INTERNATIONAL JOURNAL OF SCIENTIFIC & TECHNOLOGY RESEARCH VOLUME 9, ISSUE 01, JANUARY 2020 ISSN 2277-8616
2255 IJSTR©2020
www.ijstr.org
Decolourization And Degradation Of Sunset
Yellow-FCF And Acid Orange-7 By Wild White Rot
Fungi Trametes Elegans And Trametes Versicolor
And Their Extracellular Ligninolytic Enzymes
Sukrit Sagar, Isha Sharma, Monika Thakur, Astha Tripathi
Abstract: A total number of 253 mushroom samples were collected from Kangra, Solan and Shimla district of H.P in 2014 during the rainy season. 61 different healthy and insect free fruiting bodies of white rot fungi (WRF) were selected for isolation and 20 pure cultures were obtained. All 20 cultures were grown with 0.5mM concentration of both dyes in Malt extract agar (2% MEA) and only 6 cultures had shown growth with both dyes Sunset yellow-FCF and Acid Orange-7. These cultures were further grown with different concentration of dyes (0.25, 0.50, 0.75 and 1 mM) in 2% MEA. Out of 6 cultures only Trametes spp. (6/14, 144/14) showed good mycelial growth and decolourization with all concentrations of dyes . These Trametes spp. were identified as Trametes elegans and Trametes versicolor after molecular taxonomy and chosen for liquid culture studies for the degradation of dyes and ligninolytic enzyme study. Both Trametes spp. were grown in Nutrient Rich (NRM) and Nutrient Poor medium (NPM) under static and shaking conditions at 25±1°C up to 20 days. HPLC analysis also had clearly demonstrated that Sunset yellow-FCF and Acid orange-7 are very efficiently degraded by both Trametes spp. The enzymes namely Laccase, Aryl alcohol oxidase (AAO), Manganese Peroxidase (MnP) and Lignin Peroxidase (LiP) were observed in both species and play a significant role in the degradation of both synthetic dyes. Trametes elegans and Trametes versicolor were showed significant potential for the degradation of Sunset yellow-FCF and Acid Orange-7 dye in NPM under shaking conditions. Both white-rot fungi can be used in the biodegradation of synthetic dyes as well as other xenobiotic compounds.
Keywords: Decolourization, Trametes versicolor, Trametes elegans, Sunset yellow-FCF and Acid orange-7
.—————————— ——————————
1 INTRODUCTION:
Since the industrial era has begun in the world use of synthetic products had been increased progressively. Synthetic dyes are one of the major products which have been used in different industries like textile, cosmetics, printing and petroleum [1]. As the human needs increased day by day the excessive use of these products had caused serious impact on the environment. Synthetic dyes can cause toxicity, mutagenicity and carcinogenicity [2]. These dyes can cause unpredictable effect on human health by polluting the ecosystem [3]. Presently humans are using synthetic dyes exhaustively and it has made it serious environmental and health concern. Conditions like Allergic dermatoses, respiratory diseases, Contact dermatitis, asthma, immunoglobulin levels Mutagenicity and many more is due to heavy use of dyes and release in environment [4,5]. According to a report of WHO 17-20% of industrial water pollution is due to the synthetic dyes [6]. To overcome pollutions the hazardous outcome of dye associated in pollution several techniques were developed, decolourization and bioremediation are few important one [7]. Biodegradation of synthetic dyes in textile waste effluents by bacteria or fungi is an alternative to conventional methods and a very promising area of study because of the relatively low expense involved. Bioremediation has the advantages of rapid, mild reaction conditions, cost-effective, environment friendly and produces no secondary pollution; it offers a promising strategy for economical and safe detoxification of some wastes [8]. Decolourization can be achieved by fungi, bacteria and mushrooms.
The White rot fungi are chief agents of biodegradation of lignin-cellulosic material in nature which contribute in the global carbon recycling [9]. These fungi considered as a key group in forest ecosystem maintenance and serve as decomposer, bioremediation, waste management agent, pathogen and also have medicinal value and hence recommended for decolourisation and bioremediation [7]. Phanerochaetec chysosporium, Trametes versicolor, Bjerkandera adjusta and Pleurotus are few important species that had demonstrated the bioremediation potential by virtue of different lignolytic enzymes such as laccases and peroxidises [10]. Many enzymes are involved in the oxidative degradation of dyes, including lignin peroxidase (LiP), manganese peroxidase (MnP) and laccase [11]. These oxidative enzymes are unspecific in nature thus cause the degradation of recalcitrant compounds such as single aromatic molecules, other xenobiotics and dyes [12]. White rot fungi are known to have ligninotytic enzymes which are no specific in nature and used in decolorization of synthetic dyes by the ligninolytic activity. Phanerochaete chrysosporium, Trametes versicolor, Schizophyllum commune and Lenzite seximia are few white rot fungi reported to have dye degradation ability [13]. In the present study wild mushrooms collected from Himachal Pradesh were evaluated for decolourization and degradation potential against two synthetic dyes sunset yellow-FCF and Acid orange-7.
2 MATERIALS AND METHOD:
Collection of samples:
The mushroom samples were collected from the forests of Kangra, Solan and Shimla districts of Himachal Pradesh (India), during rainy season in 2014. During collection, soil was removed using a soft brush. Each specimen after cleaning with sterile water was cut across the pilus region __________________________________
Faculty of Applied Sciences and Biotechnology, Shoolini University,
Bajhol, Solan, H.P Corresponding author:
with the help of sterilized sharp blade to obtain bits (1-2 mm) of tissue, which were dipped in 0.1% mercuric chloride (HgCl2) solution using sterile forceps for 10 to 20 seconds. These were repeatedly washed with sterile water (5 washings) and placed on sterilized filter paper to remove excess of moisture. The bits were then transferred onto plates of malt extract agar plates (2%) aseptically with the help of sterilized inoculating needle and incubated at 25±1ºC. Stock cultures were maintained in refrigerator at 4ºC. Cultures were revived after a period of 7-10 days on fresh slants [14].
