Similar levels of mRNA from the W1282X and the delta F508 cystic fibrosis alleles, in nasal epithelial cells

Similar levels of mRNA from the W1282X and

the delta F508 cystic fibrosis alleles, in nasal

epithelial cells.

T Shoshani, … , A Tal, B Kerem

J Clin Invest. 1994;93(4):1502-1507. https://doi.org/10.1172/JCI117128.

The effect of nonsense mutations on mRNA levels is variable. The levels of some mRNAs are not affected and truncated proteins are produced, while the levels of others are severely decreased and null phenotypes are observed. The effect on mRNA levels is important for the understanding of phenotype-genotype association. Cystic fibrosis (CF) is a lethal autosomal recessive disease with variable clinical presentation. Recently, two CF patients with mild pulmonary disease carrying nonsense mutations (R553X, W1316X) were found to have severe deficiency of mRNA. In the Jewish Ashkenazi CF patient population, 60% of the chromosomes carry a nonsense mutation, W1282X. Patients homozygous for this

mutation have severe disease presentation with variable pulmonary disease. The presence of CF transcripts in a group of patients homozygous and heterozygous for this mutation was studied by reverse transcriptase PCR of various regions of the gene. Subsequent

hybridization to specific CF PCR probes and densitometry analysis indicated that the CF mRNA levels in patients homozygous for the W1282X mutation are not significantly

decreased by the mutation. mRNA levels were compared for patients heterozygous for the W1282X mutation. The relative levels of mRNA with the W1282X, and the delta F508 or the normal alleles, were similar in each patient. These results indicate that the severe clinical phenotype of patients carrying the W1282X mutation is not due to […]

Research Article

Find the latest version:

Similar Levels of mRNA

from the W1282X and the

AF508 Cystic Fibrosis Alleles, in

Nasal

Epithelial

Cells

TziporaShoshani,* Eitan Kerem,t AmirSzeinberg,OArie Augarten,' YaakovYahav,9

David Cohen,11 Joseph RivIin,' Asher Tal** and Bat sheva Kerem*

*Department ofGenetics, Hebrew University ofJerusalem, Jerusalem 91904; tDepartment ofPediatrics, Shaare Zedek Medical Center, Jerusalem 91031;

IDepartment

ofPediatrics, Chaim Sheba Medical Center, Tel Aviv 52621;

IlDepartment

ofEar Nose and Throat, Shaare Zedek Medical Center, Jerusalem 91031; 'Department ofPediatrics, Carmel Hospital, Haifa 34362; and **Department of Pediatrics, Soroka Medical Center, Beer Sheba 84101, Israel

Abstract

Theeffect of nonsense mutations on mRNA levels is variable. The levels of somemRNAs are not affected and truncated pro-teins are produced, while the levels of others are severely de-creased and null phenotypes are observed. The effect on mRNA levelsis important for the understanding of phenotype-geno-type association.Cysticfibrosis(CF) is a lethal autosomal re-cessive disease with variable clinical presentation. Recently, two CF patients with mild pulmonary disease carrying non-sensemutations(R553X,W1316X) were found to have severe

deficiencyof mRNA. In the Jewish Ashkenazi CF patient popu-lation, 60% of the chromosomes carry a nonsense mutation,

W1282X. Patientshomozygous for this mutation have severe diseasepresentation with variable pulmonary disease. The pres-enceofCFtranscriptsin a group ofpatients homozygous and heterozygous for this mutation was studied by reverse tran-scriptase PCR ofvariousregions of the gene. Subsequent hy-bridizationtospecificCF PCR probes anddensitometry analy-sis indicated that the CF mRNA levels inpatientshomozygous for theW1282X mutationare notsignificantlydecreasedby the mutation. mRNA levelswere compared forpatients heterozy-gous for the W1282X mutation. The relative levels ofmRNA

withtheW1282X,andtheAF508or the normalalleles, were similar in each patient. These results indicate that the severe clinical phenotype ofpatients carryingtheW1282X mutation is not due to a severedeficiency of mRNA. In addition, the sever-ity, progression, and variability of the pulmonary disease are

affected by other, as yet unknown factors. (J. Clin. Invest.

1994.93:1502-1507.) Keywords:cysticfibrosis * termination mutation * W1282X * mRNA levels * genotype-phenotype

Introduction

Nonsensemutations,which codeforpremature termination of

translation,canalsoaffectthe levelsofmRNA.SomemRNA

carryingnonsensemutationsarepresent in normal levels, re-sultingin theproductionoftruncatedproteins (1,2). However, the levelsof many othermRNAwithnonsensemutations are

Adresscorrespondenceto Dr.BatshevaKerem,GeneticsDepartment,

Life SciencesInstitute,HebrewUniversity,Jerusalem91904,Israel

Receivedfor publication21April1993andinrevisedform24

No-vember1993.

severely decreased, resulting in null phenotypes. Decreased mRNAlevels due to nonsense mutations have been found in

bacteria(3),yeast (4), mice (5), and humans (6-13). Nonsense

mutationsin the

f,-globin

gene cause a40foldreduction in the

half-life of ,B-globinmRNA inerythroidcells (14). In the dihy-drofolate reductase gene, nonsense mutations reduce the mRNAlevels but thetranscriptionandstability ofthe mature mRNA are normal (15). In some cases, apolar effect is ob-served. Forinstance, immunoglobulinmRNAswithnonsense

mutationsin the 5' endof their coding regionsare100-foldless stable than mRNAswithnonsensemutationsnear the authen-ticterminationcodons(16).

