczenie
Cel pracy. Określenie częstości przekazywania plazmidowo kodowanych β-laktamaz o rozszerzonym spektrum substratowym (ESBL) z klinicznych szczepów Enterobacteriaceae do szczepów biorców Salmonella enterica
i Escherichia coli K12 C600. Określono ponadto wrażliwość na wybrane antybiotyki i chemioterapeutyki szczepów
dawców i transkoniugantów uzyskanych w krzyżówkach. Adv Clin Exp Med 2010, 19, 3, 313–322
ISSN 1230-025X
ORIGINAL PAPERS
Nontyphoidal Salmonella enterica subsp.
enterica serovars are considered the leading cause
of food-borne gastroenteritis, but severe extraint-estinal infections, such as bacteremia, meningitis and osteomyelitis have also been reported [1]. Currently, the Salmonella genus includes more then 2.500 different serovars, however the majori-ty of human infections are caused by a very limited number of them. In European countries, the most common Salmonella serovar involved in human infections is S. Enteritidis responsible for 79-84% of salmonellosis, followed by S. Typhimurium, S. Hadar, S. Virchow and S. Infantis [2]. Although the antibiotic therapy is not recommended for treatment of self-limiting Salmonella gastroen-teritis, it is required for systemic, life-threatening infections. In adults, fluoroquinolones are com-monly used as the drugs of first choice. In pedi-atric patients, however, these antimicrobials are contraindicated. For this reason, third-genera-tion cephalosporins (3GC) such as ceftriaxone and cefotaxime are preferentially used to treat extraintestinal salmonellosis [3–5]. The extensive clinical utilization of 3GC has been responsible for the emergence of Salmonella strains exhibiting oxyimino-β-lactam resistance due to the expres-sion of plasmid-mediated extended-spectrum β-lactamases (ESBLs) and/or β-lactamases derived from the chromosome-encoded class C enzymes, such as CMY-2 [6, 7]. The first ESBL-producing
Salmonella strains have been isolated in the late
1980s [8]. Since then, they have been identi-fied in many countries worldwide. Although the prevalence of ESBL-positive Salmonella isolates
is relatively rare compared to the other members of the family Enterobacteriaceae, it has increased considerably in recent years. Salmonellae have been found to produce a vide variety of ESBLs including: TEM-, SHV-, CTX-M- as well as PER-type enzymes [4, 7, 9–14]. ESBL-encoding genes are usually carried by transferable plasmids and/ or mobile genetic elements, which contributes to their rapid dissemination among Gram-negative rods, particularly by means of conjugation [15, 16]. In addition, these conjugative plasmids often con-tain genes conferring resistance to non-β-lactam antimicrobial agents, such as aminoglycosides, tet-racycline, co-trimoxazole leading to the limitation of therapeutical options [17, 18].
The data concerning the acquisition of ESBL-encoding genes by different serovars of Salmonella
by mean of conjugation are very scarce. Thus, the aim of the study was to evaluate the trans-fer frequency of oxyimino-β-lactam resistance from ESBL-producing isolates to three serovars
of Salmonella enterica (S. Enteritidis, S. Virchow,
S. Hadar) and the E. coli K12 C600 reference strain. In addition, the in vitro antimicrobial susceptibility of donor strains and their transconjugants was studied.
Material and Methods
Bacterial Strains
Ten ESBL-producing clinical isolates of the
Enterobacteriaceae family including: Escherichia
coli, Klebsiella pneumoniae, Citrobacter freundii,
Enterobacter cloacae and Serratia marcescens (two
Materiał i metody. W badaniach zastosowano 10 izolatów klinicznych wytwarzających ESBL w charakterze dawców: Escherichia coli, Klebsiella pneumoniae, Citrobacter freundii, Enterobacter cloacae i Serratia marcescens (2 szczepy z każdego gatunku). Szczepy Salmonellaenterica serowar Enteritidis (S. Enteritidis), S. Virchow, S. Hadar
i E. coli K12 C600 użyto w charakterze biorców. ESBL wykrywano testem synergizmu dwóch krążków (DDST).
Przekazywanie plazmidów kodujących ESBL przeprowadzono za pomocą metody koniugacji w podłożu płynnym. Minimalne stężenia hamujące (MIC) leków przeciwbakteryjnych oznaczono metodą seryjnych rozcieńczeń w podłożu agarowym Mueller-Hintona. Występowanie genu blaCTX-M w szczepach dawców i transkonjugantach
oznaczono metodą PCR.
Wyniki. Ogółem wykonano 40 krzyżówek koniugacyjnych między szczepami dawców i biorców. Transkoniuganty otrzymano w 27 (67,5%) krzyżówkach. Najlepszym biorcą okazał się szczep E. coli K12, który nabył plazmido-wo kodowane ESBL od wszystkich badanych szczepów dawców. Wśród biorców Salmonella enterica, serowary
S. Enteritidis and S. Infantis nabyły geny kodujące ESBL odpowiednio od 9 and 7 szczepów dawców, a serowar
S. Hadar nabył ten gen tylko od jednego szczepu donorowego. Skuteczność koniugacji wynosiła od 10–6 do 10–1
w przeliczeniu na komórkę dawcy. Szczepy dawców oraz ich transkoniuganty odznaczały się typowymi dla produ-centów ESBL wzorcami oporności. Były one oporne na cefotaksym i ceftriakson, wrażliwe natomiast na karbap-enemy, tigecyklinę i oksyimino-β-laktamy skojarzone z kwasem klawulanowym. Ponadto, w wielu przypadkach oporność na gentamycynę, amikacynę i kotrimoksazol była przekazywana na drodze koniugacji wraz z opornością na oksyimino-β-laktamy. Wartości MIC dla cefotaksymu i ceftriaksonu były większe w porównaniu z wartościami MIC dla ceftazydymu. Wyniki badań PCR wykazały obecność genu blaCTX-M u wszystkich szczepów dawców oraz
ich transkoniugantów.