Chemicals:
Dyes were purchased from Himedia, analytical grade 2,20-azinobis(3-ethylbenzthiazoline-6- sulphonate) (ABTS, MW 548.7 g/mol) was obtained from Sigma and Veratryl alcohol (VA, MW 168.19 g/mol) was purchased from Himedia. All other chemicals used were of analytical grade. Screening of fungi for dyes tolerance and decolourization on
solid media:
Two dyes, Sunset yellow- FCF (MW- 452.37 g/mol) and Acid orange-7 (MW 350.32 g/mol), at four different concentrations (0.25mM, 0.50mM, 0.75mM and 1mM) were individually added to 2% MEA (Malt extract agar) after autoclaving. Plates were inoculated with 8-10 days old mycelial culture bit (5 mm in diameter) in the centre and incubated at 25°C±1°C. Radial mycelial growth was taken after every 48h and average radial growth was calculated as follows:
( ( ) ( ) )
The percentage inhibition in mycelial growth was calculated by comparing mycelial growth with dyes treated fungal plates and control. Reduction (%) in mycelial growth was calculated as follows:
( ( ) ( )
( ) )
Any change in mycelial morphology or colour formation in the cultures medium was recorded [15].
Molecular identification:
The mushroom cultures with best decolourization performance were confirmed by amplifying and sequencing the 5.8S rRNA gene or internal transcribed spacer (ITS) DNA [16], and selected to proceed further. The pure fungal cultures were sub-cultured under sterile conditions in 250 ml flasks containing 100 ml of malt extract broth at 27°C for 8 days. The growing mycelial in 2% MEA was then filtered through Whatman filter paper No.1 and used for DNA extraction. Total genomic DNA was extracted by following the methodology described by [17] with certain modifications. The isolated DNA then subjected for PCR amplification using standard method of amplification and resultant amplified DNA were subjected for sequencing.
Extracellular ligninolytic enzyme essay:
The extracellular enzymes production was carried out in nutrient rich medium (NRM) containing 2 g of ammonium
tartrate, 10 g of glucose, 1 g of KH2PO4, 1 g of yeast extract, 0.5 g of MgSO4.7H2O, 5 g of KCl, 1 ml of solution containing trace elements per litre of medium and Nutrient poor medium (NPM) containing 10 g of glucose, 2 g of KH2PO4, 0.2 g of yeast extract, 0.1 g of peptone, 1 ml of solution containing trace elements per litre of medium. Solution of trace elements containing 10 mg of Na2B4O7.10H2O, 7 mg of ZnSO4.7H2O, 5 mg of FeSO4.7H2O, 1 mg of CuSO4.5H2O, 1 mg of (NH4)6Mo7O24.4H2O, 1 mg of MnSO4 dissolved in 100 ml of H2O [18]. The pH was adjusted to ±7 before autoclaving at 15 psi and 120°C for 20 min. 0.25mM concentration of Sunset yellow-FCF (113.09 µg/ml) and Acid Orange-7 (87.58 µg/ml) were individually added in medium after autoclaving. Liquid medium (50ml) was inoculated with 5-8 days pre-cultured mycelium in 2% MEA agar. Three replicates of flaks of both media was incubated in BOD incubator and three replicates of flasks incubated in shaking condition in a rotatory shaker at 150 rev/min at 25°C. The cultures were harvested at the 5th, 10th, 15th and 20th day of incubation. Each sample was centrifuged (10,000 x g for 10 min) at 4°C. The supernatant of liquid culture was used for enzyme assay [19]. Protein concentration was determined following Bradford method. Protein content in the sample was determined from standard curve and the amount of protein μg ml–1 was calculated [20]. The enzymatic reactions were carried out in triplicate. The laccase activity was determined by monitoring the rate of oxidation of ABTS by the culture supernatants. The assay mixture contained 100mM sodium acetate buffer pH 5.0 and 5mM ABTS. The extinction coefficient (ε) used was 36,000 M-1
cm-1 [21]. The reaction was started by adding 50μl enzyme sample. Absorbance was measure at 420nm. One unit defined as 1µM of ABTS oxidized per minute ( = 36000 M-1
cm-1) [22]. AAO activity was estimated by the veratraldehyde formation from 5mM veratryl alcohol (VA). Enzyme activity was measured with 5mM VA in 100mM sodium phosphate buffer at pH 6.0. One unit of AAO activity is defined as the amount of enzyme that converts 1μmol of alcohol to aldehyde per min at 24°C. (ε310= 9,300 M-1
cm-1) [23]. Lignin peroxidase activity was assayed by measuring the rate of H2O2-dependent oxidation of veratryl alcohol to veratraldehyde spectrophotometrically. The standard reaction mixture contained 2mM veratryl alcohol in100mM sodium tartrate buffer (pH 3.0). The reaction were started by the addition of 0.4mM H2O2 (30%) and the linear increase in absorbance at 310 nm was monitored for one minute at 30°C [24]. One unit of LiP was defined as 1µM of veratraldehyde formed per minute and was expressed as U/ml ( = 9300 M-1
cm-1). Determination of MnP activity by monitoring the oxidation of Mn+2 to Mn+3 and determined by the production of a Mn+3 tartrate complex. MnP activity was determined by using of MnSO4, which was added to the enzyme extract. The assay solution contained from 0.1mM MnSO4 in 100mM sodium tartrate buffer pH 4.5. The reaction was started by 0.1mM H2O2 (30%) addition. One unit of enzyme activity was defined as the increase in absorbance at 238nm (ε= 6,500 M-1 cm-1) [25]. High performance liquid chromatographic analysis of
biodegradation of synthetic dyes:
INTERNATIONAL JOURNAL OF SCIENTIFIC & TECHNOLOGY RESEARCH VOLUME 9, ISSUE 01, JANUARY 2020 ISSN 2277-8616
2257 IJSTR©2020
www.ijstr.org without mycelial cultures and with synthetic dyes served as control. Quantification of synthetic dyes was done by RP-HPLC. The analysis was carried out using an Agilent technology 1200 series reverse phase high performance liquid chromatography (HPLC) equipped with a photodiode array detector system. The compounds were separated on INNOVAL C18 reverse-phase silica column (4.6 x 250mm). Acetonitrile and water in 60:40 were used as mobile phase Flow rate was 0.5 ml/min; injection volume was 5μl, and the compounds were detected at 285 nm. The concentration of different synthetic dyes was quantified using standard curve from the known substances against the area. Control was served without culture and with synthetic dyes for the calculated amount of dye [26].
Statistical Analysis:
All the experimental analysis was carried out in triplicates. The results are expressed as mean values and standard deviation (SD). The results were analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s HSD Test using SAV v.9.1.3 program. Differences at p< 0.05 were considered to be significant.
