Generation and analysis of clonal IgM and IgG producing human B cell lines expressing an anti DNA associated idiotype

Generation and analysis of clonal IgM- and

IgG-producing human B cell lines expressing an

anti-DNA-associated idiotype.

A J Manheimer-Lory, … , N R Hannigan, B A Diamond

J Clin Invest.

1991;

87(5)

:1519-1525.

https://doi.org/10.1172/JCI115162

.

This study describes a methodology for generating stable, cloned, EBV-transformed

IgG-and IgM-producing human B cell lines. Using these lines we have characterized

immunoglobulin V gene utilization in an DNA-associated idiotypic system. The 31

anti-DNA-associated idiotype is encoded preferentially by the VK1 gene family, and, in all

probability, reflects a germ line gene-encoded framework determinant. Analysis of these

lines indicates that the DNA-binding antibodies produced by B cell lines from SLE patients

may differ from DNA binding myeloma proteins and from natural autoantibodies.

Research Article

Generation

and

Analysis

of Clonal

IgM-

and

IgG-producing

Human

B Cell

Lines

Expressing

an

Anti-DNA-associated Idiotype

Audrey J.Manheimer-Lory, Anne Davidson,Dorothy Watkins,Noreen R.Hannigan,andBettyA.Diamond

DepartmentofMicrobiology and Immunology, Albert Einstein College ofMedicine, Bronx,New York 10461

Abstract

This study describes amethodology for generating stable, cloned, EBV-transformed IgG-and IgM-producing human B celllines.Usingtheselineswe havecharacterized immunoglob-ulinV gene utilizationin an anti-DNA-associated idiotypic system. The 31 anti-DNA-associatedidiotypeis encoded pref-erentially by the

VKl

gene family, and,in all

probability,

re-flectsagerm linegene-encodedframework determinant. Analy-sis ofthese lines indicates that the DNA-bindingantibodies produced by B cell lines fromSLE patients maydifferfrom DNAbindingmyelomaproteinsand fromnatural autoantibod-ies. (J. Clin.Invest. 1991.87:1519-1525.) Keywords: clonal EBVlines *anti-DNAidiotype * systemic lupus erythematosus * autoantibody

Introduction

Little isknown about the etiology of autoantibody production in systemiclupus erythematosus

(SLE),I

and animalmodels of thedisease have ledtodisparateviews. Many of the manipula-tions performed in studies oflupus-prone miceclearlycannot beundertaken in studies ofthe human disease;nonetheless, the study oftheautoantibodiesthemselves can be veryrevealing. Serologic studies of SLEhave employed idiotypic analyses to identifyandcharacterize subsets of autoantibodies that bind DNA and structurally related antibodies that do not bind DNA. One approach has been to generate antiidiotypic re-agents tomonoclonalanti-DNAantibodies. However, it is not clear how closely the selected monoclonal autoantibodies mirrorthe pathogenic anti-DNA antibodies in disease. The approachfavoredby our laboratory has been to generate anti-idiotypestothe heterogenous anti-DNA antibodies present in theserumandkidneys of individualswith SLE. The3I antiid-iotype recognizesadeterminant on kappa

light

chains of anti-DNAantibodies(1).High titered expression of31-reactive anti-bodies is presentin - 80% ofSLE patients with anti-DNA

activity.

Westudied expression ofthe31idiotype inthe serum ofrelatives ofSLE patients,as well as on monoclonal immuno-globulins in theserum of individuals with monoclonal gam-mopathies (1, 2)toobtainstructural and geneticinformation

Address correspondencetoDr.BettyDiamond,Dept. ofMicrobiology

andImmunology,AlbertEinstein College ofMedicine, 1300Morris Park Ave., Bronx,NY10461.

Receivedfor publication20 June 1990andinrevisedform 17

Oc-tober1990.

1. Abbreviations used in this paper: dsDNA, double-stranded DNA;

SLE, systemic lupuserythematosus.

about 31-reactiveantibodies. These analyses suggested two pro-vocative hypotheses: (a)autoantibodiesandprotective antibod-ies are structurally and probably genetically related; and (b) malignant B cells express an immunoglobulin repertoire skewed towardsautoreactivity. The study of myeloma proteins alsosuggestedthat the 31idiotyperepresents a germ line-en-coded determinant onkappa light chains because 31 reactivity iscommon to both IgM and IgG antibodies. In contrast, a

secondantiidiotype, F4, recognizesadeterminantontheheavy chain variable region of anti-DNA antibodies in - 60% of

patients with SLE with anti-DNA activity. ELISA and Western blotanalyses of SLEseraand ofmyeloma proteins show F4 reactivity to be almostexclusively limitedtocationicIgG anti-bodies and to behighlyassociated withDNAbindingactivity (3). Because F4 reactivity is present muchmorecommonlyon

IgG than on IgMantibodies, the F4 antiidiotype may recognize asomatically generateddeterminant,theappearance of which iscoincident with heavy chain class switching.