Wnioski. Wyniki badań wykazały różnice w koniugacyjnym nabywaniu genu blaCTX-M wśród badanych serowarów
Salmonellaenterica. Spośród badanych szczepów S. enterica najlepszym biorcą plazmidowo kodowanych β-laktamaz
strains of each species) were used in the study as donor strains. The isolates were collected from patients hospitalized in the intensive care unit of the University Hospital (Wrocław, Poland) dur-ing a 2-year period (2007–2008). Species identifi-cation of the strains was done by the ATB auto-mated identification system (bioMérieux, France).
E coli K12 C600 reference strain and three serovars
of Salmonellaenterica including: S. Enteritidis, S.
Virchow and S. Hadar were used as recipients in mating experiments. The Salmonella strains were isolated from 2003 to 2005 in the Country Sanitary-Epidemiological Station in Wrocław (Poland), and identified by standard method [19].
Antibiotic Susceptibility Testing
The MIC of antimicrobial agents was deter-mined by an agar dilution technique on Mueller-Hinton agar (Oxoid) according to the CLSI rec-ommendations [20]. The MIC values of oxyimino-β-lactams (aztreonam, cefotaxime, ceftazidime and ceftriaxone) were determined alone and in a fixed concentration of clavulanic acid (2 mg/l). The inoculum was 104 cfu per spot deposited on
the Mueller-Hinton agar. The MIC was defined as the lowest concentration of the drug that inhib-its visible growth after 16–18 hours of incubation at 35oC. E. coli strains ATCC 25922 and ATCC
35218 were used as the quality reference strains. Standard powders of antimicrobials tested were obtained from the following suppliers: aztreon-am (Bristol-Myers Squibb), ceftazidime (Glaxo Wellcome), ceftriaxone (Hoffmann-La Roche Inc.), amikacin, cefotaxime, gentamicin (Sigma Chemical Co.), imipenem (Merck Sharp & Dohme Research), meropenem (Zeneca), lithium clavu-lanate (GlaxoSmithKline Pharma), co-trimoxazole (Polfa Tarchomin), tigecycline (Wyeth).
ESBL Production
ESBL production was determined by the double disk synergy test (DDST) according to Jarlier et al. [21]. This test was performed by placing disks of cef-tazidime, cefotaxime and aztreonam (30 μg each) at a distance of 20 mm (center-to-center) from a disk containing amoxicillin with clavulanic acid (20 and 10 μg, respectively). The strains that showed synergy between oxyimino-β-lactams and clavulanic acid were considered to produce ESBL enzymes.
Transfer of Oxyimino-β-lactam
Resistance
Conjugational transfer of oxyimino-β-lactam resistance was performed with all ESBL-positive
isolates (resistant to ceftazidime and/or cefotaxime but susceptible to nalidixic acid) using the mixed broth method. The recipient strains were resistant to nalidixic acid but susceptible to all antimicrobi-als used in the susceptibility testing. Equal volumes (1 ml) of cultures of the donor and the recipient strains (109 cfu), grown in nutrient broth (Difco)
were mixed and incubated for 24 hours at 37oC.
Transconjugants were selected on MacConkey agar (Biomed) supplemented with nalidixic acid (64 mg/l) (Chinoin) to inhibit the growth of donor strains, and ceftazidime or cefotaxime (4 mg/l) to inhibit the growth of recipient strain. Transfer frequency of oxyimino-β-lactam resistance was expressed as the number of transconjugants cfu relative to the number of recipient cfu after the mating period.
Plasmid DNA Preparation
Plasmid DNA was extracted from donor strains and their transconjugants by the alkaline method with the Qiagen Plasmid Mini Kit (Qiagen) according to the manufacturer’s protocol.
PCR Amplification
of the bla
CTX-MDeterminant
Plasmid DNA preparations from donor strains and transconjugants were used as templates for the
blaCTX-M genes amplification. The oligonucleotide
primers specific for the blaCTX-M determinants
were: P1C (5’ –TCGTCTCTTCCAG– 3’) and P2D (5’ –CAGCGCTTTTGCCGTCTAAG– 3’).
PCR reactions were carried on in T3 thermo-cycler (Biometra GmbH, Gottingen, Germany). PCR conditions were: 3 min at 95oC, 30 cycles of
30 s at 95oC, 30 s at 55oC, and 30 s at 72oC, and
finally 3 min at 72oC [22]. The size of the PCR
products was approximately 1 kb.