Results:
Collection of wild white rot fungi and Isolation of mycelial
culture:
Total 253 mushroom samples were collected from forest of Himachal Pradesh during rainy season (Table-1). All the fruiting bodies were found to be grown on trees, dead decaying fallen logs, soil and leaf litter. Out of 253 wild mushrooms only 61 healthy different insect free fruiting bodies of white rot fungi were selected for pure cultures isolation and only 20 pure mycelial cultures were obtained and purity of all cultures was observed under microscope. Screening of white rot fungi for synthetic dyes
decolourization:
All 20 pure cultures were grown at 0.25mM concentration of both dyes and only 6 cultures showed tolerance and decolourization of both synthetic dyes. The species that had shown tolerance were Trametes spp. (6/14, 144/14), Agaricus sp. (33/14), Aminata sp. (43/14), Ganoderma sp. (68/14), Irpex sp. (70/14). These 6 cultures were grown with 4 different concentrations of sunset yellow-FCF and acid orange-7 (0.25, 0.5, 0.75, 1mM). All six cultures showed decolourization and mycelial growth with both dyes at all concentrations (Table-2).
1. Decolourization of sunset yellow-FCF: In comparison to all six mushroom samples both Trametes spp. showed good rate of decolourization and mycelial growth at all four concentrations of both dyes. Agaricus sp. and Irpex sp. also showed good rate of decolourization at 0.25 and 0.5mM concentration whereas Ganoderma sp. and Amanita sp. showed average rate of decolourization at higher concentrations dyes. Mycelium became thin at 1mM concentration. In both Trametes spp., sample number 144/14 showed complete decolourization at 0.25 and 0.5mM concentration while at 0.75 and 1 mM dye was seen in the plates and sample number 6/14 showed complete decolourization only at 0.25mM concentration (Fig.1). 2. Decolourization of Acid Orange-7: Acid Orange-7 was easily decolorized by all fungal species in comparison to
sunset yellow-FCF. All six selected strains showed good rate of decolourization however both Trametes spp. completely decolorize Acid orange-7 at 0.25 and 0.5 mM concentration. Mycelial growth was drastically reduced at 1mM concentration and mycelium became thin and strandy (Fig.2). Agaricus sp., Aminata sp, Ganoderma sp and Irpex sp. also showed good decolourization and mycelial growth at 0.25 and 0.5 mM concentrations and decolourization was noticeably slower at 1mM concentration.
Molecular Characterization:
After the screening of dye decolourization of six samples, both Trametes species showed good decolourization and mycelial growth with Sunset yellow-FCF and Acid orange-7 at all four concentrations. Thus after these two Trametes spp. were selected for detailed studies. Sample number 144/14 Trametes sp. was already sequenced in Mycology Laboratory, Faculty of Applied Sciences and Biotechnology, Shoolini University, Solan and identified as Trametes versicolor with Accession no KX372705.1. Sample No. 6/14 was confirmed by amplifying and sequencing the 5.8S rRNA gene or internal transcribed spacer (ITS) DNA and selected to proceed further. Genomic DNA was isolated from pure culture of the selected mushroom cultures by the methodology described and was amplified by the PCR using ITS1 and ITS4 primers. Resultant PCR products were viewed after electrophoresis on agarose gel and results showed a single band with an approximate size of 500 base pairs long for each isolates as shown in Fig. 3. From the homolog search and multiple sequence alignment, it is found that the sequence of PCR product of samples Trametes sp. contains showed 99% similarity with Trametes elegans. The aligned nucleotide sequence of sample was submitted to NCBI and nucleotide sequence is provided with Gene bank Accession number KX372706. A sequence of 550-620 base pairs for sample obtained after sequencing (Table-3). The phylogenteic tree was constructed (Fig.4) of Trametes sp. and revealed that the samples is closely related to fungi.
Extracellular ligninolytic enzymes in the presence of dyes:
Ligninolytic enzymes are found to be responsible for degradation or mineralization of dyes due to their non-specific nature for the substrate.
Laccase: Laccase activity was best on 15th day with both media and conditions in both varieties. In T. elegance best laccase activity was observed with Sunset yellow-FCF in NRM static condition (316.3 Ul-1) followed by with both dyes in NPM static conditions (305.7, 306.45 UL-1) on 15th day. Least activity was observed with Sunset yellow-FCF on 5th day in NRM static condition (84.94 UL-1) followed by in control on 20th day in NRM under shaking condition (97.8 UL -1
). In T. versicolor best laccase activity was observed with Sunset yellow-FCF in both medium under static condition (321.5, 320.4 UL-1) followed by with Acid orange-7 in NPM under static condition (319.5 UL-1) on 15th day. Least activity was observed in control in NRM under shaking condition on 20th day (108.6 UL-1). Both varieties showed good laccase activity with both dyes and laccase was observed main oxidase enzyme (Table-5).
AAO: Both Trametes spp. showed good AAO activity in both medium and conditions while activity was noticeably higher in T. elegans (Table-6). In T. elegans AAO activity was best with Acid orange-7 in NPM static condition on 15th day (199.44 UL-1) followed by with Sunset yellow-FCF on 20th day (195.55 UL-1). In T. versicolor best AAO activity was observed with Sunset yellow-FCF in NPM under both conditions on 15th day (163.33, 159.44 UL-1). Both varieties showed least AAO activity in NRM under shaking condition with Acid orange-7 on 5th day, respectively (19.44, 25.0 UL -1
).
LiP: Both Trametes spp. showed best LiP activity with Sunset yellow-FCF in NPM under static condition up to 20 days (Table-7). In T. elegans higher LiP activity was observed with Sunset yellow-FCF in NPM under both conditions (97.84, 89.24 UL-1) on 15th day. Least activity was observed in control in NRM under static condition on 15th day (3.33 UL-1). In T. versicolor LiP activity was best in control and with Sunset yellow-7 in NPM under static condition on 10th and 15th day, respectively (104.3 UL-1). Least LiP activity was observed with Acid orange-7 on 5th day in NRM under shaking condition (9.67 UL-1).
MnP: Both varieties showed good production of extracellular MnP with both dyes in NPM under static condition while best activity was observed with Acid orange-7. In both Trametes spp. MnP activity was best on 15th day in NPM underQq static condition with Acid orange-7 (218.46, 233.84 UL-1). Least MnP activity was observed in T. elegans with sunset yellow-FCF on 5th day in NRM under shaking condition (9.23 UL-1). In T. versicolor MnP activity was higher in comparison to T. eegans. MnP was observed main peroxidase enzyme in both varieties (Table-8). HPLC analysis of Dyes: Both dyes were degraded by both varieties in both media and conditions whereas Sunset yellow-FCF was completely removed by T. elegans and Acid orange-7 was completely removed by T. versicolor in NPM under both conditions on 20th day (Table-9).