Although many studies of autoantibodies have focusedon

myeloma proteins, the monoclonal autoantibodies produced by malignant B cells maydiffer from the autoantibodies of

autoimmune diseases. Forthisreason,it is crucial topursue the analysis ofpathogenic autoantibodies produced byB cellsfrom autoimmune individuals. We now report the production of monoclonal EBV-transformedBcell linesfrom three

individ-uals with SLE as wellasfrom one with multiple myeloma whose myelomaproteinexpressesboththe 31 and F4 idiotypes. Wehavegenerated IgM-, G-, andA-producingcell lines

ex-pressing the 31 idiotypeandIgG-producingcell lines expressing theF4idiotype. These cell lineswerecloned;their

immuno-globulin products were characterized to define antigenic speci-ficity and RNA analyzed to determine variable region gene familyutilization. We describeaprotocolforgeneratingcloned

EBV-transformed lines and wedemonstrate that SLE Bcell lines differ fromidiotypicallyrelatedmyeloma proteins;these

differencesmay provide clues to the etiology of SLE. Methods

Production andcloning ofEBV-transformedcell lines. All SLEpatients

metrevised ARAcriteria for disease. Peripheralbloodlymphocytes

wereobtained from two individuals with SLE. Bloodwasdrawnat a

time when theserumdisplayedelevatedtiters ofidiotypereactive anti-bodiesastestedbyradioimmunoassay. Spleencellswereharvested from anotherindividual with SLE who underwent splenectomy.Bone marrow wasobtained fromonepatientwithmultiplemyeloma whose myelomaproteinis31- and F4-reactive. Mononuclear cellswere iso-latedbycentrifugationonFicoll-Hypaque(PharmaciaFineChemicals,

Piscataway, NJ), and platedat1 x 106cells/mlin24-welltissue culture plates inRPMI(Gibco,Grand Island, NY)supplemented with 10% FCS(HycloneLaboratories, Inc., Logan,UT), 1%

penicillin/strepto-mycin, 1%glutamine, 1%sodium pyruvate (HazeltonBiologics, Len-exa,KS), 1%nonessential aminoacids (Gibco),and0.01 mMHepes (SigmaChemical Co., St.Louis, MO).To eachwell, 200

gI

of

superna-tantfromadense culture oftheEBV-infected Marmoset cell line

(B95-J.Clin. Invest.

© The AmericanSocietyfor ClinicalInvestigation,Inc.

0021-9738/91/05/1519/07 $2.00

8)(American Type Culture Collection, Rockville, MD), and 50 ng of cyclosporineAwasadded. Transformants grew in every well. Each well was tested for idiotypic reactivity, i.e., for the presence of 3I- or F4-reac-tiveimmunoglobulin by ELISA. Antibodies were shown to be devoid of rheumatoid factor activity based on their inability to react with an isotype- and allotype-matched irrelevantIgGI antibody in the ELISA assay (data not shown). Cloning of cells was performed within 4 wk of transformation. Cells were plated at 3, 10, 30, and 100 cells/well in 96-well round-bottomed microtiter wells in medium supplemented with 10% FCS and 20% J774 conditioned medium. The mouse macro-phage line J774 derives from a reticulum cell sarcoma and has been shown toproduce a variety of macrophage specific factors (4, 5). The line was grown in DME medium with 10% FCS. Supernatant from a 48-h dense culture was harvested and filtered before use. Plates in which cells grew in more than one of every three wells were discarded. Presumed clones were grown to mass culture in RPMI medium supple-mented as above but without the addition of J774 cell conditioned medium. For isotype, idiotype, and DNA binding assays described be-low, cells were grown in serum free medium.

Assayfor isotype. The isotype of secreted immunoglobulin was de-termined by ELISA. Goat anti-humanimmunoglobulinM,G,and A (Sigma Chemical Co., St.Louis,MO) was adsorbed tomicrotiterwells (Costar 35, Cambridge, MA) at 10 Mg/ml. Wells were blocked with PBS/3% BSA/5% FCS. Supernatant (100Ml/well)was addedfor 60 min at 370C. Wells were washed with PBS-0.05% Tween and then incu-batedseparately with peroxidase labeled goat anti-human IgM, IgG, or IgA (Sigma Chemical Co.). ABTS substrate (Kirkegaard and Perry Lab-oratories, Inc., Gaithersburg, MD) was added. ELISA plates were read atOD405.

Assays foridiotypicspeciJicity. Because human cell lines may se-crete varying amounts of immunoglobulin, sese-cretedimmunoglobulin

from each cloned line was quantitated by ELISA. Goat anti-human immunoglobulin was adsorbed to microtiter wells at 1 Mg/well.Wells were blocked with PBS/3% BSA/5% FCS. Supernatant(100 Ml/well)

was added for 60 min at 37°C. Wells were washed with PBS-0.05% Tween, and then incubated for 60 min with either peroxidase linked goat anti-human IgM orperoxidase-linkedgoatanti-human IgG (Sigma Chemical Co.). ABTS substrate was added.Astandard curve was generated with purified IgM and IgG from a normal individual diluted in medium ranging from 0.5 to 50 ug/ml.

Supernatantsnormalized forimmunoglobulinconcentration (5Mg/

ml) by dilution in medium were assayed for idiotypicreactivity.31or

F4antiidiotype, which waspurified fromasciticfluid,wasadsorbedto

microtiter wells at 1 or 2Mg/well,respectively. Wells were blocked with PBS/3% BSA/5% FCS as above and incubated with normalized cell supernatantfor 1 h followedbyperoxidaselabeled goat anti-human

IgG,IgM,orIgA(CappelLaboratories, Cooper Biomedical, Malvern,

PA)for 1 h at 1/750 dilution in PBS/1% BSA,followedbyincubation with ABTS substrate.

Assayfor DNA reactivity.Anti-double-strandedDNA (dsDNA) ac-tivity was determined by filter assay(Millipore/ContinentalWater

Sys-tems,Bedford, MA). DNA was made double-stranded by filtration throughnitrocellulose filters. 40 Ml ofasupernatantcontainingeither 5 and/or I Mg/mlof antibody was incubated with 10,000countsof 32P nick-translated dsDNA for 30 min at 37°C. Samples were thenapplied

to prewet 1"Milliporefilter discs (HA 0.45Mm)and washedthrough

several times under vacuum. Discs were placed in scintillant and counted.