Incases in whichthetermination mutationscause diseases, anunderstandingoftheir effectson mRNAstabilitycanaid in

understandingthephenotype-genotype association.For exam-ple, the absenceof

_f3-globin

mRNAin theperipheralbloodof patients homozygous fornonsensemutationscauses

#'-thalas-semia, whichis the mostsevereformof

_{fl-thalassemia}

(17). Cystic fibrosis

(CF)'

isthe mostfrequentautosomal reces-sive lethaldiseasein theCaucasianpopulation(18). The

dis-easeis characterizedmainly by progressivelungdisease,

pancre-aticdysfunction, impaired growth,and elevated sweatchloride (18). The severity ofthe disease presentation and its rate of

progressionin the involved organs varyconsiderably.The gene

responsible forthediseasehas been recently cloned anda

ma-jormutation, AF508, whichaccountsfor70%ofthe CF chro-mosomes, has beenidentified(19-21).Aphenotype-genotype

correlationin CF has beensuggested,basedonhaplotype analy-sisand thedifferent distribution oftheAF508 mutationamong

pancreatic-sufficient

and -insufficient patients (21, 22). The

AF508mutationwasshowntobeassociatedwithsevere

clini-calpresentationasreflected by earlyonset,pancreatic

insuffi-ciency, early age at diagnosis, poor nutritional status, high

sweat chloride levels, and variable pulmonary function (23,

24).Sincetheidentificationof the CF gene,>300 mutations have beenidentified worldwide(25).Several ofthese have been foundto beassociated with severe formofthe

disease,

while othershave beenfoundto beassociated with

relatively

mild

presentation(26).

Recently, two CF patients carrying nonsense mutations werereportedtohaveseveredeficiencyofmRNAtranscribed

from thenonsensealleles(27).Onepatient carriedtwo

differ-ent nonsensemutations,R553X andW1316X,and the second

patientwasheterozygous for the missense

mutation, S549N,

and the nonsense mutation, R553X. The R553X nonsense

1.Abbreviationsused in thispaper:CF, cystic fibrosis; CFTR,CF trans-membraneregulator; RT,reversetranscriptase.

J.Clin. Invest.

©TheAmericanSociety for Clinical Investigation, Inc.

0021-9738/94/04/1502/06 $2.00

mutation is located in the first nucleotide bindingfold of the CF transmembrane regulator (CFTR) protein,while the

sec-ondnonsensemutation,WI316X,islocated in the second

nu-cleotide binding fold closetothe3' end of the gene.

In theAshkenazi Jewish CFpopulation the frequency of the AF508 mutation isonly24%. Recently,amajor mutation,

W1282X, was found in 60% of the chromosomes carried by

patients from this ethnicgroup (28). This mutationcreates a

stop codon in exon 20ofthe CF gene, whichislocated in the second nucleotide bindingfoldofthe CFTRprotein.Among patients of Jewish Ashkenazi origin - 25% are homozygous

forthisnonsensemutation.Werecently compared theclinical presentation ofpatientshomozygousfortheW1282X muta-tion and patients heterozygous forboth the AF508 andthe

WI 282X mutations (28). We found that patients in both groups havesimilar severe disease presentation as reflected by

pancreatic insufficiency, high incidence of meconium ileus, earlyage atdiagnosis,poornutritionalstatus,andvariable pul-monaryfunction. Inthisstudy weaimedtodeterminethe ef-fect ofthe nonsensemutation, W1282X, onmRNAlevelsin order todeepenourunderstanding ofthegenotype-phenotype

association in CF.

Methods

Patients and controls. This study included five CF patients

homozy-gousforthe W1282Xmutation,twoCFpatientshomozygousforthe

AF508 mutation,twoCFpatients heterozygousforboth theW1282X

and the AF508mutations,sevenparentsofthe CFpatientscarryingthe

W1282X mutation, and ahealthy Jewish Ashkenazi who does not carry any ofthe mutations knownto account for 97% oftheCF

mutationsinthis ethnicgroup.Thisindividualwasconsidereda

nor-malcontrol.Thepatients'diagnoses hadbeenconfirmed before this study. The diseasepresentationofthepatientshas beendescribed

previ-ously(28).

RNA extraction andsingle-strandcDNAsynthesis.Nasal epithelial

cellswerescraped fromallthe individuals studied.The cellswere imme-diately placedinliquid nitrogen.For RNAextraction the cellswere

resuspended in 300

,d

RNAzolTmBbuffer (BIOTECX Laboratories,

Inc.). Total RNA was extracted using the acid-phenol-chloroform

methodaccordingtothemanufacturer'sinstructions.

