MicroRNA-137 represses Klf4 and Tbx3 during differentiation of mouse embryonic stem cells

15 

Loading.... (view fulltext now)

Loading....

Loading....

Loading....

Loading....

Full text

(1)

MicroRNA-137 represses Klf4 and Tbx3 during

differentiation of mouse embryonic stem cells

Ke Jiang

a

, Chunyan Ren

b

, Venugopalan D. Nair

a,

aDepartment of Neurology, Mount Sinai School of Medicine, New York, NY 10029, USA b

Graduate School of Biological Sciences, Mount Sinai School of Medicine, New York, NY 10029, USA

Received 19 December 2012; received in revised form 5 September 2013; accepted 5 September 2013 Available online 13 September 2013

Abstract MicroRNA-137 (miR-137) has been shown to play an important role in the differentiation of neural stem cells. Embryonic stem (ES) cells have the potential to differentiate into different cell types including neurons; however, the contribution of miR-137 in the maintenance and differentiation of ES cells remains unknown. Here, we show that miR-137 is mainly expressed in ES cells at the mitotic phase of the cell cycle and highly upregulated during differentiation. We identify that ES cell transcription factors, Klf4 and Tbx3, are downstream targets of miR-137, and we show that endogenous miR-137 represses the 3′ untranslated regions of Klf4 and Tbx3. Transfection of ES cells with mature miR-137 RNA duplexes led to a significant reduction in cell proliferation and the expression of Klf4, Tbx3, and other self-renewal genes. Furthermore, we demonstrate that increased miR-137 expression accelerates differentiation of ES cells in vitro. Loss of miR-137 during ES cell differentiation significantly impeded neuronal gene expression and morphogenesis. Taken together, our results suggest that miR-137 regulates ES cell proliferation and differentiation by repressing the expression of downstream targets, including Klf4 and Tbx3.

© 2013 Elsevier B.V. All rights reserved.

Introduction

Embryonic stem (ES) cells have the remarkable ability to replicate indefinitely while retaining the capacity to differentiate into functionally distinct cell types including neurons. The pluripotency and self-renewal of ES cells are regulated by a core transcriptional circuitry comprising of transcription factors, chromatin modulators, and small non-coding microRNAs (miRNAs) (Dejosez and Zwaka, 2012; Li

et al., 2012; Pauli et al., 2011). The self-regulatory networks formed by transcription factors such as Oct4, Sox2, Nanog, Klf4, Esrrb, Tbx3, and Tcf3 regulate a wide range of downstream genes required for self-renewal and pluripotency (Boyer et al., 2005; Chambers and Tomlinson, 2009; Ivanova et al., 2006; Kim et al., 2008; Silva and Smith, 2008). In addition to the transcription factors, epigenetic changes associated with posttranslational modifications of histone proteins are known to regulate gene expression in ES cells (Li et al., 2012). Abbreviations: ES cells, embryonic stem cells; NC, neuronally differentiated ES cells; EB, embryoid body; LIF, leukemia inhibitory factor;

miRNA, microRNA; 3′UTR, 3′ untranslated region; LSD1, lysine specific demethylase 1; Tuj1, neuronal class III β-tubulin 3; RT, reverse

transcription; qPCR, quantitative real-time polymerase chain reaction; ddPCR, droplet digital PCR; DAPI, 4,6-diamidino-2-phenylindole dihydrochloride; PBS, phosphate buffered saline; SSC, saline-sodium citrate.

⁎ Corresponding author at: Dept. of Neurology, Mount Sinai School of Medicine, Annenberg 14-72, Box 1137, One Gustave L. Levy Place, New York, NY 10029, USA. Fax: + 1 212 289 4107.

E-mail address:venugopalan.nair@mssm.edu(V.D. Nair).

1873-5061/$ - see front matter © 2013 Elsevier B.V. All rights reserved.

http://dx.doi.org/10.1016/j.scr.2013.09.001

A v a i l a b l e o n l i n e a t w w w . s c i e n c e d i r e c t . c o m

ScienceDirect

(2)

Moreover, by directly interacting with ES cell transcription factors, miRNAs are shown to regulate the central signaling circuitry in ES cells (Pauli et al., 2011). The genetic deletion of key miRNA processing enzymes such as Dicer or Dgcr8 has been shown to impair cell cycle progression and cause defective differentiation (Murchison et al., 2005; Wang et al., 2008). Studies on the role of miRNAs in ES cells suggest that the regulatory function of the miRNA is often regulated through, and controlled by, various transcrip-tion factors important for self-renewal and pluripotency (Marson et al., 2008; Melton et al., 2010; Tay et al., 2008; Xu et al., 2009). An understanding of the interactions among these factors will be critical for the development of improved strategies to reprogram differentiated cells or induce differentiation of pluripotent ES cells to function-ally distinct cell types.