Results
Conjugation Experiments
In the present study, the authors com-pared the effectiveness of conjugational trans-fer of plasmid-borne genes coding for ESBLs
to Salmonella enterica recipients belonging to
three serovars: S. Enteritidis, S. Virchow, and
S. Hadar. Additionally, the E. coli K12 C600 strain was used as the reference recipient. Ten ESBL- -positive clinical isolates including: Escherichia
coli, Klebsiella pneumoniae, Enterobacter cloacae,
Citrobacter freundii and Serratia marcescens (two
A total of 40 conjugation crossings were car-ried out. Transconjugants were obtained for twenty seven (67.5%) of them (Table 1). Among
Salmonella recipients tested, serovars S. Enteritidis
and S. Virchow acquired plasmid-mediated ESBLs from 9 and 7 donor strains respectively, with a frequency ranged from 1.5 × 10-6 to 5.1 × 10-1
per donor cell. In contrast, S. Hadar was practi-cally incapable of acquisition of plasmid-encoding ESBLs. The only exception was the cross with
E. coli 26 donor strain, which produced
transcon-jugants with a frequency of 3.1 × 10-5 per donor
cell. Using the reference strain E. coli K12 C600 as the recipient, transconjugants were obtained in all crosses with a frequency ranged from 1.5 × 10-6 to
5.8 × 10-1 per donor cell. Interestingly, the majority
of the donors studied (8/10) transferred plasmid-mediated genes coding for ESBLs to this recipient with a very high frequency of 10-2 to 10-1 per donor
cell. All transconjugants obtained in conjugational crossings displayed ESBL phenotype, which was confirmed by the conventional DDST.
Antimicrobial Susceptibility
of Donor Strains
The susceptibilities of the donor strains to the antimicrobial agents tested are summarized in Table 2. All these strains were fully resistant to cefotaxime (MIC range: 256 to > 1024 mg/l), ceftriaxone (MIC range: 256 to > 1024 mg/l) and aztreonam (MIC range: 32 to 256 mg/l). Moreover, all of them, with the exception two isolates, were susceptible to ceftazidime (MIC range: 2 to 32
mg/l). In all cases susceptibility to oxyimino-β-lactams was efficiently reversed (MIC: < 1 mg/l) in the presence of clavulanic acid at concentra-tion of 2 mg/l, confirming the expression of ESBL phenotype. In addition, all the donor strains were susceptible to imipenem and meropenem (MIC: < 1 mg/l). With regard to non-β-lactam antimicro-bials, the susceptibility testing gave the following results: all the donor strains were uniformly resis-tant to gentamicin, amikacin and co-trimoxazole (MIC: > 1024 mg/l) but susceptible tigecycline (MIC: < 1 mg/l).
Antimicrobial Susceptibility
of Transconjugants
The transconjugants obtained in mating exper-iments exhibited antibiotic resistance profiles simi-lar to those of their parental clinical isolates (Table 3). They were resistant to cefotaxime and ceftri-axone (MIC range: 128 to > 1024 mg/l) but sus-ceptible to imipenem, meropenem and oxyimino-β-lactams in combination with clavulanic acid (MIC: < 1 mg/l). Resistance to ceftazidime (MIC: 32 mg/l) and aztreonam (MIC range: 32 to 256 mg/l) was detected in 6 and 22 transconjugants, respectively. In all mating experiments resistance to gentamicin and amikacin (MIC range: 64 to > 1024 mg/l) was simultaneously transferred with oxyimino-β-lactam resistance, whereas resist-ance to co-trimoxazole (MIC 1024 – > 1024 mg/l) was found in 25 out of the 27 transconjugants. Similar to the donor strains, all transconjugants were uniformly susceptible to tigecycline (MIC < 1 mg/l).
Table 1. Transferfrequency of ESBL-encoding plasmids from donor strains (n = 10) to the E. coli K12 C600 and three Salmonella enterica serovars
Tabela 1. Częstość przekazywania plazmidów kodujących ESBL ze szczepów dawców (n = 10) do szczepu E. coli K12 C600 i trzech serowarów Salmonella enterica
Donor strainsa
(Szczepy dawcówa) Transfer frequency to recipient strains(Częstość transferu do szczepów biorców)
E. coli K12 C600 S. Enteritidis S. Virchow S. Hadar
Ec 26 Ec 42 Kp 36 Kp 41 Cf 8 Cf 933 En 70 En 938 Ser 242 Ser 278
1.5 × 10–1
1.5 × 10–1
5.8 × 10–1
3.8 × 10–1
2.9 × 10–1
5.4 × 10–2
1.6 × 10–1
2.8 × 10–1
2.4 × 10–6
1.5 × 10–6
4.9 × 10–4
3.1 × 10–5
1.2 × 10–4
1.5 × 10–3
5.7 × 10–5
1.1 × 10–2
1.5 × 10–6
2.5 × 10–1
6.9 × 10–2
–
1.8 × 10–3
1.6 × 10–3
2.0 × 10–5
1.6 × 10–6
– 8.5 × 10–6
– 1.5 × 10–2
5.1 × 10–1
–
3.1 × 10–5
– – – – – – – – –
aEc – Escherichia coli, Kp – Klebsiella pneumoniae, Cf – Citrobacter freundii, En – Enterobacter cloacae, Ser – Serratia
Detection of the
bla
CTX-MGene
On the basis of PCR amplification, all the donor strains and their transconjugants, but not recipients, were found to harbour the blaCTX-M
determinant (Fig. 1).