Sunset Yellow-FCF: T. elegans had shown excellent biodegradation of Sunset yellow-FCF dye in NPM under both conditions while degradation rate was very slow in NRM under static condition. Retention time (RT) of Sunset Yellow dye is 3.60 min. One unknown metabolite was observed in NRM under both conditions and NPM under shaking condition on 20th day (RT-4.2 min). Two unknown metabolites were observed in NPM under static condition on 20th day (RT- 3.32, 3.87 min). Sunset yellow-FCF was completely removed by T. elegans on 20th day in NPM and
under shaking condition. In T. versicolor dye was not completely degrade up to 20 days. Two unknown metabolite were observed in NRM under both conditions (RT- 3.82, 3.91 min) on 15th and 20th. One metabolite was detected in NPM under static condition (RT-4.45 min) and one very small peak was observed with Sunset yellow-FCF in NPM under both conditions and one different metabolites was observed in NPM under shaking condition (RT- 4.03 min) on 20th day (Fig.5).
Acid orange-7: T. elegans showed good rate of degradation of Acid orange-7 (RT-4.82 min) in both media and conditions however this variety was failed to remove dye up to 20 days. In NPM under shaking condition Acid orange-7 was 81.9% degrade on 5th day and on 20th day 88.3 % degradation was observed. Degradation rate was high in NPM under both conditions. One common metabolite was observed in both medium and condition on 15th and 20th day (RT-3.5min) however in NRM under both conditions one different metabolite was observed on 20th day (RT-6.21 min). In NRM static condition one metabolite was observed on 20th day (RT-5.0 min) and this metabolite was not observed in other media and condition. In T. versicolor Acid orange-7 was completely removed in NPM under shaking condition while in static condition of both media degradation rate was up to 88%. Least degradation was observed in NRM under shaking condition (67.9%). Major peak of metabolite was observed in NRM under shaking condition (RT-4.01 min) and in other media and conditions very small peaks were observed (Fig.6).
3 Discussion:
INTERNATIONAL JOURNAL OF SCIENTIFIC & TECHNOLOGY RESEARCH VOLUME 9, ISSUE 01, JANUARY 2020 ISSN 2277-8616
2259 IJSTR©2020
www.ijstr.org biodegradation process; it was observed that laccase played an important role in the dye degradation, while manganese peroxidase activity could not be detected [29]. T. versicolor was also investigated by for its ability to degrade 4-(3'-methyl-4'-(4"-nitrophenyl) azo- 1'H-pyrazol-5'-ylazo)-3-methyl- H-pyrazol-5-on in the mediums containing glucose and different concentrations of degrade dye in batch systems [30]. Yang, et al has bioresource for mycoremediation, a new white-rot fungus Trametes versicolor that could decolorize various dyes commonly used in textile industries was isolated, and decolorization capacity were characterized. Trametes versicolor had been studied for the bioremediation against 200 mg L-1 acid dyes (red 114, blue 62 and black 172) and reactive dyes (red 120, blue 4, orange 16 and black 5). In this study Trametes versicolor showed 90 % of dye degradation within 6 days in the PDB medium. Further it was observed that Trametes versicolor had high laccase and Mn-dependent activity which could be the cause of decolorization of these dyes [31]. Recently, dye decolourization through biological means has gained momentum as these are cheap and can be applied to wide range of dyes. The review of Kaushik and Malik focuses on the decolourization of dye wastewaters through fungi via two processes (biosorption and bioaccumulation) and discusses the effect of various process parameters like pH, temperature, dye concentration etc. on the dye removing efficiency of different fungi. The study indicated fungal decolourization has a great potential to be developed further as a decentralized wastewater treatment technology for small textile or dyeing units. However, further research work is required to study the toxicity of the metabolites of dye degradation and the possible fate of the utilized biomass in order to ensure the development of an eco-friendly technology [32].
4 CONCLUSION:
In the present study it can be very easily established that Himalayan region is having rich source of wild mushrooms, and these mushrooms can be effectively been used management of pollution through decolourization. The present study concludes that, out 20 white rot fungi only six species had good potential of dye decolourization. The strength of decolourization were varies among six different species, the Trametes spp. were observed with good rate of decolourization and mycelial growth against both sunset yellow-FCF and acid orange-7 dyes. However mycelium becomes thin at higher concentration. While other five species were having average potential of decolourisation. The molecular characterisation of the study confirmed the white rot fungi with highest decolourisation potential were T. elegans and T. versicolor. Ligninolytic enzymes estimation of both the fungi showed the presence of high laccase and MnP production. In the present study the HPLC analysis were also done and had clearly demonstrated that both the dyes are very efficiently degraded by both Trametes spp. in NPM under shaking condition.
5 ACKNOWLEDGEMENT:
The authors are thankful to the Faculty of Applied Sciences and Biotechnology, Shoolini University, SolanConflict of Interest: All the authors have no conflict of interest.
6 REFERENCE:
[1] Selvakumar S, Manivasagan R, Chinnappan K (2013). Biodegradation and decolorization of textile dye waste water using Ganoderma lucidum. 3 Biotech. 3(1): 71-79.
[2] Rajput Y, Shit S, Shukla A, Shukla K (2011). Biodegradation of malachite green by wild mushroom of Chhatisgarh. Journal of experimental sciences. 69-72.
[3] Sarkar S, Banerjee A, Halder U et al (2017). Degradatiom of synthetic Azo dyes of textile industry: a sustainable approach using microbial enzymes. Water conservation Sci Eng. 2: 121. [4] Kjell T, Birgitta M, Rolf N, Lars B (1986). Contact
dermatitis and asthma from reactive dyes. Contact Dermatitis, 15(3): 186-193.
[5] Wollin KM, Gorlitz BD (2004). Comparison of genotoxicity of textile dyestuffs in Salmonella mutagenicity assay, in vitro micronucleus assay, and single cell gel/comet assay, J. Environ. Pathol. Toxicol. Oncol, 23(4): 267-278.
[6] Sudha M, Saranya A, Selvakumar G et al (2014). Microbial degradation of azo dyes: a review. Int J Curr Microbial App Sci. 3(2): 670-690.
[7] Kulshreshtha S, Mathur N, Bhatnagar P (2014). Mushroom as a product and their role in mycoremediation. AMB Express. 4: 29.
[8] Joutey NT, Bahafid W, Sayel H, Ghachtouli NEI (2013). Biodegradation: Involved Microorganisms and Genetically Engineered Microorganisms. Biodegradation Life of Science. Edited by Rolando Chamy. Intech Open. 289-320.