miRNAs are short non-coding RNAs that can modulate gene expression by binding to the complementary se-quences on target sites in the 3′ untranslated regions (UTRs) of messenger RNA (Bartel, 2004). There is strong evidence that miRNAs play an important role in the maintenance of ES cells (Pauli et al., 2011). In ES cells, a majority of the miRNA species are produced by 4 miRNA loci (the miR-21, the miR-17-92 cluster, the miR-15b-16 cluster and the miR-290-295 cluster) that regulate cell cycle progression and oncogenesis (Calabrese et al., 2007). During differentiation, a number of miRNAs exhibit distinct expression patterns and have been shown to fine tune or restrict cellular identities by targeting important tran-scription factors or key pathways (Stefani and Slack, 2008). For example, miRNA-145 has been shown to repress Oct4, Sox2, and Klf4 during differentiation of human ES cells into mesoderm and ectoderm lineages (Xu et al., 2009). Furthermore, miR-134, miR-296, and miR-470 target the transcription factors Nanog, Oct4, and Sox2 to promote retinoic-acid-induced differentiation of mouse ES cells (Tay et al., 2008). The contribution of additional miRNAs involved in the direct repression of ES cell transcription factors during neuronal differentiation remains unknown. We searched for miRNAs that show increased expression levels during neuronal differentiation and are predicted to target ES cell genes. The expression of miR-137 has been found to increase during differentiation of neural stem cells into neurons (Sun et al., 2011b; Szulwach et al., 2010). Moreover, miR-137 is one of the two miRNAs in ES cells that are co-occupied by the key transcription factors: Oct4, Sox2, and Nanog (Boyer et al., 2005). These findings suggest that miR-137 may be an important component of the transcriptional regulatory circuitry, and that temporal expression of miR-137 may influence proliferation and differentiation of ES cells.

Here, we show that miR-137 is mainly expressed in ES cells at mitotic stages of the cell cycle and is significantly upregulated when ES cells are differentiated into neuronal lineage. We demonstrated that miR-137 directly targets the ES cell transcription factors, Klf4 and Tbx3, as well as a known miR-137 target, lysine specific demethylase 1 (LSD1) (Balaguer et al., 2010; Sun et al., 2011b). The repressive effect of miR-137 is mediated by its binding to the target sites present in the 3′ untranslated regions (3′UTRs) of the mRNAs. Furthermore, we found that miR-137 disrupts ES cell self-renewal and accelerates differentiation of ES cells in vitro.

Materials and methods

ES cell culture and differentiation

R1 ES (ATCC) and Dgcr8−/−(Novus Biologicals) cells were maintained on mitomycin C treated MEF feeder layers and differentiated in vitro as described previously (Melton et al., 2010; Nair, 2006). Briefly, undifferentiated ES cells were grown on gelatin-coated tissue culture plates in the presence of 1000 U/ml leukemia inhibitory factor (LIF; Chemicon) in ES cell medium. To induce embryoid body (EB) formation, the cells were trypsinized and dissociated to a single-cell suspension and plated in ES cell medium without LIF onto non-adherent bacterial culture dishes at a density of 2–2.5 × 106 cells/dish. Four-day-old EBs were

plated onto adherent tissue culture dishes and maintained in ES cell medium for 24 h. The selection of nestin-positive cells was initiated by replacing the ES cell medium with serum-free insulin/transferrin/selenium medium. Cells grown in differentiation medium for 12–14 days were used in all experiments.

Western immunoblotting

Total cell extracts were prepared and Western immunoblotting was carried out as described in our previous publication (Nair et al., 2012). Western blots of Klf4, Tbx3, LSD1, CoREST, RXRα, GAPDH, andβ-actin were performed using anti-Klf4 (Millipore; 09-821), Tbx3 (SCB: sc-48781), LSD1 (CST; 2139), CoREST (Millipore; 07-455), RXRα (SCB; sc-553), anti-GAPDH (SCB; sc-166545), and β-actin (SCB; sc-166545) antibodies. All horseradish peroxide-conjugated secondary antibodies were from Santa Cruz Biotechnology.