Discussion
The emergence of Salmonella enterica serov-ars exhibiting oxyimino-β-lactam resistance due to ESBLs poses an increasing clinical problem throughout the world [7, 11–13]. The conjuga-tional transfer of plasmid-mediated ESBLs occurs efficiently in intestinal tract where enteric rods, in particular Escherichia coli and Klebsiella spp., often act as the reservoir of self-transmissible plas-mids conferring resistance to third-generation cephalosporins. A good example supporting this phenomenon has been reported by Su et al. [12]. The authors described the in vivo transmission of plasmid-borne blaCTX-M-3 gene from E. coli to the
S. Anatum leading to the treatment failures and fatal sepsis eventually.
It has been shown previously that Salmonella
strains may act as donors of plasmid-mediated genes coding for ESBLs [9–12]. On the other hand, the reports concerning the ability of these microorganisms to acquire ESBL-encoding mark-ers by means of conjugation are very scarce. The results of the current study clearly showed a com-mon and very effective mechanism of ESBLs dis-semination among Gram-negative bacteria via
conjugation. Moreover, own findings revealed significant differences in acquisition of oxyimino-β-lactam resistance due to ESBLs synthesis among the Salmonellaenterica recipients studied.
S. Enteritidis was shown to be the best recipient. It acquired ESBL-encoding plasmids from 9 of the 10 donor strains, followed by S. Infantis. On the other hand, S. Hadar acquired ESBL-encoding determi-nants from a single donor strain only. These results are in agreement with data previously reported by Sarowska et al. [23].
The susceptibility test data showed that the ESBL-positive isolates (donors) were multiresist-ant strains, displaying resistance to most β-lactams and non-β-lactams. It should be emphasized that these strains as well as their transconjugants dem-onstrated significantly higher MIC values of cefo-taxime and ceftriaxone (MIC: 128 – > 1024 mg/l) than those of ceftazidime (MIC: 2 – 32 mg/l). These findings indicate that this resistance may result from cefotaximase activity (e.g., CTX-M-type
β-lactamases). In order to check this suggestion,
PCR was performed with P1C and P2D primers specific for CTX-M family of ESBLs. As expected, the blaCTX-M determinant was detected in all donor
strains studied and their transconjugants.
CTX-M-type β-lactamases emerged in the late 1980s, shortly after the introduction of cefo-taxime in clinical practice. The global expansion of the enzymes, however, was observed in the mid 1990s. CTX-M β-lactamases have been derived
Fig. 1. Agarose gel electrophoresis of PCR products in recipient, donor strains (A) and their transconjugants (B).
A. Lane M – DNA molecular-size markers. Lanes: 1 to 4 – recipient strains: S. Enteritidis, S. Virchow S. Hadar
and E. coli K12 C600, respectively. Lanes: 5 to 14 –
donor strains: E. coli 26; E. coli 42; K. pneumoniae 36;
K. pneumoniae 41; C. freundii 8, C. freundii 933; Ent.
cloacae 70; Ent cloacae 938; S. marcescens 242 and
S. marcescens 278, respectively.
B. Lanes: 1 to 27 – transconjugants: T Ec 26/K12 C600; T Ec 26/
Enteritidis;T Ec 26/Virchow; T Ec 26/Hadar;T Ec 42/K12 C600; T Ec 42/Enteritidis;
T Ec 42/Virchow; T Kp 36/K12 C600; T Kp 36/Enteritidis; T Kp 36/Virchow; T Kp
41/K12 C600; T Kp 41/Enteritidis; T Kp 41/Virchow; T Cf 8/K12 C600; T Cf 8/
Enteritidis; T Cf 933/K12 C600; T Cf 933/Enteritidis; T Cf 933/Virchow; T En 70/ K12 C600; T En 70/Enteritidis; T En 938/K12 C600; T En 938/Enteritidis; T En 938/
Virchow, T 242/K12 C600; T Ser 242/Enteritidis; T Ser 242/Virchow and T Ser
278/K12 C600, respectively
Ryc. 1. Elektroforeza w żelu agarozowym produktów PCR szczepów biorców, dawców (A) i ich transkoniu-gantów (B).
A. Ścieżka M – markery długości fragmentów DNA. Ścieżki: od 1 do 4 – szczepy biorców w kolejności: S. Enteritidis, S. Virchow S. Hadar and E. coli
K12 C600. Ścieżki: od 5 do 14 – szczepy dawców w kolejności: E. coli 26; E. coli 42; K. pneumoniae 36; K.
pneumoniae 41; C. freundii 8, C. freundii 933; Ent.