[9] Pointing SB (2001). Feasibility of Bioremediation by White-Rot Fungi. Applied Microbiology and Biotechnology. 57(1-2): 20-33.
[10]Hyeon WK, Yun H, Sang W, Soonok K (2014). Decolorization of triphenylmethane dyes by wild mushrooms, Biotechnology and Bioprocess Engineering. 19 (3):519-525.
[11]Mishra A, Kumar S, Kumar A (2001). Laccase production and simultaneous decolorization of synthetic dyes in unique inexpensive medium by new isolates of white rot fungus. Int. Biodeter. Biodeg. 65: 487-493.
[12]Saparrat MCN, Cabello MN, Arambarri AM (.2002) Exrtracellular laccase activity in Tetraploa aristata. Biotechnol. Letters. 24: 1375-1377.
[13]Selvam K, Shanmuga PM (2012). Biological treatment of pulp and paper industry effluent by white rot fungi Schizophyllum commune and Lenzites eximia. International Journal of Pharmaceutical and Biological Archives. 3(1): 121-126.
[14]Chaudhary R, Tripathi A (2015). Isolation and Identification of Bioactive compounds from Irpex Lacteus Wild Fleshy Fungi. J. Pharm. Sci. & Res. 7(7): 424-434.
[16]Larraya LM, Pérez G, Peñas MM, Baars JJ, Mikosch TS, Pisabarro AG, Ramírez L (1999). Molecular karyotype of the white rot fungus Pleurotus ostreatus. Appl Environ Microbiol. 65(8): 3413-3417.
[17]Van Kan JAL, Van den Ackerveken GFJM, De Wit PJGM (1991). Cloning and characterization of cDNA of a virulence gene avr9 of the fungal pathogen Cladosporium fulvum, causal agent of tomato leaf mold. Mol Plant- Microbe Interact. 4: 52– 59.
[18]Espindola LHS, Espindola FS, de Freitas RG Brandeburgo MAN (2007). Biodegradation of red 40 dye by the mushroom Pleurotus sp. florida. Biosci. J. 23:90-93.
[19]Tripathi A, Upadhyay RC, Singh S. (2012) Extracellular ligninolytic enzymes in Bjerkandera adusta and Lentinus squarrosulus. Ind. J. Microbiol. 52(3): 381-387.
[20]Bradford MM (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principal of protein dye binding. Analyt. Biochem. 72: 248–254.
[21]Shin KS, Lee YJ (2000). Purification and characterization of a new member of laccase family from the white-rot basidiomycete Coriolus hirsutus. Arch. Biochem. Biophys. 384: 109-115.
[22]Wolfenden BS, Wilson RL (1982). Radical cations as reference chromogens in studies of one-electron transfer reactions: pulse radio analysis studies of ABTS. J. Chem. Soc. Perkin. Trans. 2: 805-812. [23]Varela E, Martinez AT, Martinez MJ (1999).
Molecular cloning of aryl-alcohol oxidase from the fungus Pleurotus eryngii, an enzyme involved in lignin degradation. Biochem. J. 341: 113-117. [24]Tien M, Kirk TK (1983). Lignin degrading enzymes
from the basidiomycetes Phanerochaete chrysosporium burds. Sci. 221:661-662.
[25]Paszczynski A, Huynh VB, Crawford RL (1988). Manganese peroxidase of Phanerochaete chrysosporium: purification. Methods in enzymology, Wood, Vol. 161 (W.A. and Kellong, S.C. editors), Academic press. 238-249.
[26]Magan N, Aldred D, Hope R, Mitchell D (2010). Environmental factors and interactions with microflora of grain and grapes: effects on growth and deoxynivalenol and ochratoxin production by Fusarium culmorum and Aspergillus carbonarius. Toxins. 2: 353-366.
[27]Murugesan K and Kalaichelvan PT (2003). Synthetic dye decolourization by white rot fungi. Indian J Exp Biol. 41(9): 1076-1087.
[28]Rodrí guez Couto S (2009). Dye removal by immobilised fungi. Biotechnol Adv. 27(3): 227-235. [29]Pazarlioglu NK, Akkaya A, Akdogan HA, Gungor B
(2010). Biodegradation of Direct Blue 15 by free and immobilized Trametes versicolor, Water Environ. Res. 82(7): 579-585.
[30]Akdogan HA, Demircali A, Aydemir C, Pazarlioglu N, Karci F (2011). GC-MS and spectrophotometric analysis of biodegradation of new disazo dye by Trametes versicolor. Prikl Biokhim Mikrobiol. 47(5):590-594.
[31]Yang SO, Sodaneath H, Lee JI, Jung H, Choi JH, Ryu HW, Cho KS (2017). Decolorization of acid, disperse and reactive dyes by Trametes versicolor CBR43. J. Environ. Sci. Health A Tox Hazard Subst. Environ Eng. 52(9):862-872.
INTERNATIONAL JOURNAL OF SCIENTIFIC & TECHNOLOGY RESEARCH VOLUME 9, ISSUE 01, JANUARY 2020 ISSN 2277-8616
2261 IJSTR©2020
www.ijstr.org
Table-1: Collection details of mushroom samples collected from different region of Himachal Pradesh
Sr. No. Location area Total
samples
Forest type Altitude (Meter)
1 Jubbal 2 Mixed 1,901
2 Bajhol, Solan 16 Mixed 1,532
3 Shilly, Solan 67 Pine 1,600
4 Kharapather, Jubbal 40 Mixed 2,900
5 Chail, Shimla 49 Mixed 2,250
6 Kufri, Shimla 41 Mixed pine 2,290
7 Macleodganj, Dharamshala 38 Mixed 2,082
Total 253
Table-2: Reduction (%) in mycelial growth of mushrooms by 4 different concentrations (mM) of Sunset yellow-FCF and Acid orange-7 (mean ± SD; n = 3)
Sunset Yellow-FCF
Sample No. Sample name 0.25mM 0.50mM 0.75mM 1Mm
06/14 Trametes sp. 6.06±0.34 e 13.13±1.2 e 16.16±1.77 c 20.21±0.47 e
33/14 Agaricus sp. 8.11±0.12 d 14.14±0.98 d 17.88±.0.23 b 24.24±0.87 b
43/14 Amanita sp 9.03±0.55 c 14.65±0.45 c 18.69±1.1 b 21.23±0.33 d
68/14 Ganoderma sp. 11.12±1.34 a 16.93±0.55 a 20.21±1.76 a 28.21±0.98 a
70/14 Irpex sp. 10.56±1.3 b 14.99±1.11 b 16.83±0.88 c 22.22±0.06 c
144/14 Trametes sp. 4.04±0.54 f 11.12±0.32 f 13.13±0.66 d 14.15±0.33f
Acid Orange-7
06/14 Trametes sp. 9.11±0.09e 19.14±1.09 b 20.88±0.45 b 18.18±0.12 e
33/14 Agaricus sp. 21.21±0.34 a 25.26±1.34 a 22.23±1.66 a 24.24±1.01 b
43/14 Amanita sp 10.31±0.44 d 12.65±1.45 e 16.69±0.92 e 22.22±0.67 d
68/14 Ganoderma sp. 12.12±1.34 b 16.43±0.23 c 20.41±0.23 c 27.23±0.33 a
70/14 Irpex sp. 11.56±0.98 c 13.49±0.55 d 16.83±1.87 d 23.22±0.66 c
144/14 Trametes sp. 9.09±0.12 e 10.10±1.66 f 14.15±0.33 f 13.13±0.23 f
*In each column (individual dye) different letters means significant difference (p < 0.05)
Sample number
Sequences Gene bank
Accession no.