Southern blotanalysisforassayingclonality.Celllineswereassayed

forclonality by Southern blot analysisusingspecific humanJK andJH probes (TableI). High molecular weight DNAsfrom theEBVlines were prepared essentially as described by Steffen et al. (6).Briefly, 107 cells were suspended in 5 mlof 100 mM NaCl 10mMTris-HCl(pH

7.5) and 1 mM EDTA. Thesuspensionwasthenmixedwithanequal

volume of the same buffer containing1%SDS and 400Mg/ml protein-ase K(Boehringer Mannheim, GmbH, Mannheim, FRG)and incu-batedfor 2 h at 37°C. Afterincubation,2phenoland 2 SEVAG(24:1

chloroform/isoamyl alcohol) extractions, DNA was precipitated with

Table I. ProbesUtilizedinSouthern and NorthernAnalyses

Probe Characterization Source

JK 1.8 kb SacI

_fragment

Leder, P.,Harvard

_University

inclusive JKl-5

JH 1.0 kb BstElI

fragment

Berman,J.,F.Alt,Columbia

most3'fragment University

VKl 0.4 kb Sac I-Pst I Zachau, H., University of

fragment Munich

VK2 0.4 kb Hind III-EcoRI Zachau, H., University of

fragment Munich

VK3 0.4kb Hind III-Eco RI Zachau, H., University of

fragment Munich

VK4 0.4 kbHind III-Eco RI Zachau, H., University of

fragment Munich

VHl 0.4kb Eco RI-Bst Eli Berman, J., F. Alt, Columbia

fragment University

VH2 0.38kb Sal I-EcoRI Berman, J., F. Alt, Columbia

fragment University

VH3 0.5 kb Nco I-BstIEII Berman, J., F. Alt, Columbia

fragment University

VH4 0.47 kb Bam-Eco RI Berman, J., F. Alt, Columbia

fragment University

VH5 0.38 kb Hinc II-Pst I Berman, J., F. Alt, Columbia

fragment University

VH6 0.30 kb Eco RI-Stu I Berman,J., F.Alt,Columbia

fragment University

2.5 vol ethanol and dissolved inaminimal volume 10 mMTris-HCI (pH 7.5)1mM EDTA. 10Mg DNAwasdigestedwithEco RIorBam HI (New England Biolabs, Inc., Beverly, MA) and electrophoresed on

0.8% agarosegels. Subsequently,DNAwastransferredtonitrocellulose filters and hybridized to a radiolabeled human JK probe (Leder, P.,

HarvardUniversity, Cambridge, MA) or a human JH probe (Berman, J., and F. Alt, ColumbiaUniversity,NewYork). Blotswerewashedat 68OCin 2xSSC,0.1%SDS.Onlycell lines which exhibitednomore than two heavy chain or kappa light chain rearrangements were

se-lectedfor further study.

Northern blot analysisoftotal RNAfor V gene utilization. Total RNA was preparedfrom I X 108cells using the guanidinium

thiocya-nateextraction procedure (7). Briefly, frozen or fresh cells were added directly to4Mguanidinium thiocyanate solution and homogenized immediatelyusingapolytron.This homogenate was carefullylayered

onto a 5.7 M CsCl cushion and tubes were spun in a SW41 rotor

(Beckman Instruments, Inc., Fullerton, CA) at 32 K for 18 h at 20'C.

Supernatantswere quicklysuctioned off. RNA pelletswererinsed in 100% ethanol at 250C, resuspended in 10 mM Tris 1 mM EDTA

(pre-treated with DEPC), extracted once with Phenol-Sevag solution and precipitated twice with 1/10 volume4 MNaCl (DEPC) and 2 vol of ethanol. Northern blotting was performed by electrophoretically frac-tionating the RNA on a 1.2% agarose gel (6%formaldehyde)in 40 mM MOPS, 20 mM NaOAc, 2 mM EDTA. The gel was blotted without pretreatment onto nitrocellulose using 20X SSC (3 M NaCl 0.3 M Na-citrate).

Variable region gene families of both heavy and light chains were assigned based upon hybridization of totalRNAtoeach ofsix probes representing all identified VH gene families and to each of four probes representing all identified VK gene families (Table I). Plasmids for each VH probe were kindly provided by Jeffrey Berman and Fred Alt of Columbia University. Plasmids containing the K light chain family specific probes were provided by Hans Zachau (University of Munich, FRG).Vregion specific probes were prepared to insure minimal

Blots werehybridizedusingnick-translatedprobes in 50% form-amide (EM Science, Cherry Hill, NJ) at420Covernight. Subsequently, blots were washed in 2X SSC,0.1% SDSat680Cand autoradio-graphed.