cloa-cae 70; Ent cloacae 938; S. marcescens 242 and
S. marcescens 278, respectively.
B. Ścieżki: od 1 do 27 – transkoniuganty w kolejności: T Ec 26/K12 C600; T Ec 26/Enteritidis;T Ec 26/Virchow; T Ec 26/Hadar;T Ec 42/K12 C600; T Ec 42/Enteritidis; T Ec 42/Virchow; T Kp 36/K12 C600; T Kp 36/Enteritidis;
T Kp 36/Virchow; T Kp 41/K12 C600; T Kp 41/Enteritidis; T Kp 41/Virchow; T Cf
8/K12 C600; T Cf 8/Enteritidis; T Cf 933/K12 C600; T Cf 933/Enteritidis; T Cf 933/
Virchow; T En 70/K12 C600; T En 70/Enteritidis; T En 938/K12 C600; T En 938/
Enteritidis; T En 938/Virchow, T 242/K12 C600; T Ser 242/Enteritidis; T Ser 242/
Table 2. MIC values (mg/l) of antibacterial agents for ESBL-positive donors strains (n = 10) Tabela 2. Wartości MIC (mg/l) leków przeciwbakteryjnych dla ESBL-dodatnich szczepów dawców (n = 10) Donor strains b (Szczepy daw -ców b) Antimicrobial agents a (Leki przeciwbakteryjne a) CAZ CAZ+Cla CTX CTX+Cla CRO CRO+Cla ATM ATM+Cla IPM MEM Gm An Sxt Tig Ec 26 4 < 1 512 < 1 1024 < 1 128 < 1 < 1 < 1 > 1024 > 1024 > 1024 < 1 Ec 42 2 < 1 > 1024 < 1 > 1024 < 1 32 < 1 < 1 < 1 > 1024 > 1024 > 1024 < 1 Kp 36 32 < 1 512 < 1 1024 < 1 256 < 1 < 1 < 1 > 1024 > 1024 > 1024 < 1 Kp 41 8 < 1 256 < 1 512 < 1 32 < 1 < 1 < 1 > 1024 > 1024 > 1024 < 1 Cf 8 8 < 1 256 < 1 512 < 1 32 < 1 < 1 < 1 > 1024 > 1024 > 1024 < 1 Cf 933 8 < 1 512 < 1 1024 < 1 64 < 1 < 1 < 1 > 1024 > 1024 > 1024 < 1 En 70 2 < 1 256 < 1 256 < 1 64 < 1 < 1 < 1 > 1024 > 1024 > 1024 < 1 En 938 4 < 1 256 < 1 256 < 1 32 < 1 < 1 < 1 > 1024 > 1024 > 1024 < 1 Ser 242 32 < 1 1024 < 1 512 < 1 256 < 1 < 1 < 1 > 1024 > 1024 > 1024 < 1 Ser 278 4 < 1 1024 < 1 1024 < 1 128 < 1 < 1 < 1 > 1024 > 1024 > 1024 < 1 aCAZ – ceftazidime, CTX – cefotaxime, CRO – ceftriaxone, ATM – aztreonam, IPM – imipenem, MEM – meropenem, Gm – gentamicin, An – amikacin, Sxt – co-trimoxazole, Tig – tigecycline, Cla – clavulanic acid at concentration of 2 mg/l. bSee footnote
a in
Table 1. aCAZ – ceftazydym, CTX – cefotaksym, CRO – ceftriakson, ATM – aztreonam, IPM – imipenem, MEM – meropenem, Gm – gentamycyna, An – amikacyna, Sxt – kotrimoksazol, Tig – tigecyklina, Cla – kwas klawulanowy w stężeniu 2 mg/l. bOdnośnik a w
tabeli
Table 3. MIC values (mg/l) of antibacterial agents for transconjugants (n = 27) obtained in mating experiments Tabela 3. Wartości MIC (mg/l) leków przeciwbakteryjnych dla transkoniugantów (n = 27) uzyskanych w krzyżówkach Transconjugants (T a)
(Transkoniuganty (Ta)
Antimicrobial agents (Leki przeciwbakteryjne) CAZ CAZ+Cla CTX CTX+Cla CRO CRO+Cla ATM ATM+Cla IPM MEM Gm An Sxt Tig
T Ec
26/K12 C600 4 < 1 512 < 1 1024 < 1 64 < 1 < 1 < 1 > 1024 1024 > 1024 < 1
T Ec
26/Enteritidis 4 < 1 256 < 1 512 < 1 32 < 1 < 1 < 1 > 1024 > 1024 > 1024 < 1
T Ec
26/Virchow 8 < 1 1024 < 1 1024 < 1 128 < 1 < 1 < 1 > 1024 1024 > 1024 < 1
T Ec
26/Hadar 8 < 1 1024 < 1 512 < 1 128 < 1 < 1 < 1 > 1024 > 1024 > 1024 < 1
T Ec
42/K12 C600 2 < 1 256 < 1 1024 < 1 32 < 1 < 1 < 1 > 1024 512 > 1024 < 1
T Ec
42/Enteritidis 4 < 1 512 < 1 256 < 1 128 < 1 < 1 < 1 > 1024 1024 > 1024 < 1
T Ec
42/Virchow 4 < 1 512 < 1 512 < 1 16 < 1 < 1 < 1 > 1024 1024 > 1024 < 1
T Kp
36/K12 C600 32 < 1 512 < 1 1024 < 1 64 < 1 < 1 < 1 64 256 > 1024 < 1
T Kp
36/Enteritidis 32 < 1 512 < 1 128 < 1 16 < 1 < 1 < 1 > 1024 1024 > 1024 < 1
T Kp
36/Virchow 32 < 1 1024 < 1 256 < 1 16 < 1 < 1 < 1 > 1024 1024 > 1024 < 1
T Kp
41/K12 C600 8 < 1 128 < 1 256 < 1 32 < 1 < 1 < 1 > 1024 1024 > 1024 < 1
T Kp
41/Enteritidis 4 < 1 1024 < 1 > 1024 < 1 64 < 1 < 1 < 1 > 1024 1024 > 1024 < 1