RNAwassolubilizedin 10g diethylpyrocarbonate(DEPC)-treated

RNAse-free double-distilledwater.3

_,d

ofthe RNAsolution was added

to2.5MMrandomhexamer mix(PharmaciaFineChemicals, Piscata-way,NJ), 1 mM (each) dNTPs(PharmaciaFine Chemicals), 5 mM

MgCl2,2.5 Uof Moloneymurineleukemiavirusreversetranscriptase (RT) (BethesdaResearchLaboratories, Gaithersburg,MD), and 4 Uof

RNaseinhibitor (Boehringer Mannheim Biochemicals, Indianapolis,

IN). The tubeswereincubatedat room temperaturefor 10 min,at

42°C for15min,at99°C for5 min,andat5°Cfor 5 min. Each setof

cDNAsynthesis experiments includedacontrolsample inwhichall reagents except RNA were present.

Polymerase chain reaction(PCR).The cDNA products were ampli-fied byPCR(29, 30).Theoligonucleotideprimersusedforthe amplifi-cationand theannealingtemperaturesforeachPCRarelisted in Table

I. Each reactionmixture contained the 20ul of cDNA from the RT

reaction, lx Taqbuffer,2.5 Uof Taq polymerase (Boehringer Mann-heimBiochemicals),50 pmol of eacholigonucleotideprimer, and dis-tilledwatertobringthe final volumeto100Ml.For controls, we used 20

M1ofthereaction mixes from the RNA-less samples for cDNA synthesis

(seeprevious section).cDNAsampleswereheatedat94°C for 3 min and thensubjectedto35 cycles of denaturation (94°C for 30 s), primer annealing (as indicated in Table I), and extension (65°C for 30 s), followed_byafinal extension_periodof7min. Nested RT-PCR

prod-ucts were_generatedforsequencingreactions, usingtheoligonucleotide

primersFIR,Fl L,F2R,and F2L. The sequences ofthese

oligonucleo-tides andthePCR conditionshave been describedpreviously (31). Hybridizationwithallele-specificoligonucleotides and PCR

prod-ucts. 20 Mlofeach RT-PCRsampleweresubjectedtoelectrophoresis

on a 1.4% agarosegel. Blots were prepared aspreviously described(28). Filters were hybridizedfor18 hwith 5X 106 cpm/ml of 32P end-labeled oligonucleotides or 5X 101cpm/ml 32Prandom-primed specific geno-mic DNA-PCR products. The blots were washed twice at room temper-aturefor 5min,followed by two 15-min washes at 550C.

Identification ofthe W1282X mutation by MnlI digestion. 25 M1 of

RT-PCRproducts of exons 19-21 wasdigestedwithMnlI restriction

endonuclease for 18 h at370Candsubjected to electrophoresis on 1.7% agarose gels. Blots were prepared andhybridized withexon20genomic

DNA-PCR products asdescribedabove.

RT-PCR sequence determination. Nested RT-PCR products of

exons 19-21 elutedfrom 5%polyacrylamidegelswere extracted with phenol/chloroform and subjected to the dideoxy chain termination

sequencingmethod (32)usingtheSequenasem kit (U. S. Biochem.

Corp.,Indianapolis, IN) with the F2R oligonucleotide as the

sequenc-ing primer.

Results

cDNAreversetranscribedfrom total nasal epithelial RNAwas analyzedin five CF patients homozygous for thenonsense

mu-tation WI282X, twoCFpatientshomozygousfor the AF508 mutation, and anormal individual. The CFpatients

homozy-gousfor the W1282X mutation were 1-32 yr old, all with pan-creaticinsufficiency.Thepulmonarydiseasewasmild insome patients and severe inthe others. Thisvariabilitywasnot

corre-lated with age. Threeregions ofthe CF genewereamplified by

RT-PCR:upstream to the W1282Xmutation,exons9-11

(re-gion I); flankingthemutation, exons 19-21 (region II);and downstream to the mutations, exon 21-23 (region III). The

sequencesof theoligonucleotide primersused in the RT-PCRs

are listedin Table I. No PCRproducts could beseen on the

ethidium bromide-stained agarose gels. Therefore, the RT-PCR products generated fromregionsI,II,orIIIwereblotted and hybridizedto the DNA-PCRproducts ofexon 10, 20, or 21,respectively. The,B-actingene wasamplifiedas acontrol for the overall amount ofRNAextracted from the scrapednasal cells. These amplified productswerehybridized toactin PCR

products. DNA fragments of the predicted sizeswere detected

in all three regions of the CFand the actin genes in allpatients (Fig. 1). The hybridizationresults revealedtheexistence of

RT-PCRproductsfrom CF patients homozygousfor the W1282X

mutation. These resultswere verified by direct sequencingof

the RT-PCR products generatedfrompatients homozygousfor

the W1282X mutation. Nested RT-PCR was performed be-tween exons 19 and 24 (asdescribedinMethods)and the

prod-ucts were directly sequenced. The complete expected cDNA sequence, with the W1282X mutation, was found in all the RT-PCR products from patients homozygous for this

muta-tion (Fig. 2).