Quantitative real-time PCR

Quantitative real-time PCR (RT-qPCR) was carried out to measure gene expression as described in our previous publica-tion (Nair et al., 2012). Briefly, RNA was isolated using an Absolutely RNA preparation kit (Agilent Technologies) and reverse transcribed using the Superscript™ III first-strand synthesis system (Invitrogen). SYBR green qPCR reactions on resulting cDNAs were performed on an ABI 7900HT (Applied Biosystems). Gene-specific primers used for RT-qPCR are shown inTable 1.β-Actin, α-tubulin, and Rps11 were used as internal normalization controls.

For RT-qPCR assays of miRNAs, total RNA was prepared using mirVANA miRNA isolation kit (Ambion). cDNA was synthesized from 100 ng of total RNA using miRNA specific RT primers and the expression was quantified using TaqMan MicroRNA Kits according to the manufacturer's protocol (Applied Biosystems). RT-qPCR assays using TaqMan Assay Kits, mmu-miR137 (ID 001129), hsa-miR16 (000396), and mouse snoRNA (001232) were used to determine the expression of miR-137, miR-16, and snoRNA, respectively. Relative fold mRNA and miRNA levels were determined by the 2− ΔΔCT (cycle threshold) method (Nair et al., 2012). The expression levels of each miRNA in undifferentiated ES cells (ESC) were arbitrarily set to one.

(3)

Droplet digital PCR

miRNA levels were measured by digital PCR using the QuantaLife droplet digital PCR (ddPCR) system (Nair et al., 2012). Briefly, 20μl of ddPCR mixtures was prepared by combining the respective reverse transcription (RT) product, primers, and probes with the QuantaLife master mix. Approx-imately 10,000 to 14,000 monodispersed droplets for each sample were prepared using the QuantaLife droplet generator. The droplets were transferred to a 96-well PCR plate and amplified to endpoint using the following conditions: 95 °C for 10 min, 40 cycles of 94 °C for 30 s, 60 °C for 1 min, and 98 °C for 10 min in a standard thermal cycler (PTC100; MJ Research). Plates were read in a QuantaLife droplet reader, and the concentrations (copy numbers) of the targets in the samples were determined using QuantaSoft software. The expression levels of each miRNA in vehicle-treated cells (control) were arbitrarily set to one.

3′UTR luciferase reporter constructs

To make the luciferase reporter constructs with LSD1 3′ UTR, full-length cDNA, corresponding to the 3′UTR of LSD1 (2665–2999 bp), was amplified from mouse ES cell mRNA by PCR. The product was sub-cloned into the pDrive vector (Qiagen), and we confirmed the sequences. The 3′UTR was then excised by Mlu1-HindIII digestion and cloned into the pMIR-REPORT Luciferase vector (Ambion). To generate a LSD1 3′UTR luciferase reporter construct-lacking miR-137 binding site, we deleted the miR-miR-137 target site 5′-TAGCAATA-3′ by using a site-directed mutagenesis kit with overlapping mutated primers 5′-CTGCCACGTAAG CAAGCTCTTCCTAGATCCTACTGAGAAACTCCATG-3′ and 5′-CATGGAGTTTCTCAGTAGGATCTAGGAAGAGCTTGCTTACGTG

GCAG-3′, according to the manufacturer's instructions (Promega). Klf4 3′UTR luciferase reporter was constructed by cloning the PCR-amplified DNA corresponding to 714– 790 bp of mouse Klf4 3′UTR, flanking the miR-137 binding site (753–759 bp) into the pDrive vector. The Klf4 3′UTR was then excised by HindIII/Spe1 digestion and cloned into the pMIR-REPORT luciferase vector. We deleted the miR-137 target site 5′-GCAATAA-3′ at the KLf4 3′UTR by using a site-directed mutagenesis kit with overlapping mutated primers 5′-TTATGCACTGTGGTTTCAGATGTTTTGT ACAAT-GGTTTATT-3′ and 5′-AATACGTGACACCAAAGTCTAC AAAACATGTTACCAAATAA-3′. Nucleotide sequences of all 3′UTR constructs were confirmed by DNA sequencing. The Tbx3 3′UTR wild type with miR-137 binding site (8 bp GCAATAAC, 862–869) and Tbx3 3′UTR with mutant miR-137 sites (866– 869 bp), Oct4 3′UTR, and Sox2 3′UTR constructs used in the study were reported previously (Xu et al., 2009; Zhang et al., 2011).