Sequencingtheheavy chain rearrangement ofH2F.10

_gg

totalRNA was used to reverse transcribe into first-strand cDNA using a specific

C-yprimer 5'GCCAGGGGGAAGACCGATGG3'. Thereaction was carried out ina

50-,1

reaction mixture according to the standard proto-colprovided by Amersham Corp. (Arlington Heights, IL). Second-strandsynthesiswascarriedoutby the polymerase chain reaction method. Thereaction (100Mlvolume)contained 250Mimof each dNTP, 1.5 mM MgCI2, 50 mMKCl,20mMTris-HCI(pH8.4atroom temperature), 2.5 Uof Taq polymerase (Perkin Elmer Corp., Norwalk, CT), 1MgofCyprimerand 1

Mg

ofa5'VH3 specific 20-mer 5'AGGTG-CAGCTGGTGGAGTCT3'.30reaction cycles were performed under the following conditions: denaturation (940C, I min), annealing

(480C, 1 min) and extension(720C,3min).ElutionofspecificDNA productwasdonefrom a 2.5% low-melt agarose gel (NuSieve GTG; FMGBiproducts,Rockland, ME). The gel slice was heated for 5 min at 68°C and the volumewasadjustedto500 MlwithTEpH 8. 500Mlof phenolwasadded and the aqueous layer was extracted.Anequal

vol-umeofphenol:SEVAG(chloroform:isoamylalcohol,24:1)wasthen added and the aqueous layer was extracted. One ether extraction was done and then the DNAwasethanolprecipitated(1/10 volsodium

acetate +2 vol 100%ethanol). DNA wassequencedusing 35S-alpha

thio ATP and thedideoxytermination methodofsequenase with the addition of 10% DMSOtoallreactants.

Results

EBV-transformedcelllines were produced fromthree individ-uals with SLE and oneindividualwithmultiple myeloma.All three patients with SLE had elevated titers ofboth 3I- and F4-reactive antibodiesintheirserum on severaloccasions.The myelomapatienthad a3I-andF4-reactive DNA-binding my-elomaprotein. Cellswerepropagated in bulk cultures and, therefore, it was not possible to determine a transformation frequency.Eachwellof 106peripheral blood mononuclearcells grewmultipletransformants, demonstrating a frequency> 1 in 106 cells.

Supernatants

from cultures of transformedcells were ana-lyzed forthe presence of

immunoglobulin

expressing the 31 and F4 idiotypes. Supernatants wereconsidered

positive

for

idiotype

ifthemeanof the duplicateswere greaterthanfour standard deviations above the meanofthe

negative

control. Cells from 31-reactive or 31-

and/or

F4-reactive wellswere cloned by limiting dilution. In every case, itwas

possible

to clone31-reactive lines from 31-reactive

polyclonal

culturesand 31-and F4-reactive lines from 3I- and F4-reactive cultures, even though it is, in general, difficultto clone EBV-trans-formed Bcelllines.

Attempting

to

optimize

conditions for cloningthese B cell

lines,

weassayed different

conditioned

me-dia for increased

cloning efficiency.

Whereas supernatants from concanavalin A-stimulated

peripheral

blood mononu-clear cells and the U937 human

monocytelike

line showedno appreciable effect, we found that medium from the murine

macrophagelike

lineJ774 was abletogreatly enhance the

clon-ing

efficiency. Using

this

medium,

wecan

routinely

plate cells ataconcentration of 3-30

cells/well

in

_100,ul

ofmedium. Cells grow to massculture in

approximately

one-fourthtoone-third of all wells

suggesting

a

cloning

efficiency

of 1-10%. Aftera

single

round of

limiting dilution

cloning,

cellswere

_reassayed

for

idiotype

expression.

Thoselines thatwere31

positive

were

shown to express a single heavy chain constant region anda single lightchain constant region suggesting clonality.

Weconfirmed the clonality of lines byanalyzingSouthern blotsofDNA

digested

withtwo enzymesand

probed

witha

JH

and a

_JK

_probe.

Most lines containedtwo

rearranged

heavy

chain loci andtwo

rearranged

light

chain loci. Some

clones,

however,

did showonegermline fragmentandonlya

single

gene rearrangement of either the

heavy

chain orlight chain locus. Genomic Southerns from several EBV-transformed lines blotted with

JK

and JH probesareillustratedinFig. 1.One

line, IC4,

isderived fromthepatientwithmultiple

myeloma,

although

it doesnot representthemyeloma protein;the other three lines shown in

Fig.

1comefromasingle patientwith SLE. Each

displays

different

JH

and JKgene rearrangements

showing

themto bedifferentlines. Wereport here clones that

clearly

differ from each other

by

DNA rearrangement.Whereasthis

meansthatsome clones which differ from each otherby

so-matic mutationbutnotbyarestriction fragment length

poly-morphism analysis

would neverbe distinguishedfrom each

other,

itdoesensurethat each clonerepresents an

independent

transformationevent.

Aftercloning, 31 reactivitywasreassayedon supernatants

normalized forimmunoglobulin concentrations. Results for idiotypic reactivity in supernatants from cloned lines are

showninTableII. All linesexpressthe 31idiotype. Threeofthe lines alsoexpressthe F4 idiotype. All three ofthese producean

IgG antibody (see below). The cell lines displayaspectrumof idiotypic reactivity.

Isotype and variable regiongeneusageby EBVlines. Anti-bodiessecreted by unselected EBV-transformed cells have been consistently reportedtobe of theIgM isotype.Incontrast,we

foundasubstantialpercentageofidiotype positiveclones

pro-ducing IgG antibodies. Whereas50% of the lines reported here

are IgG producing, - 10-20% of all the 31 idiotypicpositive

lines obtainedwereIgG. AllF4-positiveantibodieswereIgG.

EcoRI

0

Ec e

kb _uu

23--a_

9.4--6.6

4.4

-Barnm _i

c

a)

0

a * c)CN

isAd* ~~~kb

-9.4

-6.6

-4.4

2.3

-_2.0

JK

probe

_JH

probe

Figure 1. Southernanalysisofhuman germlineDNAand heavy and light chain rearrangements of EBV oell line DNA digested with Eco RIand Bam HI and probed with 32Pnick-translatedJK andJH probes.