T Kp
41/Virchow 4 < 1 1024 < 1 1024 < 1 64 < 1 < 1 < 1 > 1024 1024 > 1024 < 1
T Cf
8/K12 C600 4 < 1 256 < 1 512 < 1 32 < 1 < 1 < 1 > 1024 1024 1024 < 1
T Cf
8/Enteritidis 4 < 1 512 < 1 256 < 1 64 < 1 < 1 < 1 512 1024 > 1024 < 1
T Cf
933/K12 C600 2 < 1 512 < 1 1024 < 1 32 < 1 < 1 < 1 > 1024 1024 > 1024 < 1
T Cf
933/Enteritidis 4 < 1 256 < 1 256 < 1 64 < 1 < 1 < 1 > 1024 > 1024 > 1024 < 1
T Cf
933/Virchow 4 < 1 > 1024 < 1 1024 < 1 64 < 1 < 1 < 1 > 1024 1024 > 1024 < 1
T En
70/K12 C600 2 < 1 256 < 1 512 < 1 64 < 1 < 1 < 1 > 1024 128 < 1 < 1
T En
70/Enteritidis 2 < 1 1024 < 1 256 < 1 64 < 1 < 1 < 1 > 1024 1024 > 1024 < 1
T En
Table
3.
MIC
values
(mg/l)
of
antibacterial
agents
for
transconjugants
(n
=
27)
obtained
in
mating
experiments
(cd.)
Tabela
3.
Wartości
MIC
(mg/l)
leków
przeciwbakteryjnych
dla
transkoniugantów
(n
=
27)
uzyskanych
w
krzyżówkach
(continued)
Transconjugants
(T
a)
(Transkoniuganty (Ta)
Antimicrobial
agents
(Leki
przeciwbakteryjne)
CAZ
CAZ+Cla
CTX
CTX+Cla
CRO
CRO+Cla
ATM
ATM+Cla
IPM
MEM
Gm
An
Sxt
Tig
T En
938/Virchow
8
<
1
1024
<
1
256
<
1
16
<
1
<
1
<
1
>
1024
1024
>
1024
<
1
T 242/K12
C600
32
<
1
512
<
1
512
<
1
256
<
1
<
1
<
1
>
1024
>
1024
>
1024
<
1
T Ser
242/Enteritidis
32
<
1
1024
<
1
256
<
1
128
<
1
<
1
<
1
>
1024
1024
>
1024
<
1
T Ser
242/Virchow
32
<
1
>
1024
<
1
1024
<
1
256
<
1
<
1
<
1
>
1024
1024
>
1024
<
1
T Ser
278/K12
C600
4
<
1
512
<
1
512
<
1
128
<
1
<
1
<
1
>
1024
>
1024
>
1024
<
1
a Obtained
in
crosses
between
donor
and
recipient
strains;
for
example
T Ec
26/K12
C600
, the
first
abbreviation
(Ec
26)
denotes
the
donor
strain
(
E.
coli
26),
while
the
second
the
recipient
strain
(
E.
coli
K12
C600).
a Uzyskane
w
krzyżówkach
między
szczepem
dawcy
i biorcy;
na
przykład
T Ec
26/K12
C600
, pierwszy
skrót
(Ec
26)
określa
szczep
dawcy
(
E.
coli
26),
a
drugi
szczep
biorcy
(
E.
coli
K12
from the chromosomally encoded enzymes of
Kluyvera spp. [24]. In general, these enzymes
preferentially hydrolyze cefotaxime and ceftriax-one but their activity against ceftazidime is usu-ally lower [25, 26]. Nowadays, plasmid-mediated CTX-M-type β-lactamases are the most prevalent ESBLs worldwide. These enzymes were identified in various species of Enterobacteriaceae,
includ-ing Salmonella enterica serovars [11, 12, 27–29].
In Poland, the first Salmonella serovar Mbandaka exhibiting oxyimino-β-lactam resistance due to the expression of CTX-M-3 enzyme has been reported in 1999 [30]. Since then, this variant of ESBL was found in other serovars of Salmonella, such as S.
Enteritidis, S. Typhimurium [11], S. Thompson, S.
Muenster and S. Oranienburg [31].
All the donor strains and their transconjugants were uniformly susceptible to carbapenems and tigecycline. These findings support previous obser-vations that carbapenems remain the antibiotic in choice for the treatment of infections caused by ESBL-producing strains [15, 16, 32]. Additionally, the results of the present study confirm the high activity of tigecycline against ESBL-producing enteric bacilli and are in accordance with those previously reported by other authors [33–35]. This new semisynthetic antimicrobial, belonging to the glycylcyclines, demonstrates excellent activ-ity against a wide variety of Gram-positive and
Gram-negative bacteria, including enterobacteria exhibiting ESBL phenotype. For this reason, tige-cycline could be considered an encouraging anti-microbial for the treatment of infections involving these microorganisms.