To study the relative levels of CFTR transcripts from WI282X, AF508, and the normal alleles, cDNA fromtwo pa-tients heterozygous for boththe AF508and the W1282X mu-tations and fromtwohealthycarriers of the W1282Xmutation wasamplified. In addition, cDNA wasamplifiedfrom thesame

individuals, homozygous for either theW1282X mutation or thenormalallele, as in theprevious experiments. The

ampli-fiedregionwasbetweenexons 19 and21. For

controls,

exon20

Table I.Oligonucleotides for RT-PCR andfor Hybridization

Region Primer(5' 3) Annealing temperature

PCRoligonucleotideprimers

Actin 998 TGAAACAACATACAATTCCATCATGAAGTGTGAC 650C 886 AGGAGCGATAATCTTGATCTTCATGGTGCT

CFTR exons

9-11 X9B TACTCCTGTCCTGMAGA 500C

542N ACCTTCTCCAAGAACT

19-21 C1-1D CCAAACCATACAAGMT 500C

X2 1A GATCACTCCACTGTTCAT

21-23 X21B TTGGATCCCTATGAACAG 500C

X23A TTACTGTGCAATCAGCAA

Washing temperature

Oligonucleotides forhybridization

WN CAACAGTGGAGGAAAG 550C

WM CAACAGTGAAGGAAAG 550C

WM' GGCTTTCCTTCACTGT 550C

theWI282Xmutation,from individuals heterozygousforthe W1282X mutationand a normal allele, andfrom individuals

carryingtwonormalalleles. Only PCR productsfromthe DNA controls could be detected on the ethidium bromide-stained gel,therefore, the PCRproducts were blotted andhybridizedto

specific oligonucleotides detectingeither the W1 282X muta-tion (WM) or the normal sequence at this site (WN) (see Ta-bleI).

Surprisingly,the WI282X alleles could not be detected by the WMoligonucleotidein anyof the RT-PCR products.

Hy-bridization signals ofthepredicted sizesweredetected only on the DNA-PCRcontrols(data not shown). Weak hybridization

signalsweredetected in RT-PCR productsofindividuals carry-ing the normal exon 20 sequences uscarry-ing the WN oligonucleo-tide probe. An'oligonucleotide (WM') from the antisense

strandwasdesignedtodetect theWI282X mutation (TableI),

butnohybridization totheW1282X allelecould be detected with this oligonucleotide either.

Hybridizationtooligonucleotideprobesdesigned to differ-entiate between CF the W1282X allele and the normal allele

was not sensitive enough for our purposes. Therefore, we

1 2 3 4

Figure1. mRNAanalysis byRT-PCR

174 A and subsequent hybridization with

PCRproducts.(Lane 1)Normal

con-trol, (lane2)AF508/AF508,(lane3) 322 * * B W1282X/W1282X,(lane 4)

RNA-W

w J less.(A) RT-PCRproductsof the fl-actin gene.(B)RT-PCRproductsof 402 C exons9-11 (region

I)

oftheCFgene

hybridized

with_genomicPCR

prod-uctsofexon 10.(C)RT-PCR

prod-283283| DD ucts of exons 19-21 (regionII)of the

CF genehybridizedwithgenomic PCRproductsofexon20.(D)

RT-PCRproductsofexons21-23(region III) of the CF genehybridizedwithgenomicPCRproductofexon

21.Thesizes(bp)of the RT-PCRproductsaremarkedontheleft.

adoptedouroriginal technique,inwhichwe detectedRT-PCR products using genomic DNA-PCR products as probes. We tookadvantage of the fact that the W1282X mutationdestroys

arecognitionsite for the restriction enzyme MnlI. Wedigested

theRT-PCRproductsfrom exons19-21with MnlI, before gel electrophoresis, blotting,andhybridization. Tostudy the

rela-tive levelsof CFTRtranscriptsfrom W1282X, AF508 and the normalalleles, relative intensity oftheradioactivebands

repre-sentingtheW1282X and the normal or the AF508 allelesin each lanewereanalyzed.Forthis analysiswehave enlarged the groupof individuals heterozygous fortheW1282X mutation. Thus, in theseexperiments were included two patients hetero-zygous forthe AF508 and W1282X mutations, five healthy

carriersoftheW1282X mutation,threepatients homozygous

for the W1282X mutation, and one patient homozygousfor the AF508 mutation. The RT-PCR productswere fromthe

samebatchesashadfailedtogive signals when hybridized with

G

W/W

GA T C

w.

- ;RS.9

;i ."s

:3

'SC:-P,,+_'*{r

r_#.

._

ru

m...i X .)

...

.w

*L...o..