Germline JK is 9.4 kb and germ line JH is 17 kb.

Human B Cell ClonesExpressingAnti-DNAIdiotypes

ok-TableII. SummaryofIdiotypeReactive Lines

OD 405±2 SD

Cell Patient

line origin Tissue Isotype 3I F4

IC4 HIC (myeloma) Bone marrow IgM 409±15.5 215±3.0

2A4 HIC (myeloma) Bone marrow IgG 931±7.0 745±11.5*

III-3R DIL(SLE) Spleen IgM 741±7.8 154±1.4

III-2R DIL(SLE) Spleen IgM 859±40.0 261±5.5

II-I DIL(SLE) Spleen IgM 542±0 248±28.0

I-2a DIL(SLE) Spleen IgG 1012±26.0 449±37.5*

IX7RG1 DIL(SLE) Spleen IgA 517±10.6 112±4.2

HF2 HER(SLE) PBL IgM 555±23.0 306±10.8

H2F HER(SLE) PBL IgG 912±45.0 1082±27.5*

R3.5H.SG RIO (SLE) PBL IgG 892±86.5 288±7.5

Purifiedprotein (5_gg/ml)fromaEBV-transformed non-3I (158±23), nonreactiveF4line(318±13) was utilized asnegativecontrols. All lines are

3Ipositive.*F4-positive lines.

Similarfigures wereobtainedwhether peripheral blood cells, spleen cells,orbonemarrowcellsweretransformed.

Northern blottingwas utilizedtodetermine which heavy and

light

chain variableregiongenefamilieswererepresented inourpanel of antibodies.5-7

_jsg

of totalRNA wasblottedon nitrocellulose and probed withVspecific probes representing allreported human

VKgene

families

(Fig.

2).Analysis ofthe VK families utilizedindicates that 31 reactive lines preferentially use amember(s) of the

VKI

family;allbut2 of 10 31-reactive antibodiesare encoded bya VK1 gene (Table III). No clone expresses more thanone VK family. Whereastwolines were

derived

from thepatient with myeloma, neither line is produc-ing the myeloma protein.Both linesproduce aVKl-encoded

light

chain,

whereas the

myeloma

protein

is a VK3 encoded lightchain (8).

Itisapparent thatno

single VH region family

is used

by

the 31-positiveantibodies(Fig. 3).Four ofthe sixcurrentlydefined

VH families are expressed in these 31-reactive lines. Even when clonesfrom thesameindividualareexamined,more than one VH

family

is expressed in 31-reactive antibodiesand inthe DNA binding subset of 31-reactive antibodies. For example, III-3R, III-2R, and 11-1 are allderived from asingle patient; theyexpress aVH3, VHS,and VH1 gene product,respectively. Whereasonly threeF4-reactive lineswerestudied,thereis no evidence

suggesting

thata

single

VHgenefamily associates with F4reactivity. OfthethreeF4-positive lines,one uses amember ofthe VH4 family andtwo use amemberof the VH3 family. Boththesegene familiesarealso used inthe samepatientsto encodeantibodies that lackF4

reactivity.

To seeifF4

idiotypic

specificity

resides in the third

complementarity-determining

region,wesequenced the Dregionof theheavychain fromthe H2Fantibody and compared ittotheD sequenceof the 2A4 antibody

(Fig.

4). Thesequencesinthe Dregionare

sufficiently

divergenttosuggestthatF4

reactivity

does notreside in CDR3.

c3U-cr i,

trHD ti =

PROBE

28S-VK1

18SI

-28S

.. _{- 18S}

PROBE

VK

2

-28 S Figure2. Northern blotanalysis of total RNAforVKgene

utili-- 18S VK4 zation.Variable region specific

VK(A) fragmentswere nick-translated andusedtoprobe the

blots(2A4Vregionusagewas

determinedbysequencing mRNA).

N U)

CDJ~

. ;_.

:

s.i

..=

r:::-_

...j.

VK3

i..

28S- ..

f..."

Table III. VariableRegion Gene Usage

Genefamily

Patient Cellline VK VH

HIC IC4IgM 1 4

2A4* IgG 1 4*

DIL III-3RIgM 1 3

III-2R IgM 1 1

II- I gM 3 5

I-2a* IgG 1 3*

IX7RG1 IgA 1 3

HER HF2IgM 2 3

H2F*IgG 1 3*

RIO R3.5H.5GIgG 1 1

Summary table of VL and VHgenesutilized by EBV-transformed cell linesasdetermined by Northern blot.*F4positive lines.

Antigenic

specificity.

Double-stranded DNA binding was demonstratedby Milliporefilter assay. TheMilliporefilter as-sayisaclinicalassay which is used to demonstratehigh-affinity anti-DNAreactivity.Infact,whenonly40ng of antibody was usedintheassay allthelinesexcept R3.5H5G exhibited some anti-DNAactivityas DNAbindingwasgreater than four stan-darddeviations above the mean of three normal control IgG fractions. The lines varied enormouslyintheirrelative affini-tiesfor dsDNA(Table IV).Previous studies ofmyeloma pro-teins had shown that in the 31 idiotypesystem IgG antibodies are more likelytobind DNA than IgMantibodies. The five IgM antibodieswestudied, four from SLE patientsand one from a myeloma patient, all bind DNA, suggesting that the

(D

- LO

cr Lo LO I,- _{c rei}

?< =

V~po CJ -I

2L

PROBE

VH

I

28S-

185-VH3 28S

18S-VH

5

28S-18 S

-H2F D L S M TD G Figure 4. Derived amino

acidsequenceofthe D

re-gionof H2F comparedto

2A4 DS IM G E IARGP R A K GQ Dregion of 2A4 (8).