Luciferase reporter assay

ES cells growing on gelatinized plates in LIF media were used in transfection experiments. We plated 30,000 wild type (R1 ES) or 40,000 Dgcr8−/−ES cells per well in a 48-well plate and let them grow for at least 16 h before transfection. For transfection experiments, we transfected a mixture of 250 ng of reporter to each well using Lipofectamine 2000, according to the manufacturer's instructions (Invitrogen). The pSV-β-Galactosidase Vector (Promega) was used as a control plasmid for monitoring transfection efficiencies. In co-transfection experiments, luciferase reporters were transfected with 10–200 nM of mature miR-137 RNA duplexes (UUAUUGCUUAAGAAUACGCGUAG; Dharmacon, C-310413-05), miR-137 inhibitor (Dharmacon, IH-310413-07), or a combination

Table 1 RT-qPCR primer sequences.

Gene name Sense primer Antisense primer

Klf4 GTCAAGTTCCCAGCAAGTCAG CATCCAGTATCAGACCCCATC

Tbx3 TGGCTCAGTGTCCTTGTCAC ACTGGAATGGAGAGACCTTGG

LSD1 CACAGCAGTCCCCAAGTATGT GCCTCTGCTGTCAAACTAGGA

Oct 4 CCCACTTCACCACACTCTACT GCTCCAGGTTCTCTTGTCTA

Nanog CCACCAGGTGAAATATGAGAC GGCTCACAACCATACGTAAC

Sox2 CCGTGATGCCGACTAGAAAAC AGCGCCTAACGTACCACTAG

REST AAGGAACCACCTCCCAGTATG CGTCTGAGCAACCTCAATCTG

CoREST GCCTCATTCACCTTTCCTTC CCAACCCTTCTTTCTCCAAAC

Calb1 TGCCAGAGAGTATGACCATAG GGAAGTAGGCAAACTAGACAC

Kcnn1 TCACCTTCAACACACGCTTC GCTGGTCACTTCCTGCTTATC

RXR GCAAACACAAGTACCCTGAGC CATCTCCATGAGGAAGGTGTC

Scn3a TTGCCTAACATGATACAACTC TTGGCTCAATAACGAAGTAG

Slc1a3 TGTGCTTGTTTATGTCCCTACC TCTCCTGCTGTGTTTTCTTCC

NeuroG2 GACTCCACTTCACAGAGCAGAG CACGCCATAGTCCTCTTTGAC

Rps11 GCACATTGAATCGCACAGTC CGTGACGAAGATGAAGATGC

α-Actin CTGCGCAAGTTAGGTTTTGTCAA GCTGCCTCAACACCTCAAC

β-Tubulin AG CTGGAGCAGTTTGACGACAC TGCCTTTGTGCACTGGTATG

Brachyury TTACACACCACTGACGCACAC AGGCTATGAGGAGGCTTTGG

Sox17 GCAACTACCCCGACATTTGAC CAAAACAGCTTGACGCTAAGG

Mixl1 TCTTCCGACAGACCATGTACC TGAAATGACTTCCCACTCTGG

Sox1 TCTCCAACTCTCAGGGCTACA ACTTGACCAGAGATCCGAGG

(4)

of both using Lipofectamine 2000. Cells were lysed 24–48 h later, and processed for luciferase andβ-galactosidase assays using Dual-Luciferase Reporter Assay System (Promega) and β-Galactosidase Enzyme Assay System (Promega), respectively. The luciferase activity was measured using a Mithras LB 940 luminometer (Berthold Technologies), and β-galactosidase activity was measured at 420 nm using a spectrophotometer (Spectra Max Gemini XS, Molecular Devices).

Fluorescent in situ hybridization

Mouse ES cells were grown on gelatin-coated cover glasses which were fixed and permeabilized as described previ-ously (Nair et al., 2012). For the detection of miR-137, the cells were hybridized with 5′-fluorescein labeled LNA detection probe (Exiquon, #38510-04) overnight in 50% formamide/5 × SSC at 50 °C. The cells were washed three times with 50% formamide/2 × saline-sodium citrate (SSC), three times with 2 × SSC, and three times 0.2 × SSC at 50 °C. The cells were washed with phosphate buffered saline containing 0.1% Tween 20 (PBST), and the nuclei were stained with 1μg/ml (in PBS) of the fluorescent DNA dye 4, 6-diamidino-2-phenylindole dihydrochloride (DAPI) for 10 min and mounted in the Vectashield (Vector Laboratories) mount-ing medium. The slides were examined under an Olympus (BX65) upright epifluorescence microscope.

