• No results found

PCR based molecular markers linked to the leaf rust resistance gene Lr19 in different bread wheat cultivars

N/A
N/A
Protected

Academic year: 2020

Share "PCR based molecular markers linked to the leaf rust resistance gene Lr19 in different bread wheat cultivars"

Copied!
6
0
0

Loading.... (view fulltext now)

Full text

Loading

Figure

Figure 1 reflects the PCR profiles performed using SCS123 F/R molecular marker (5’CCTGATCACCAA- TGACGATT3’/5’CCTGATCACCTTGCTACAGA3’)
Table 2. Results of the PCR tests using SCAR markers SCS123F/R and SCS253F/R.*

References

Related documents

The three research questions examined (1) teachers’ self- efficacy beliefs, orientations, and writing practices in first-grade classrooms; (2) how first-grade students’

Between 2012 and 2014 12 consecutive patients with combined cleft lip and palate deformities underwent secondary nasal and septal correction surgery with the same method by the

From very first emergence and inception of modern civilization, Bank plays a pivotal role in case of overall financial and socioeconomic development of any modern country.

Inhalation: In inhalation studies, laboratory rodents exposed to octamethylcyclotetrasiloxane (300 ppm five days week, 90 days) developed increased liver weights in female

METHODS Seventy-three patients (42 female, 31 male) with verrucae vulgaris on their hands or feet (1:1.5) were given a maximum of 12 treatments with a flashlamp-pumped pulsed dye

Int I De,' BioI ~h; 29 3 302 (14421 ~93 Autoradiographic localization in polychaete embryos of tritiated mesulergine, a selective antagonist of serotonin receptors that inhibits

A two years field experiment was carried out to analyze the effects of light-enriched treatment and shading on shoot dry matter accumulation and vertical distribution of

To 6 LEDs Adjacent track Phase angle detector 5 tracks 0, 1, 2, 3, 4 input from 5 phototransistors Index slot detector at 360 ° INT Data bus Port interface at