IgMantibodies ofSLE patients maydiffer fromtheIgM anti-bodiesin nonautoimmuneindividuals.

Discussion

The adventofhybridomatechnology madeit possibleto gener-atemurine monoclonal antibodies essentiallyatwill.Human hybridomatechnologyhasnotbeensosuccessful (9, 10). Fu-sion frequencies are generally low, stability ispoor, and the amount ofsecreted immunoglobulin isvery small. Epstein-Barrvirushas also been used totransformhuman Bcells, but EBV-transformed B cells have also been somewhat unstable, when lines are grown as uncloned populations(11). Previously, othershavereported thegeneration of only IgM

producing

B cells(12-14). Nakamuraet al.generated cloned, IgG-produc-ing linesbutonlywhen humanperipheral bloodmononuclear cells wereusedasfeedercells(15).Theseclonedlymphocytes were stableforonly a numberof months.Inaddition,the pres-enceofsuchfeedercellsprecludesstudiesof cell lineRNAand DNA. Tostudy themoleculargenetics ofanti-DNA antibodies from patients with SLE, it isnecessary to be able tomaintain stable cloned IgM- andIgG-producingB cell lines in the ab-sence ofany other cells. Therefore, we had to first devise a protocolfor generatingsuchlines.Inthis study theuseof con-ditioned medium inconjunction withasingle round of early

cloning

by

limiting

dilution

permitted

theestablishment of long term, stable, clonal EBV-transformed lines. These lines have beengrowingforover ayear andtheysecretebetween0.5

-28S

VH 2

-18S

-28S_{V5 4}

-18S

-28S

-18S

VH6

Figure 3. Northern blot analysisof total RNA forVHgeneutilizationperformedas

describedforVKgeneutilization.

-t)

CD

,

a:t~

cr c _-L

Table IV.Millipore Filter BindingAssayfor dsDNA Reactivity

IC4

2A4

III-3R III-2R

II-1

I-2af

IX7RG1

HF2

H2F0

R3.5H.5G

R

J

w

2187±857*

995±76*

5351±123*

2404±1419* 1326±375*

1499±299* 574±139$ 263±31*

206±74$

793±69*

159±11$

334±228*

198±28*

3080±431* 541±27*

1423±71*

126±42*

48±8* 59±2*

36±2*

55±20* 60±32*

61±12*

R, J,

and W represent purified immunoglobulin fromnormal indi-viduals. Data are expressed as mean counts per minute±2SD. An-tibody concentrations are* 5and*1 ug/ml,respectively.I_{F4 positive}

lines.

and 5

jg

of immunoglobulin per 106cells per 24 h. We were successful in generating a large number of IgG-producing lines. Nakamura et al. report a higher frequency of IgG-producing clones in EBV-transformed cells from autoimmune individ-uals than from normal individuals (15). They found a fre-quency for wells containing IgG-producing B cells from pa-tients with Hashimoto's disease andSLE of - 10%, similar to

that which we report. Whereas this increased frequency may reflect a feature of the B cells of autoimmune individuals, we were able to derive IgG-producing lines from the myeloma patient as well. It may be that early cloning permits the stabili-zation of IgG producing lines, or that IgG-producing lines can be more readily derived from bone marrow cells and spleen cells than peripheral blood cells. Because IgG-producing cell lines can be transformed and maintained in the absence of feeder cells, it will be possible to study the role of somatic muta-tion in the producmuta-tion of anti-self antibodies, and todirectly analyze the IgG antibodies that are thought to contribute to pathogenesis.

Our second goal was to determine the V regiongenesused to encode an idiotypically defined subset of anti-DNA antibod-ies. Anunderstandingof thegenes used to produce anti-DNA antibodies and other autoantibodies will facilitate studies of immunoglobulin gene polymorphisms that might constitute part of a genetic predisposition to disease. Carson and col-leagues have shown that rheumatoid factors, atleast monoclo-nalrheumatoid factors, areencoded to a very great extent by VKIII genes(16). This restriction may be somewhatbiased be-cause they have selected only rheumatoid factors expressing the Waidiotype.Our studydemonstrates that DNA anti-bodies of the 3I idiotype are encoded almost exclusively by

genes of the VKl gene family. This association is consistent with data we have obtained studying serum antibodies and myelomaproteinswhich suggested that the 31 idiotype was a germ line gene-encoded framework determinant. The VK1 gene

family

isalarge familyandnotall themembersofthis family have been cloned and sequenced. Itis not yet clear whether allmembersofthe VKlfamilyencode31-reactive anti-bodiesand/oranti-DNAantibodies or whether only a subset of VKl genesisused. Thefact thattwo31-reactive antibodies

are notencodedby VKl genesshows that the 31epitope isnot

restricted to the VKl gene family. VKl-encoded antibodies are

- 70% homologousattheprotein leveltoVK2- and

VK3-en-coded antibodies. It is quite possible, therefore, that certain

epitopes

beencodedbymorethanonegenefamily.Ithasbeen shown inanumberof idiotypesystemsthat more than one V regiongene may encode agiven idiotype. The CRI idiotype of anti-arsonate antibodiesis encoded by adifferentgenefamily in A/J mice than in BALB/c mice (17). The A48idiotype ex-pressed on levan antibodies is present primarily on anti-bodies encoded by the 7183 VH family but also on an antibody encoded by a member of the J558 gene family (18). A wide variety ofVK genes are used to encodeantibodies bearing the A48idiotype. Anti-DNA antibodies bearing the H 130idiotype canbe encodedby a J558 VH gene or by a 7183 VH gene (19). Such studiesdemonstrate howdifficult it can be to determine the structuralbasis for idiotype expression. Substantial se-quencehomology among theidiotypically related products of differentV genefamilies mayexist or, indeed,be of very lim-ited homology (17, 20). Such regions ofhomology, however large or small, may well explain an idiotype encodedby more than one V regiongenefamily. Continued study of the avail-able panelofBcelllinesshould help answer these questions.