Alkaline phosphatase staining

R1 ES cells were transfected with mature miR-137 duplexes, inhibitor, or a combination of both, and grown in complete ES medium and LIF for 5 days. Staining for alkaline phosphatase in these cells was carried out using an alkaline phosphatase detection kit according to the manufacturer's instructions (Chemicon, Millipore).

Immunocytochemistry

Cells were permeabilized and incubated with primary anti-bodies at 4 °C overnight as described previously (Nair et al., 2012). Primary antibodies used were a rabbit polyclonal LSD1 (dilution 1:400), Tuj1 mouse monoclonal anti-body (Covance; MMS-435P; 1:1000), anti-Nanog (BD Biosci-ence; 560259; 1:400), anti-histone H3 (CST; 9715; 1:500), and anti-cytochrome c monoclonal antibody (BD Pharmingen; 556432, 1:400). After washing with PBST (PBS with 0.1% Tween20), the cells were incubated at room temperature for 2 h with Alexa Fluor 568 donkey anti-rabbit IgG or Alexa Fluor 488 goat anti-rabbit/mouse IgG (Molecular Probes, dilution 1:400) as indicated. The slides were processed and images were acquired as described in our previous publication (Nair et al., 2012).

Cell cycle synchronization

To synchronize cells to metaphase, R1 ES cells were first grown to about 60% confluency in complete ES medium. Prior to the addition of 100 ng/ml nocodazole or vincristine, the medium was replaced with serum-free ES cell medium and incubated for 16–18 h. Synchronization and cell cycle

state were confirmed as described previously (Nair et al., 2012) and used for the analysis of miR-137 expression.

Cell proliferation assay

For cell proliferation analysis, cells were plated at a density of 2 × 104cells/well on 6, 96-microwell cell-culture plates (in

100μl of medium). The next day (D0), cells were transfected with mature miR-137 RNA duplexes (100 nM), miR-137 inhibitor (50 nM), or a microRNA inhibitor negative control (Dharmacon, IN-001005-01; 50 nM) and grown for 5 days. Media was changed daily and the cell proliferation was determined on day 0, 1, 2, 3, and 4 using CellTiter-Blue™ reagent (Promega, Madison, WI). The fluorescence was quantified using a spectrofluorometer (Spectra Max Gemini XS, Molecular Devices) by measuring the fluorescence at excitation/emission wavelengths of 570/ 590 nm. Data are expressed as a percentage of the vehicle-treated controls, and values represent the means ±s.e.m. from eight microwells from each of two independent experiments (n = 16).

Statistical analysis

The data were analyzed using the GraphPad Prism data analysis program (GraphPad Software, San Diego, CA). For the comparison of statistical significance between two groups, Student's t tests for paired and unpaired data were used. For multiple comparisons, one-way ANOVA followed by post hoc comparisons of the group means according to the method of Tukey was used.

Results

miR-137 is enriched in ES cells at the mitotic phase of the cell cycle

miRNAs are small non-coding RNAs that are shown to regulate pluripotency and self-renewal by interacting with the 3′UTR of key transcription factors in ES cells (Pauli et al., 2011). To assess the potential miRNA interaction with key ES cell genes, we sought miRNAs that are regulated by ES cell transcription factors and could interact with RNA recognition sites in the 3′ UTR of these genes. We performed bioinformatics analyses using TargetScan (Lewis et al., 2003) to identify potential miRNA candidates that have the capacity to interact with the 3′ UTR of ES cell genes. One candidate miRNA, miR-137, was selected for further analysis on the basis of its regulation by Oct4, Sox2, and Nanog (Boyer et al., 2005) and the presence of target sites in the 3′UTR of many pluripotency and self-renewal genes (Ramalho-Santos et al., 2002; Wang et al., 2008), such as Klf4, Klf2, Tbx3, Akt2, GSK-3β, Cdk6, Cdc42, and CCNY mRNA. TaqMan reverse transcription-PCR, droplet digital PCR, and in situ hybridization were used to analyze miR-137 expression in mouse ES cells. We also amplified miR-16 and snoRNA in these samples. We found that miR-137 is expressed at relatively low levels in undifferentiated R1 ES cells (Fig. 1A). In situ hybridization of miR-137, coupled with analysis of the nuclear morphology characteristics of the mitotic phase in ES cells growing under self-renewal conditions, demonstrated that miR-137 is highly expressed in cells at all stages of mitosis and

(5)

nearly undetectable in G1, S, and G2 phase cells (Fig. 1B). We found that all cells showing mitotic nuclear morphology, as described in our recent report (Nair et al., 2012), showed increased expression of miR-137. These results suggest that miR-137 is expressed in a cell cycle-dependent manner in ES cells.