Resistance to aminoglycosides (gentamicin and amikacin) and co-trimoxazole was in many cases co-transferred with ESBL-encoding plas-mids to the recipient strains. These findings seem to confirm the previous observations that genes coding for ESBLs and those conferring resistance to non-β-lactam antimicrobial agents are often localized within the same multi-drug resistance plasmids that can be horizontally transferred from one species to another by means of conjugation [7, 13, 18]. Therefore, such multiresistant ESBL-producing organisms constitute a serious thera-peutic problem and might be selected by various non-β-lactam drugs.
In conclusion, own results suggest that the extended-spectrum cephalosporins resistance
in Salmonella serovars due to ESBLs may have
been the consequence of an effective plasmid exchange between Gram-negative strains coex-isting in the same environment. Moreover, the ability to acquire the blaCTX-M genes may depend
on Salmonellaenterica serovars, however the
fur-ther studies are needed to explain precisely these findings.
References
[1] Parry CM: Antimicrobial drug resistance in Salmonella enterica. Curr Opin Infect Dis 2003, 16, 467–472. [2] Galanis E, Lo Fo Wong DMA, Patrick ME, Binsztein N, Cieślik A, Chalermchaikit T, Aidra-Kane A, Ellis A,
Angulo FJ, Wegener HC: Web-based surveillance and global Salmonella distribution, 2000–2002. Emerg Infect Dis 2004, 12, 381–388.
[3] Yen MH, Huang YC, Chiu CH, Lin TY: Duration of antimicrobial therapy for non-typhoid Salmonella bacter-emia in healthy children. J Microb Immunol Infect 2002, 35, 94–98.
[4] Fey PD, Safranek TJ, Rupp ME, Dunne EF, Ribot ME, Iwen PC, Bradford PA, Angulo FJ, Hinrichs SH: Ceftriaxone-resistant Salmonella infection acquired by a child from cattle. N Engl J Med 2000, 342, 1242–1249. [5] Hohmann EL: Nontyphoidal salmonellosis. Clin Infect Dis 2001, 32, 263–269.
[6] Koeck JL, Arlet G, Philippon A, Basmaciogullari S, Vu Thien H, Buisson Y, Cavallo JD: A plasmid-mediated CMY-2 β-lactamase from an Algerian clinical isolate of Salmonella senftenberg. FEMS Microbiol Lett 1997, 152, 255–260.
[7] Makanera A, Arlet G, Gautier V, Manai M: Molecular epidemiology and characterization of plasmid-encoded β-lactamases produced by Tunisian clinical isolates of Salmonella enterica serotype Mbandaka resistant to broad-spectrum cephalosporins. J Clin Microbiol 2003, 41, 2940–2945.
[8] Miriagou V, Tassios PT, Legakis NJ, Tzouvelekis LS: Expanded-spectrum cephalosporins resistance in non-typhoid Salmonella. Int J Antimicrob Agents 2004, 23, 547–555.
[9] Vahaboglu H, Dodanli S, Eroglu C, Öztürk R, Soyletir G, Yildirim I, Avkan V: Characterization of multiple-antibiotic-resistant Salmonella Typhimurium strains: molecular epidemiology of PER-1-producing isolates and evidence for nosocomial plasmid exchange by clone. J Clin Microbiol 1996, 34, 2942–2946.
[10] Tassios PT, Gazouli M, Tzelepi E, Milch H, Kozlova N, Sidorenko S, Legakis NJ, Tzouvelekis LS: Spread of Salmonella Typhimurium clone resistant to expanded-spectrum cephalosporins in three European countries. J Clin Microbiol 1999, 37, 3774–3777.
[11] Baraniak A, Sadowy E, Hryniewicz W, Gniadkowski M: Two different extended-spectrum beta-lactamases (ESBLs) in one of the first ESBL-producing salmonella isolates in Poland. J Clin Microbiol 2002, 40, 1095–1097. [12] Su LH, Chiu CH, Chu C, Wang MH, Chia JH, Wu TL:In vivo acquisition of ceftriaxone resistance in Salmonella
[13] Liebana E, Batchelor M, Torres C, Briñas L, Lagos LA, Abdalhamid B, Hanson ND, Martinez-Urtaza J: Pediatric infection due to multiresistant Salmonella enterica serotype Infantis in Honduras. J Clin Microbiol 2004, 44, 4885–4888.
[14] Usha G, Chunderica M, Prashini M, Willem SA, Yusuf ES: Characterization of extended-spectrum β-lactamases in Salmonella spp. at a tertiary hospital in Durban, South Africa. Diagn Microbiol Infect Dis 2008, 62, 86–91. [15] Livermore DM: β-lactamases in laboratory and clinical resistance. Clin Microbiol Rev 1995, 8, 557–584. [16] Paterson DL, Bonomo RA: Extended-spectrum β-lactamases: a clinical update. Clin Microb Rev 2005, 18, 657–686. [17] Jacoby GA, Medeiros AA: More extended-spectrum β-lactamases. Antimicrob Agents Chemother 1991, 35,
1697–1704.