;

_O

*:

N/N

G A T C

*s

.

. -

_{~~~~~~~~~~~~~~~~~I-O}

.. _

r _-

_-

G-I

Figure 2. RT-PCR sequence around theW1282Xmutation. The

G-*.Amutationis shown in boldface letters. The sequencewas de-rivedfrom thecodingstrand. W/W,mutated sequence derived from

apatient homozygousfor the W1282Xmutation.N/N,normal

se-quence derived from normal control. Thearrowpointstothe cDNA

junctionbetweenexons20 and 21.

oligonucleotide probes (see previous section) and from addi-tional three carriers of the W1282X mutation. The blotswere

hybridizedto exon20genomicDNA-PCR products. The

re-strictionmapoftheamplified region isshownin Fig.3. The

MnlI-digested RT-PCRproductsfromthe heterozygous

indi-vidualsrevealed two bands: one of 204 bp and the other a 99 + 105-bp doublet; the 99- and the 105-bpbands are insepara-bleonthegel(Fig.4). Thefirstbandis the expected size forthe W1282X allele andthe second bandis ofthe expectedsize for the AF508orthe normal alleles. The MnlI-digested RT-PCR products fromindividuals homozygous forthe W1282X

muta-tion revealed only the 204-bp band, and those from individuals homozygous for the AF508 detected only the 99 + 105-bp

doublet. The27-bp band couldnot bedetectedasit migrated

outofthe gel (see Fig. 3). Densitometry analysis oftwo individ-uals heterozygousfortheW1282X and the normal allelesare

presented in Fig. 4, lanes 1 and7. Theanalysis revealedaration

of2:1 fortheWI282Xtothe normal allele in each lane. This experimentwasrepeated by analysis ofthree additional individ-ualsheterozygousfortheWI282X and the normal allele. The

densitometry

analysis revealed also a 2:1 ratio between the

W1282X and the normal allele ineach lane (data notshown). Analysis oftwoindividuals heterozygous fortheW1282Xand

the AF508mutationsarepresented in Fig. 4, lanes2and6. The

analysisrevealed in each lanea1:3 ratiobetweenthe W1282X and AF508 alleles, respectively. Subsequently, thesame blot washybridized to the exon 21 DNA-PCR product, which is

expectedtohybridizetothesame204- and99-bp bands(Figs.3 and4). Thepatternof bandswasidenticaltothat detectedby

theexon20DNA-PCR probe,confirmingthat the105- and the

99-bp bands are indeed inseparable on the gel (data not

shown). In addition, theratio betweentheW1282X and the

AF508 or the normal alleles, in each lane, were the same as

those revealedbyexon20 DNA-PCRprobe.In summary, our

results show that inpatientsheterozygousfortheW1282X and the AF508orthenormalalleles,similarlevelsofmRNAfrom

thetwoallelesarefound in eachindividual. Discussion

Inthis studywepresent ananalysis ofthe CF mRNA levels in nasalepithelial cells from CF patients carrying thenonsense

mutation,W1282X.Altogether, 19 CF chromosomes carrying the WI282X mutation were studied, from patients with variousdegreesofpulmonarydisease. Understandingthe effect

ofthenonsensemutationW1282Xon mRNAlevelsis

signifi-cant totheunderstandingof the phenotype-genotype associa-tion in thisgroupofpatients.cDNAreversed transcribed from

1982271 204

p-89-i--- 82-+27-i---- 105 -+--- 99 -4

j exon 19 3 exon20

M exon21 Figure 3. RT-PCR map of exons 19-21 (regionII).TheMnlIsites are represented by vertical bars. The polymorphic site, which is destroyed

bytheW1282Xmutation, is represented by a thick bar. The sizes of thedigested fragmentsareindicated above.

1

2

3

4

5 6 7 8

Figure 4.Analysis of relativemRNAlevelsin heterozygous

individ-ualscarryingthe W1282Xmutation.Hybridizationof DNA-PCR

productsofexon20with MnlI digested RT-PCRproductstfrom

re-gionIIgenerated from:twohealthy individuals heterozygous forthe W1282Xmutation (lanes I and 7); two CFpatients heterozygous for

theW1282XandAF508mutations (lanes2and6);threeCFpatients homozygousfortheW1282Xmutation (lanes 3, 4,and8);andaCF patienthomozygousforthe AF508mutation (lane 5).Thesizes (bp) ofthedigested fragmentsareindicated.

nasal epithelial total RNA was revealed in five CF patients

homozygousforthenonsensemutation W1282Xusingexon 20 DNA-PCR products as probes.The

hybridization

results revealed theexistence ofRT-PCRproducts fromCF

patients

homozygousforthe W1282Xmutation(Fig. 1). Furthermore, sequencing ofthecDNA-nested PCRproducts

generated

from the homozygous patients carrying the W1282X mutation

showed the expected sequence with the W1282X mutation

(Fig. 2). Theseresultsindicatethat the levelofmRNA in

pa-tients homozygousfortheW1282X mutation is notseverely

reduced by theprematureterminationmutation,aswasfound fortermination mutationsin othergenes.