06/14
TTCGTACGTGACCTGCGGAGGATCATTAACGAGTTCTGAAACGGGTTGTAGCTGGC CTTCCGGGGCATGTGCACACCCTGCTCATCCACTCTACACCTGTGCACTCACTGTAG GTTGGCGTGGGCTTCCTTCGCGGGAAGCATTCTGCCGGCCTATGTACACTACAAAC ACTATAAAGTAACAGAATGTATTCGCGTCTAACGCATCATAATACAACTTTCAGCAAC GGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGA ATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATAT TCGAAGAACATGCCTGTTGAGTGTCATGGAATTCTCAACCTATAAATCTTTGTGGTTT ATGGGCTTGGACTTGGAGGCTTGCCGGCCTCAATGGTCGGCTCCTCTTGAATGCAT TAGCTTGATTCCGTGCGGATCGGCTCTCAGTGTGATAATTGTCTACGCTGTGAACCG TGAAGCGTTTGGCGAGCTTCTAACCGTCCCGTTGGGACAATTTACTGACATCTGACC TCAAATCAGTAGACGCATT
2263
Table-4: Extracellular Protein (µgml-1) in T. elegans and T. versicolor with or without dyes (mean ± SD; n=3)
Dye Mediu
m
Conditi on
Day Interval
T. elegans T. versicolor
5 10 15 20 5 10 15 20
Suns et yellow -FCF
NRM Static 52.75±0. 82b 50.17±1. 01d 33.10±0. 78h 21.89±0. 68f 40.68±0. 75c 44.13±0.6 3c 136.55±1. 3c 145.34±1. 4a Shakin g 45.17±0. 79c 50.68±0. 82d 50.68±0. 89e 51.20±0. 89d 43.62±0. 76b 45.51±0.7 9c 132.58±1. 12c 129.31±1. 29b NPM Static 47.24±0.
8c 49.48±0. 8d 56.37±0. 82c 54.65±0. 91c 41.20±0. 83c 128.79±1. 52a 38.79±0.9 3g 42.75±0.8 2e Shakin g 31.72±0. 71f 46.37±0. 83e 49.82±0. 86f 51.20±0. 78d 38.96±0. 78d 128.10±1. 32a
40±0.93f 39.65±0.9 2f
Acid orang e-7
NRM Static 42.41±0. 61d 6.03±0.1 3g 28.79±0. 63i 11.89±0. 23g 52.93±0. 19a 46.37±0.9 2c 147.75±1. 61b 64.82±1.0 8c Shakin g 43.62±0. 71d 55.68±07 3b 49.82±0. 56f 54.13±0. 67c 52.58±1. 12a 50.17±0.9 6b 152.41±1. 29a 127.06±1. 82b NPM Static 17.58±0.
26g 50.68±0. 58d 51.20±0. 79e 31.72±0. 65e 43.44±0. 92b 40.51±0.8 9d
135±2.01c 46.89±1.2 1d Shakin g 47.93±0. 71c 44.13±0. 75f 50.17±0. 83e 31.72±0. 81e 37.93±0. 86d 44.31±0.7 3 c
45.51±0.7 9e 130.34±0. 98b Contr ol
NRM Static 37.41±0. 98e 51.55±1. 1d 54.82±1. 14d 69.13±1. 26b 38.44±0. 89d 45.34±0.9 6c 50.51±1.0 1d 57.41±1.3 2d Shakin g 55.17±1. 21a 56.03±1. 03b 61.55±1. 31b 68.10±1. 39b 21.37±0. 79e 22.58±0.8 9f 27.58±0.9 9h 22.93±0.7 1h
NPM Static 42.58±0. 92d 63.62±1. 01a 47.75±0. 92g 51.55±0. 92d 41.03±0. 98c 45.17±0.8 9c 46.72±0.9 6e 41.03±0.9 1e Shakin g 50.68±1. 01b 54.82±1. 11c 68.10±1. 09a 74.31±1. 19a 23.10±0. 21e 26.20±0.3 2e 28.96±0.4 2h 24.48±0.5 1g
*In each column different letters mean significant differences (p<0.05)
Table-5: Extracellular laccase production (UL-1) in T. elegans and T. versicolor with or without dyes (mean ± SD; n=3)
Dye Mediu
m
Conditi on
Day Interval
T. elegans T. versicolor
5 10 15 20 5 10 15 20
Suns et yello w-FCF
NRM Static 181.7±3. 04c 234.4±4.2 1d 316.2±5.9 8a 138.7±2.6 9e 187.1±2.9 6c 245.2±4.5 6e 321.5±5.6 6a 143.1±3.2 1d Shakin g 84.94±1. 09i 140.9±2.0 6j 265.6±4.3 5d 120.43±3. 33g 93.54±1.8 9k 151.6±2.9 4k 278.5±4.8 1c 127.9±2.4 2g NPM Static 192.5±3.