Thefact that multiple VH gene familiesareassociatedwith 31-reactive anti-DNA antibodies might suggest that no single heavychain family is critical in determining antigenic specific-ity of these antibodies. Recently, Logtenberg et al. reported a preferential usage of the VH6 gene in four IgM anti-ssDNA antibodies derived from healthy individuals (21). They have speculated thatthisrestriction may be important in anti-DNA antibodies produced by SLE patients as well. We have,

how-ever, notobtainedanyVH6-encodedDNA-bindingantibodies frompatients withSLE.

We have not yet characterized asufficient number of F4-reactive antibodies to be certain which VH gene families can encodethisidiotype. Thelimiteddata available showingthat more then one VH gene family can encode F4 reactive heavy chains is consistent with the hypothesis that VH framework residues maynot be critical ingenerating anti-DNA antibod-ies. In a previous study ofmyeloma proteins, we found F4 reactivity to be highlyassociatedwith DNAbinding andalmost exclusively associated with IgG antibodies (3).We suggested that the F4antiidiotype mightrecognize asomatically gener-ated determinant critical to DNA binding. Sequences of F4-reactive myeloma proteins revealedmore than one VHfamily. Adetailedmolecularstudy of one3I-positive, F4-positive anti-DNAantibody,2A4, revealed theacquisitionofsomatic

studies which have shown thatantibodies utilizing differentVH and VK genes canstillexpresssimilar idiotopes(17-20). Alter-natively, the F4 idiotype may be encoded with the VDJ junc-tion and represent a particular D region gene sequence. We do notfavor this hypothesis as the D region of the H2Fantibody reportedin this study differs substantially from that of the 2A4 antibody (8).

The IgGantibodies reported here bind dsDNA as well as the pentamericIgM antibodies despite thefact that IgM anti-bodies havehigheravidity forantigen than their IgG counter-parts. Therefore, the IgG antibodies must have higher actual affinityfor dsDNA. This result was anticipated because in our studiesofmyeloma proteins we found DNA binding tobe highlyassociatedwith IgG isotype in the 31 idiotype system (1). The higheraffinity of IgG antibodies found in this study may imply that DNA is a selecting antigen in the anti-DNA re-sponse andthataffinity maturation occurs for DNA anti-bodies. Confirmation of this interpretation will bepossible onceadditional lines are available from each patient and the expressed variable region gene sequences and germ linegene sequences are known.

Weweresomewhatsurprised to find that theIgM antibod-ies produced by the cell linesgenerated for this study bound dsDNA. The relative avidity of the IgM antibodies reported here for dsDNA is greater than that previously reported for germlinegene-encoded monoclonal IgManti-DNA antibod-iesfromSLE patients and normalindividualswhich have been shown by others to bind single-stranded DNA (ssDNA) but have little ornoability to bind dsDNA (10, 12, 13, 16). Binding to ssDNA is generallybelievedto be a propertyof nonpatho-genic antibodies. Previous studies on myeloma proteins had suggested that 31-reactive IgM antibodies infrequently bind DNA.ThatIgM producing31-reactivelinesderivedfrom SLE patientsbind DNA is,however, consistentwith theobservation thatIgM anti-DNAantibodiesare notuncommonlypresent in the serumof SLE patients (22). There are severalpossible inter-pretations for this observation. The SLE-derived 31-reactive IgM antibodies maypreferentially use a subset ofantibody genesthat in their germ lineconfiguration encode 31-reactive dsDNA bindingantibodies.It is also possible that SLEpatients possess polymorphismsofimmunoglobulingenes that lead to anti-DNA reactivity of germ line-encoded antibody mole-cules.Alternatively, IgM antibodiesfrom SLE patients may be more likely to bemutatedthan thoseproducedbymalignantB cells;hypermutation may be a feature of SLE. Somatic muta-tion may occur earlier in B cell ontogeny or at higher fre-quency. Finally, EBV transformation may be selective for thoseBcells that are activatedandthus are more likely to have acquired mutations so that sampling an EBV-transformed B cellrepertoire will yield different data thansamplinga malig-nant B cellrepertoire.Themonoclonal proteinsthat express an autoantibody-associated idiotype but were derived from pa-tients with monoclonal gammopathies may not faithfully mirror theidiotypically-related antibodiesinautoimmune dis-ease and reinforces theimportanceoftechnologiesfordirectly studyingtheautoantibodies producedbynonmalignantB cells.

Acknowledaments

We wouldliketoexpressourappreciationtoDr. B.Birshteinfor criti-calreview of themanuscript.We thankMs.RosaliaCawleyand Ms. MillieBorgasforpreparingthemanuscript.

This work wassupported byNational Institutes of HealthgrantNo.