Exonskippingduetomissenseandnonsensemutationshas been shown in severalgenes(33-35).The results ofourstudy

also exclude the possibility of exon skipping due to the

W1282Xnonsense mutation.

We initially examined the relative levels ofmRNA

tran-scripts

inindividuals heterozygous for the WI282X and the

AF508 or the normal alleles byallele-specific oligonucleotide

hybridization. Unexpectedly, the RT-PCR products of the

W1282Xallele couldnotbedetected. Even RT-PCR products thathadpreviouslybeendetectedbyexon20DNA-PCR

prod-uct astheprobecouldnotbe detectedbyallelespecific

oligonu-cleotidehybridization. The reasonfor thisdiscrepancyisnot clearto us.Itmightbe theresultof interference by secondary

structureofthe

oligonucleotide,

theinability ofthe

oligonucleo-tidetodetect low levelsofRT-PCRproducts,orboth. However,we wereabletodetecttheexpectedsizeRT-PCR bands generated from individuals heterozygous for the

W1282X mutationbyMnlI digestionand subsequent

hybrid-izationtoexon 20 and 21 DNA-PCR products. In

heterozy-goteswhocarryboth the W1282X and the normalalleles,the levelsofthe RT-PCRfromtheW1282X alleleswereslightly higher than those ofthe AF508 alleles(ratio of 2:1,

respec-tively).Inheterozygotes whocarry theW1282Xand theAF508 alleles,thelevelsoftheRT-PCRfrom theW1282X allelewere

slightly lowerthan thosefrom the AF508 allele (3:1,

respec-tively).Sincethenumber ofpatientsin eachgroupwassmall,

thesignificanceof these fluctuationscould not beevaluated.It

is, however, clear that themRNAlevelsoftheW1282X allele

are notseverely reduced. Furthermore,ourresults indicatethat

negative

hybridization

resultsusing oligonucleotidesasprobes

mustbeconfirmed by other methods.

Recently, Rolfini et al. (36) reported that in patients homo-zygousforanother nonsensemutation in exon 20, RI262X,

the mRNAlevels seems very similar to those obtained in nor-mal and AF508 homozygous patients. In addition, Hamosh et al. (37) reported that patients heterozygous for the W1282X mutation have severe deficiencyofmRNA derived from the W1282X allele. This conclusion was based on hybridization with an oligonucleotide specific for the W1282X mutation. Severe deficiency of mRNA derived from another nonsense mutation, G542X, was also reported in that study. In addition, in a previous study (27), severe deficiency of mRNA of the R553X and W1316X mutations was reported; these

conclu-sionswere also based on hybridization tooligonucleotides. Fur-therstudiesusingdifferent detectiontests are needed to verify the conclusions from the negative results obtained for the G542X,W1316X, and the R553X mutations.

The results of our study on CF patients carrying the W1282X mutation together with the results of the study on

patients homozygous forthe R1262X mutation suggest that

mutations in exon 20 ofthe CFTR gene have no effect on mRNA levels. Since these two mutations are located towards the 3' endof the gene, the resultsarecompatiblewith the polar

effects ofnonsensemutations foundin other genes(16). How-ever, more studies on the effects of nonsense mutations to-wards the 5' endof the CF gene are needed before general

con-clusionscanbedrawn. Itis expectedthatatruncatedprotein

would be producedfrom theW1282Xand the R 1262X alleles.

Patients homozygous for the W1282X mutation were

foundto have severepresentationsof the CFdisease,like

pa-tientshomozygousforthe AF508mutation(28). The resultsof

our study indicate that the severe clinical phenotype is not necessarily due to a null phenotyperesulting fromsevere

defi-ciency ofmRNA.Inaddition,it isimportanttoemphasizethat thepulmonary disease of thepatientsinthis studyvariedand was not correlated with age. The oldestpatientin the group was 35 yr old andhis pulmonary diseasewasrathermild

(forced

expiratory volume in 1 s =

_45%).

We have shown that this variabilityin thepulmonary diseaseisnot aresultof variable

mRNAlevels.Thus,the

severity

progression

and

variability

of

pulmonarydiseaseareaffected by other,asyet unknown

fac-tors.

Acknowledgments

Wethank Drs.Lap-CheeTsui,JohannaRommens,and Ann Harrisfor providingoligonucleotideprimers,and Dr.Shoshana Kleinfor

_helpful

discussions.

This studywassupportedbygrantsfrom the_ThyssenFoundation

and theIsraeliFoundation for Sciences and Humanities(toB._Kerem).

References

1.Lehrman,M.A., W.J.Schneider,M.S.Brown,C. G.Davis,A.Elhammer, D.W.Russell, and J. L.Goldstein.1987. The Lebanese alleleatthe lowdensity lipoproteinreceptor locus. J.Biol. Chem.262:401-410.