92b 261.3±5.3 2a 305.7±5.4 9b 137.6±2.2 1e 196.7±3.2 0b 269.89±4. 1b 320.4±5.2 8a 140.86±2. 49e Shakin g 138.7±2. 36d 176.3±2.1 1h 153.7±3.1 2g 126.9±2.0 8f 145.2±2.2 2e 188.2±3.0 1i 207.5±3.7 8e 148.38±2. 92c Acid orang e-7
NRM Static 134.4±2. 10e 244.1±3.7 2c 276.4±3.3 3c 188.2±2.9 1b 140.9±2.0 1f 248.4±4.3 3d 281.7±4.5 6b 196.77±2. 96a Shakin g 122.6±1. 31g 224.7±2.4 5e 244.1±3.4 2e 112.9±2.1 4h 130.1±2.1 2h 207.5±3.0 9h 253.7±3.2 5d 126.88±2. 63g NPM Static 145.2±2.
02d 250.5±4.2 3b 306.45±6. 01b 121.5±2.0 3g 150.5±2.9 2d 278.5±3.4 6a 319.5±5.1 9a 131.2±2.4 2f Shakin g 124.7±2. 02g 195.7±2.9 2g 278.5±3.6 3c 192.7±3.0 1a 135.48±2. 44g 213.97±3. 66g 278.5±4.6 2c 117.2±2.4 1h Contr ol
NRM Static 125.8±2. 02g 174.19±3. 63h 179.56±3. 98f 146.3±2.8 6d 130.1±2.5 6h 183.9±4.1 5i 202.2±4.8 5f 149.5±3.5 2c Shakin g 116.2±2. 51h 158.1±3.0 9i 145.2±3.5 2h
97.8±1.62j 119.4±2.0 9j 164.5±2.7 9j 170.9±3.0 2g 108.6±2.0 4i
NPM Static 204.3±3. 04a 243.01±4. 07c 178.49±3. 12f 151.61±2. 23c 206.45±4. 96a 256.98±5. 09c
Table-6: AAO activity (UL-1) in T. elegans and T. versicolor with or without dyes (mean ± SD; n=3)
Dye Mediu
m
Conditi on
Day Interval
T. elegans T. versicolor
5 10 15 20 5 10 15 20
Suns et yello w-FCF
NRM Static 33.88±.85f 78.33±1.2 1e
124.44±1. 74d
71.66±1.1 9h
65±1.28d 83.88±1.8 2i
130±2.39f 67.22±1.4 1i
Shakin g
21.66±.86i 60±1.33i 115±2.66e 78.88±2.0 8f 27.22±.9 5i 66.11±1.3 6l 114.44±2. 09h 81.66±1.0 8g NPM Static 145±2.45b 146.11±2.
29a
180±2.08b 195.55±2. 49a
78.33±1. 98c
135±2.53a 163.33±3. 21a 84.44±1.8 5f Shakin g 166.11±2. 06a 91.11±1.9 5d 157.22±2. 75c 87.77±1.5 2d
55±1.35cf 96.66±1.9 2h 159.44±2. 92b 85±1.28f Acid orang e-7
NRM Static 24.4±1.21
h 99.4±2.08c 108.33±2.
53f
97.22±1.8 9c
27.22±1. 85i
105±2.05d 109.44±2. 26j
100.55±2. 09d Shakin
g
19.44±.86j 60.55±1.0 6i
92.77±1.2 9i
75±1.57g 25±1.05j 71.66±1.8 6k
99.44±2.3 6k
79.44±1.9 3h NPM Static 112.77±2.
12c 123.88±2. 32b 199.44±3. 29a 113.88±2. 33b 96.11±2. 09a 118.33±2. 29b 153.88±3. 19d 86.11±1.7 3e Shakin g 98.88±1.9 8c 67.77±1.2 5g 108.33±2. 08f 86.11±2.0 6d 87.77±1. 28b 101.11±2. 16f 141.66±3. 01e 113.88±2. 29a Contr ol
NRM Static 31.11±1.0 2g 62.22±1.7 8h 101.11±2. 30g 78.88±1.9 8f 53.33±1. 35g
85±2.58h 112.22±2. 21i
87.22±2.7 8e Shakin
g
35±1.29f 36.66±1.9 4k
52.77±1.7 8k
45±1.48j 43.88±1. 34h 75.55±2.5 7j 108.33±3. 08j 56.11±2.6 5j
NPM Static 87.22±2.7 8d
70±2.07f 99.44±3.0 9h 83.88±2.3 8e 96.11±3. 06a 114.44±3. 41c
155±2.98c 106.11±2. 60b Shakin
g
45±1.54e 48.33±1.8 4j 62.77±2.2 6j 57.77±2.2 7i 62.22±1. 26e 103.88±2. 01e 118.33±2. 81g 102.22±2. 20c *In each column different letters mean significant differences (p<0.05)
Table-7: LiP activity (UL-1) in T. elegans and T. versicolor with or without dyes (mean ± SD; n=3)
Dye Mediu
m
Conditi on
Day Interval
T. elegans T. versicolor
5 10 15 20 5 10 15 20
Sunse t yellow -FCF
NRM Static 12.90±.9
2h 19.35±.6 9g 89.24±1. 26b 46.23±1. 29b 21.50±1. 21d 40.86±2.3 6g 90.32±3.0 9c 48.38±2. 05b Shakin g 9.67±0.6 9i 22.58±0. 96f 62.36±1. 58e 38.70±1. 02c 11.82±0. 59g 37.63±1.8 5i 73.11±2.5 9f 38.70±1. 99d NPM Static 30.10±1.
02a 62.36±2. 21a 97.84±2. 59a 55.91±2. 98a 33.33±1. 39a 73.11±2.3 7b 104.30±2. 40a 61.29±2. 16a Shakin g 20.43±1. 02d 47.31±2. 74b 89.24±2. 98b 30.10±1. 38e 20.43±1. 02e 50.53±2.1 0e 86.02±2.6 8d 40.8±2.0 4c Acid orang e-7
NRM Static 15.05±1. 15g 44.08±2. 41c 63.44±3. 21e 35.48±1. 95d 20.43±1. 34e 54.83±2.3 5c 76.34±2.6 7e 40.86±2. 04c Shakin g
5.37±.58j 33.3±1.9 6e 21.50±1. 1h 17.20±1. 1h 9.67±0.6 9h 39.78±1.9 3h
45.1±2.05j 27.95±1. 69g NPM Static 22.58±1.
51b 50.53±2. 35b 73.11±2. 89c 45.16±2. 25b 29.03±1. 92b 72.04±2.2 7b 94.62±3.0 9b 34.40±1. 43e
2265
g 71f 84b 67d 92f 81f 8d 6g 03f
Contr ol
NRM Static 21.50±0. 69c 38.70±1. 83d 44.08±2. 04g 11.82±0. 65i 26.88±1. 62c 45.16±1.5 4f 51.61±2.0 5i 18.27±0. 89i Shakin g 9.67±0.2 4i 19.35±0. 75g 3.33±0.0 9i 6.45±0.2 1k 11.82±1. 02g 40.86±2.0 4g 33.33±1.3 2k 17.20±0. 85i NPM Static 19.35±0.