AR32371andNational Cancer Institutegrant13330. B.Diamond is a

recipientof an Irma T.Hirschel award. Audrey Manheimer-Loryis a

recipientof anArthritis Foundation Fellowship. References

1.Davidson,A.,J. L.Preud'homme,A.Solomon,M.-d.Chang,S.Beede,and B.Diamond. 1987.Idiotypic analysis of myeloma proteins: anti-DNA activity of monoclonalimmunoglobulinsbearinganSLE idiotype is more common in IgG thanIgM antibodies. J. Immunol. 138:1515-1518.

2. Halpern, R.,A.Davidson,A.Lazo, G.Solomon, R. Lahita, and B. Dia-mond. 1985.Familial systemic lupus erythematosus presence ofacross-reactive

idiotypein healthyfamilymembers.J. Clin. Invest. 76:731-736.

3.Davidson,A.,A.Smith,J.Katz, J.L.Preud'homme,A.Solomon, and B. Diamond. 1989. A cross-reactive idiotype on anti-DNA antibodies defines a heavy chaindeterminant present almostexclusively on IgG antibodies. J. Im-munol. 143:174-180.

4. Ralph, P., J. Prichard, and M. Cohn. 1975. Reticulum cell sarcoma:an effector cell in antibody dependent cell mediated immunity. J. Immunol. 114:898-905.

5.Schwarzbaum, S., and B. Diamond. 1983. The J774.2 cell line presents antigen in anIregionrestricted manner. J. Immunol. 131:674-677.

6.Steffen,D., S.Bird,W. P. Rowe, and R.A.Weinberg. 1979. Identification

ofDNAfragmentscarrying ecotropic provirses of AKR mice. Proc.Natd.Acad. Sci. USA. 76:4554-4558.

7.Maniatis,T., E.F.Fritsch,andJ.Sambrook. 1982. Molecular Cloning: A Laboratory Manual. ColdSpring Harbor Laboratory, Cold Spring Harbor, NY. 196 pp.

8.Davidson,A.,A.Manheimer-Lory,C. Aranow,R.,Peterson, N.Hannigan,

and B. Diamond. 1990. Molecular characterization of a somatically muated anti-DNA antibody bearing two SLE related idiotypes. J. Clin. Invest. 85:1401-1409. 9.Carson,D.A., and D. Friemark. 1986. Human lymphocyte hybridomas andmonoclonal antibodies.Adv. Immunol. 38:275-31 1.

10.Cairns, E., J. Block, and D. A. Bell. 1984. Anti-DNA autoantibody pro-ducing hybridomasof normal human lymphoid cell origin. J. Clin. Invest. 74:880-887.

11.Casali, P.,G. Inghirami, M. Nakamura, T. Davies, and A. L. Notkins. 1986. Human monoclonals from antigen-specific selection of B lymphocytes and transformation by EBV. Science (Wash. DC). 234:476-479.

12.Hoch, S., P. H. Schur, and J. Schwaber. 1983. Frequency of anti-DNA producing cells from normals and patients with systemic lupus erythematosus. Clin. Immunol. Immunopathol. 27:28-37.

13. Shoenfeld, Y., J. Rauch, H. Massicotte, S. K. Datta, J. Andre-Schwartz, B. Stollar, and R. S. Schwartz. 1983. Polyspecificity of monoclonal lupus autoanti-bodies produced by human hybridomas.N. Engl. J. Med. 308:414-420.

14. Rauch, J., H. Massicotte, and H. Tannenbaum. 1985. Hybridoma anti-DNAautoantibodies derived from rheumatoid arthritis and systemic lupus eryth-ematosuspatients. J. Immunol. 134:180-186.

15. Nakamura, M., S. Burastero, Y. Ueki, J. Larrick, A. L. Notkins, andP. Casali. 1988. Probing the normal and autoimmune B cell repertoire with Epstein-Barr virus. Frequency of B cells producing monoreactive highaffinity autoanti-bodies inpatients with Hashimoto's disease and systemic lupus erythematosus. J. Immunol. 141:4165-4172.

16. Chen, P. P., F. Goni, S. Fong, F. Jirik, J. H. Vaughan, B. Frangione, and D. Carson. 1985. The majority of human monoclonal IgM rheumatoid factors express a primary structure dependent cross-reactive idiotype. J. Immunol.

134:3281-3285.

17. Meek, K., D. Jeske, M. Slaovi, 0. Leo, J. Urbain, and J. D. Capra. 1984. Completeamino acid sequence of heavy chain variableregionsderived fromtwo monoclonal anti-p-azophenylarsonate antibodies of BALB/c mice expressing the major cross-reactive idiotype of the A/J strain. J. Exp. Med. 160:1070-1086.

18. Zaghonani, H., F. A. Bonilla, K. Meek, and C. Bona. 1989. Molecular basisfor expression of the A48 regulatory idiotope on antibodies encoded by immunoglobulin variable-region genes from various families. Proc.Nati.Acad. Sci. USA. 86:2341-2345.

19.Treppichio, W., and K. J. Barrett. 1987. Eleven MRL-Ipr/lpr anti-DNA autoantibodies are encoded by genes from four VH gene families: a potentially biased usage of VH genes. J. Immunol. 138:2323-233 1.

20.Capra, J. D., and T. J. Kindt. 1975. Antibody diversity: can more than one gene encode each variable region? Immunogenetics. 1:417-427.

21.Logtenberg, T., F. M.Young,J. H. Van Es, F. H. J. Gmelig-Meyling, and F. W. Alt. 1989. Autoantibodies encoded by the most_JH-proximalhuman immu-noglobulin variable region gene.J. Exp. Med. 170:1347-1356.