2. Fojo,S.S., P. Lohse,C. Parrott, G.Baggio,C. Gabelli,F.Thomas, J.

Hoffman,andH.B.Brewer, Jr. 1989.A nonsensemutation in theapolipoprotein

CIIgene inapatientwithapolipoprotein deficiency.J.Clin. Invest. 84:1215-1219.

3.Nilsson,G.,J.G. Belasco, S. N.Cohen, andA.vonGabain. 1987. Effect of premature termination of translation on mRNA stability depends on the site of ribosome release. Proc.Nat!.Acad. Sci. USA.84:4890-4894.

4. Losson,R., and F. Lacroute. 1979.Interference ofnonsensemutationswith

eukaryoticmessenger RNAstability.Proc.Nat!. Acad. Sci.USA.76:5134-5137.

5.Baumann,B., M. J.Potash,andG. Kohler.1985.Consequences of frame-shiftmutations at theimmunoglobulin heavychain locus ofthemouse.EMBO

(Eur.Mol.Biol.Organ.)J.4:351-359.

6.Atweh,G.F.,H. E.Brickner,X.-X.Zhu,H.H.Kazazian, Jr., andB.G.

Forget.1988.Newamber mutationinafl-thalassemicgenewith nonmeasurable

levels of mutant messenger RNA invivo.J.Clin.Invest.82:557-561.

7.Baserga, S.J., and E. J.Benz,Jr.1988.Nonsensemutationsinthe human

beta-globingeneaffectmRNAmetabolism.Proc.Nat!. Acad. Sci. USA.

85:2056-2060.

8.Humphries,R. K., T. J.Ley,N. P.Anagnou,A.W.Bauer,and A. W.

Nienhaus. 1984.fl'-Thalassaemiagene: aprematuretermination codoncauses (J-mRNA deficiency without affecting cytoplasmicfl-mRNAstability. Blood. 64:23-32.

9.Moschonas,N.,E.DeBoer,F.G.Grosveld,H. H. M.Dahl,S.Wright,C. K. Shewmaker,and R. A.Flavell.1981.Structure andexpressionofcloned

Pthalas-semicglobingene.Nucleic AcidsRes.9:4391-4401.

10. Orkin, S. H.,andS.Goff. 1981.Nonsense andframeshift mutations in ,B°-thalassaemiadetected incloned fl-globingenes. J.Biol. Chem. 256:9782-9784.

11.Takeshita, K.,B.G. Forget,A.Scarpa, andE. B.Benz,Jr.1984. Intranu-cleardefectinfl-globinmRNAaccumulation dueto aprematuretranslation terminationcodon.Blood. 84:13-22.

12.Daar, I. O., and L. E.Maquat. 1988.Prematuretranslation termination mediates triosephosphateisomerasemRNAdegradation.Mol.Cell. Biol. 8:802-813.

13.Globerman, H.,M. Amor, K. L.Parker,M.I.New,and P.C.White.1988. Nonsense mutationcausingsteroid21-hydroxylasedeficiency.J. Clin.Invest.

82:139-144.

14. Maquat, L.E.,A.J.Kinniburgh,E. A.Rachmilewitz,and J. Ross.1981. Unstable,B-globinmRNA inmRNA-deficient°thalassaemia.Cell. 27:543-553.

15.Urlaub,G.,P.J.Mitchell,C.J.Ciudad,andL. A.Chasin.1989. Nonsense

mutations inthedihydrofolatereductase geneaffectRNAprocessing.Mol. Cell. Biol. 9:2868-2880.

16.Atwater, J.A.,R.Wisdom,andI.M. Verma. 1990.RegulatedmRNA

stability.Annu.Rev.Genet. 24:519-541.

17.Ramirez, F.,D.Starkman,A.Bank,H.Karem, G.Cividalli,and E. A.

Rachmilewitz. 1978. Absenceof,B mRNAinf"thalassaemia in KurdishJews.

Blood. 52:735-739.

18.Boat,T.F.,M. J.Welsh,and A. L. Beaudet.1989.Cysticfibrosis.InThe

Metabolic Basis of Inherited Disease. 6thed.C.L.Scriver,A.L.Beaudet,W.S. Sly, andD.Valle,editors. McGraw-HillInc.,NewYork. 2649-2680.

19. Rommens, J.M.,M.C.Iannuzzi,B.Kerem,M.L.Drumm,G.Melmer,

M.Dean, R.Rozmahel,J. L.Cole,D.Kennedy,N.Hidaka,M.Zsiga,M.

Buch-vald, J. R.Riordan, and L.-C. Tsui. 1989. Identification oftheCysticfibrosis

gene:chromosomewalkingandjumping.Science(Wash.DC).245:1059-1064. 20.Riordan,J.R.,J. M.Rommens,B.Kerem,N.Alon,R.Rozmahel,Z.

Grzelczak,J. Zielenski,S.Lock,N.Plavsic,J-L.Chou,M.C.Drumm,M.C. lannuzzi,F.S.Collins,and L.-C.Tsui 1989.Identification oftheCysticfibrosis

gene:cloningandcharacterization ofcomplementaryDNA.Science(Wash. DC).