[18] Franiczek R, Krzyżanowska B, Dolna I, Mokracka G, Szufnarowski K: Extended-spectrum β-lactamase-conferring transferable resistance to different antimicrobial agents in Enterobacteriaceae isolated from blood-stream infections. Folia Microbiol 2005, 50, 119–1124.
[19] Gray LD: Escherichia, Salmonella, Shigella and Yersinia. In: Manual of clinical microbiology. Eds.: Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH, Washington 1995, ASM Press., 450–456.
[20] Clinical and Laboratory Standard Institute: Performance Standards for Antimicrobial Susceptibility Testing. Wayne PA, USA 2006, 16th Informational Supplement, M100–S15.
[21] Jarlier V, Nicolas MH, Fournier G, Philippon A: Extended broad-spectrum β-lactamases conferring transferable resistance to newer β-lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns. Rev Infect Dis 1988, 10, 867–878.
[22] Gniadkowski M, Schneider I, Pałucha A, Jungwirth R, Mikiewicz B, Bauernfeind A: Cefotaxime-resistant Enterobacteriaceae isolates from a hospital in Warsaw, Poland: identification of a new CTX-M-3 cefotaxime-hydrolyzing β-lactamase that is closely related to the CTX-M-1/MEN-1 enzyme. Antimicrob Agents Chemother 1998, 42, 827–832.
[23] Sarowska J, Drulis-Kawa Z, Guz K, Jankowski S, Wojnicz D: Conjugative transfer of plasmid encoding extend-ed-spectrum beta-lactamase to recipient Salmonella strains. Adv Clin Exp Med 2009, 18, 63–70.
[24] Humeniuk C, Arlet G, Gautier V, Grimont P, Labia R, Philippon A: β-lactamases of Kluyvera ascorbata, prob-able progenitors of some plasmid-encoded CTX-M types. Antimicrob Agents Chemother 2002, 46, 3045–3049. [25] Alobwede I, M’Zali FH, Livermore DM, Heritage J, Todd N, Hawkey PM: CTX-M extended-spectrum
β-lactamase arrives in the UK. J Antimicrob Chemother 2003, 51, 470–471.
[26] Bonnet R: Growing group of extended-spectrum β-lactamases: the CTX-M enzymes. Antimicrob Agents Chemother 2004, 48, 1–14.
[27] Izumyia H, Mori K, Higashide M, Tamura K, Takai N, Hirose K, Terajima J, Watanabe H: Identification of CTX-M-14 β-lactamase in Salmonella enterica serovar Enteritidis isolate from Japan. Antimicrob Agents Chemother 2005, 49, 2568–2570.
[28] Bahar G, Mert A, Catania MR, Koncan R, Benvenuti C, Mazzariol A: A strain of Salmonella enterica serovar Virchow isolated in Turkey and carrying a CTX-M-3 extended-spectrum β-lactamase. J Chemother 2006, 18, 307–310.
[29] Bertrand S, Weill FX, Cloeckeart A, Vrints M, Mairiaux E, Praud K, Dierick K, Wildemauve Ch, Godard C, Butaye P, Imberechts H, Grimont AD, Collard JM: Clonal emergence of extended-spectrum β-lactamase (CTX-M-2)-producing Salmonella enterica serovar Virchow isolates with reduced susceptibilities to ciprofloxacin among poultry and humans in Belgium and France (2000–2003). J Clin Microbiol 2006, 44, 2897–2903.
[30] Gierczyński R, Szych J, Rastawicki W, Jagielski M: The molecular characterization of the extended-spectrum beta-lactamase (ESBL) producing strain of Salmonella enterica serovar Mbandaka isolated in Poland. Acta Microbiol Pol 2003, 52, 183–190.
[31] Szych J, Gierczyński R, Wardak S, Cieślik A: The occurrence and characterization of oxyimino-β-lactams resistant strains among Salmonella enterica subsp. enterica isolated in Poland. Med Dosw Microbiol 2005, 57, 115–130. [32] Medeiros AA: Evolution and dissemination of β-lactamases accelerated by generations of β-lactam antibiotics.
Clin Infect Dis 1997, 24, 19–45.
[33] Biedenbach DJ, Beach ML, Jones RN:In vitro antimicrobial activity of GAR-936 tested against antibiotic-resis-tant Gram-positive bloodstream infection isolates and strains producing expended-spectrum β-lactamases. Diagn Microbiol Infect Dis 2001, 40, 173–177.
[34] Morosini MI, Garcia-Castillo M, Coque TM, Valverde A, Novais A, Loza E, Baquero F, Canton R: Antibiotic coresistance in extended-spectrum-β-lactamase-producing Enterobacteriaceae and in vitro activity of tigecycline. Antimicrob Agents Chemother 2006, 50, 2695–2699.
[35] Sorlozano A, Gutierrez J, Salmeron A, Luna JD, Martinez-Checa F, Roman J, Piedrola G: Activity of tigecycline against clinical isolates of Staphylococcusaureus and extended-spectrum β-lactamase-producing Escherichia coli in Granada, Spain. Int J Antimicrob Agents 2006, 28, 532–536.
Address for correspondence:
Roman Franiczek
Department of Microbiology Wroclaw Medical University Chałubińskiego 4
50-368 Wrocław Poland
Phone: +48 71 784 13 02
E-mail: [email protected]
Conflict of interest: None declared