85e 44.08±2. 14c 47.31±2. 74f 19.35±0. 95g 30.10±1. 30b 104.30±2. 94a 58.06±1.8 5h 30.10±1. 39f Shakin g 18.27±0. 95e 38.70±1. 78d 44.08±1. 8g 9.67±0.5 6j 22.58±1. 82d 37.63±2.3 2i 44.08±2.4 5j 20.43±1. 96h *In each column different letters mean significant differences (p<0.05)
Table-8: MnP activity (UL-1) in T. elegans and T. versicolor with or without dyes (mean ± SD; n=3)
Dye Mediu
m
Conditi on
Day Interval
T. elegans T. versicolor
5 10 15 20 5 10 15 20
Suns et yello w-FCF
NRM Static 21.53±1. 02i 129.23±2. 45e 144.61±3. 04e 110.76±2. 35b 27.69±1. 05g
160±2.45f 150.8±2.1 9f 107.69±1. 87c Shakin g 9.23±0.6 3j 83.07±1.2 3h 107.69±1. 86h 98.46±1.7 8c 21.53±1. 13h 107.69±2. 11i 126.2±2.5 7i 107.69±2. 19c NPM Static 58.5±1.5
3b
172.3±2.6 8b
175.4±2.7 5b
120±2.11a 70.76±1. 28b 187.69±2. 24c 206.2±2.4 7b 126.15±1. 98a Shakin g 33.84±1. 23g 144.6±2.4 1d 116.92±2. 11g 98.46±1.9 8c
40±1.47e 172.30±2. 11e 147.69±1. 75g 110.76±1. 87b Acid orang e-7
NRM Static 24.61±1. 02h 169.23±1. 63c 172.30±1. 86b 83.07±1.1 3e 33.84±1. 24f 190.76±2. 45b 203.07±2. 98b 101.53±2. 19d Shakin g 24.61±1. 06h 101.53±2. 19g 116.92±2. 63g 36.92±1.4 5h 27.69±1. 17g 110.76±2. 18h 135.38±2. 23h 67.69±1.8 5i
NPM Static 64.61±1. 75a 187.69±2. 41a 218.46±2. 59a 110.76±2. 13b 73.84±1. 45a 212.30±2. 84a 233.84±2. 62a 126.15±1. 89a Shakin g 43.07±1. 09d 144.61±2. 47d 95.38±1.5 8i 89.23±1.8 7d 46.15±1. 42d 175.38±2. 48d 156.92±2. 34e 98.46±1.6 8e Contr ol
NRM Static 40±1.25e 70.76±1.8 7i
160±2.14c 55.38±1.3 4g 46.15±1. 25d 86.15±1.7 8k 190.76±2. 19c 86.15±1.7 6g Shakin g 36.92±1. 19f 52.30±1.5 4j
120±1.89f 36.92±1.1 7h
40±1.23e 67.69±1.8 9l
150.76±2. 17f
67.69±1.8 8i
NPM Static 58.46±1. 42b
110.76±2. 13f
160±2.19c 70.76±1.5 5f 70.76±1. 56b 141.53±2. 27g 193.84±2. 54c 95.38±1.8 4f Shakin g 52.30±1. 34c 83.07±1.4 6h 150.76±1. 98d 24.61±1.1 3i 52.30±1. 31c 95.38±1.9 4j 163.07±2. 14d 83.07±1.4 7h *In each column different letters mean significant differences (p<0.05)
Table-9: Degradation of Sunset yellow-FCF (113.09 µgml-1) and Acid orange-7 (87.58 µgml-1) followed by HPLC (mean ± SD; n=3)
Dye Day
Interv al
T. elegans T. versicolor
NRM NPM NRM NPM
Sunset yellow-FCF
Static Shaking Static Shaking Static Shaking Static Shaking
5 1.66±0.4g 4.21±0.1ef 79.43±0.4a 49.12±0.2c 56.38±0.9b 0.40±0.8gh 5.74±0.1e 17.42±.8d 10 27.52±0.2e 8.48±0.4g 80.80±0.2a 62.70±1.5b 55.48±0.8c 21.88±0.6f 25±1ef 37.15±1.3d 15 27.53±0.8f 31.14±0.4ef 89.61±0.1b 91.12±1.7a 57.90±1.1c 55.39±1.4cd 35.20±2.1e 46.63±2.3d 20
33.53±0.7f 88.85±0.2c 90.44±0.3b 113.09±0. 0a
83.14±0.8c
d 80.84±0.9d 45.46±1.1ef 54.92±1.4e
Acid orange -7
5
3.62± 0.24g 20.59± 0.41f
68.3±
1.17b 71.75±1.3
a 55.80±0.2 5c 51.23±1.66 cd 29.76±0.48 e 42.62±0.58 d
10 48.42±1.66
e 39.98±2.3f 75.9±
2.11ab 76.42±1.1
a 59.67±0.3 9c
56.47±0.62
15 53.34±1.32
de 69.40±0.53b 76.23±2.2
1a 76.95±1.0
a 60.21±0.5 3c
57.75±0.69
d 52.76±1.06de 60.98±0.62c
20
74.26±1.1c 75.36±0.61bc
76.96±1.8b
c 77.34±0.9b
78.34±0.5 9b
59.48±0.74 d
77.07±0.94
b 87.58±0.0a
2267
Fig.1: Decolourization of sunset yellow-FCF by both Trametes spp. (+ve control- Plate with mycelium without dye; -ve control- Plate with dye without mycelium)
Fig.2: Decolourization of Acid orange-7 by both Trametes spp. (+ve control- Plate with mycelium without dye; -ve control- Plate with dye without mycelium)
2269
Fig.6: HPLC chromatogram showing the biodegradation of 0.25mM Acid orange-7 on 20th day by T. elegans and T. versicolor in both medium and conditions
Abbreviations and Units:
µgml-1 Microgram per millilitre
AAO Aryl alcohol oxidase
2271
LiP Lignin peroxidase
mM millimolar
MnP Manganese peroxidase
NPM Nutrient Poor medium
NRM Nutrient Rich medium
PCR Polymerase chain reaction
RT Retention time
SD Standard deviation
U Unit
UL-1 Unit per litre
WRF White-rot fungi