245:1066-1073.

21.Kerem, B.,J. M.Rommens,J. A.Buchanan,D.Markiewicz,T. K.Cox,

A.Chakravarti,M.Buchwald,andL-C.Tsui.1989.Identification oftheCystic

fibrosisgene:geneticanalysis.Science(Wash.DC).245:1073-1080.

22.Kerem, B.,J.A.Buchanan,P.Durie,M. L.Corey,H.Levison,J. M. Rommens, M.Buchwald,andL-C.Tsui. 1989.DNAmarkerhaplotype associa-tionwithpancreaticsufficiencyincysticfibrosis.Am.J.Hum. Genet.

44:827-834.

23. Kerem,E., M.Corey,B. Kerem,J. M. Rommens,D.Markiewicz, H.

Levison, L-C.Tsui,and P.Durie. 1990. Therelationshipbetweengenotypeand

phenotype incysticfibrosis-analysisofthemostcommonmutation(AF508).N.

Engl.J.Med.323:1517-1522.

24.Santis, G.,L.Osborne,R.A. Knight,and M. E. Hodson. 1990. Linked markerhaplotypesand theAF508mutation in adults with mildpulmonary

dis-easeandcysticfibrosis.Lancet.335:1426-1429.

25.Tsui,L-C. 1992. The spectrum ofcysticfibrosismutations. TrendsGenet.

8:392-398.

26.Kristidis, P.,D.Bozon,M.L.Corey,D.Markiewicz,J.Rommens,L-C.

Tsui,and P.Durie. 1992.Genetic determination of exocrinepancreaticfunction incystic fibrosis.Am.J. Hum.Genet. 50:1178-1184.

27.Hamosh, A.,B.C.Trapnell,P. L.Zeitlin,C.Montrose-Rafizadeh,B. J.

Rosenstein,R.G.Crystal,and G. R.Cutting. 1991.Severedeficiencyofcystic

fibrosistransmembrane conductanceregulatormessenger RNA carrying

non-sense mutationsR553XandW1316X inrespiratory epithelialcellsof_patients withcysticfibrosis. J. Clin.Invest. 88:1880-1885.

mutation (W 1282X), themostcommonmutationin theAshkenazi Jewishcystic

fibrosis patientsinIsrael,withpresentationofsevere disease. Am.J.Hum. Genet. 50:222-228.

29. Saiki, R. K.,S.Scharf,F.Faloona,K. B.Mullis,G. T.Horn,H. A.Erlich,

and N. Arnheim. 1985. Enzymatic amplification ofbeta globin genomic se-quences andrestriction site analysisfordiagnosisofsicklecellanemia.Science

(Wash.DC).230:1350-1354.

30.Saiki,R.K.,S. H.Gelfand,S.Stoffel,S. J.Scharf,R.Higuchi,G. T.Horn,

K. B.Mullis,andH. A.Erlich. 1988.Primer-directedenzymatic amplification of DNAwith a_{thermostable DNA polymerase. Science (Wash. DC). 239:487-491.} 31.Chalkley,G., and A.Harris. 1991. Lymphocyte mRNAas aresourcefor detection ofmutationsandpolymorphisms in the CF gene. J. Med. Genet. 28:777-780.

32.Winship,P. R.1989. An improved methodfordirectly sequencingPCR

amplified material using dimethyl sulfoxide. Nucleic Acids Res.17:1266-1269. 33. Dietz, H. C., D. Valle, C. A.Francomano,R. J. Kendzior,Jr., R. E.

Pyeritz,and G. R._Cutting. 1993.The_skippingofconstitutiveexonsin vivo

inducedbynonsensemutations. Science(WashDC).259:680-686.

34.Matsuo, M.,T.Masumura,H.Nishio,T.Nakajima,Y.Kitoh,T.Takumi,

J.Koga,and H.Nakamura. 1991. Exon_{skipping during splicing}ofdystrophin

mRNAprecursorduetoanintraexon deletionin the_dystrophingene of Du-chenne musculardystrophykobe. J. Clin. Invest.87:2127-2131.

35.Wakamatsu, N.,H.Kobayashi,T.Miyatake,and S._Tsuji.1992.A novel

exonmutation in thehumanfl-hexosaminidase Psubunitgeneaffects3'splice

site selection. J._Biol.Chem.267:2406-2413.

36._{Rolfini, R.,}M. C.Dechecchi,A.Tamanini,and G.Cabrini. 1992.

Detec-tion of_CFTRmRNAin nasal_polypfroma

_Rl

162XCFhomozygote.Pediatr. Pulmonol. S8:253.

37.Hamosh,A.,B. J.Rosenstein,and G. R._Cutting. 1992. CFTRnonsense

mutations G542XandW1282XareassociatedwithseverereductionofCFTR mRNAin_{respiratory epithelial cells.}Hum. Mol. Genet. 1:542-544.