To further confirm the expression of miR-137 in mitotic cells, we synchronized ES cells to G2/M phases of the cell cycle and the expression of miR-137 was determined by two independent methods such as qPCR and droplet digital dPCR (ddPCR). As shown in Fig. 1C, cells treated with nocodazole and vincristine showed significantly higher miR-137 expression levels. However, no changes in the levels of miR-16, a microRNA highly expressed in ES cells were observed in cells synchronized to G2/M phase (Fig. 1C). The localization of miR-137 in mitotic cells by in situ hybridization (Fig. 1B) and the increased levels of miR-137 in mitotically synchronized cells (Fig. 1C) suggest that miR-137 is expressed in a cell cycle-dependent manner in ES cells.

miR-137 has been shown to inhibit proliferation and induce differentiation of tumor cells (Kozaki et al., 2008; Silber et al., 2008). miR-137 is a known regulator of neuronal development and its expression has been found to increase during neuronal differentiation (Ripke et al., 2011; Silber et al., 2008; Smrt et al., 2010; Sun et al., 2011a). We used a stage-controlled ES cell

differentiation protocol that includes EB formation, selection, expansion of nestin positive cells, and differentiation into neuronal cells (Nair, 2006). Consistent with reported studies, we observed a significant increase (~27 fold) in miR-137 expression upon differentiation of ES cells into neural cells (NC) (Fig. 1A). However, no increase in the levels of miR-16 was observed between ES cells and neuronally differentiated cells (Fig. 1A). These findings suggest that the proper temporal expression of miR-137 may influence ES cell proliferation and differentiation.

miR-137 represses luciferase reporters containing Klf4 and Tbx3 3′UTRs

miRNAs bind to partially complementary target sites present in the 3′UTRs of messenger RNA, which results in either degradation of the target mRNAs or translational repression of the encoded proteins (Bartel, 2004). By bioinformatics analysis using TargetScan, we found 971 conserved miR-137 targets in the mouse genome and identified many potential candidate mRNAs that have the capacity to directly interact with miR-137 in ES cells. Two candidate genes, Klf4 and Tbx3, were selected for further analysis on the basis of their role in ES cell self-renewal and pluripotency and the presence of target

Figure 1 miR-137 is highly expressed in M phase ES cells. (A) The relative levels of miR-137 increased after the differentiation of ES cells. In TaqMan real-time RT-qPCR, miR-137, miR-16, and snoRNA levels were quantified in undifferentiated (ESC) and neuronally differentiated R1 ES cells (NC). The expression levels of each miRNA in undifferentiated ES cells (ESC) were arbitrarily set to one. The error bar represents the standard deviation (SD) from three independent experiments. **, Pb 0.001. (B) miR-137 is mainly expressed in M phase cells. Expression of miR-137 in R1 ES cells growing under self-renewal condition was assessed by in situ hybridization using fluorescein-labeled miR-137 detection probe (green), while the blue fluorescent signal was from nuclear DNA counterstained with DAPI. Scale bar, 5μm. (C) Increased expression of miR-137 in cells synchronized at metaphase by nocodazole and vincristine treatment (100 ng/ml; 16 h) was confirmed by droplet digital PCR (ddPCR). Data are the means ± SD (n = 4) from two independent experiments. *, Pb 0.01.

(6)

“seed sequences” in the 3′UTR of these mRNAs (Fig. 2A). We also used LSD1, a known miR-137 target (Balaguer et al., 2010; Sun et al., 2011b), as a control. To investigate whether Klf4, Tbx3, and LSD1 can be directly targeted by miR-137 in ES

cells, we constructed luciferase reporters that have either the wild-type 3′UTR of these genes or the mutant 3′UTR with altered or deleted miR-137 target sites (Fig. 2A). In order to evaluate the specific function of miR-137, we used Dgcr8−/−

Figure 2 (A) The miR-137 target site in the Klf4, Tbx3, and LSD1 3′UTR as predicted by TargetScan. The underlined nucleotides (target sites) were deleted in the mutant 3′UTR constructs. (B–G) miR-137 represses Klf4, Tbx3, and LSD1 3′UTR in the luciferase reporter assay. Dgcr8−/−ES cells were co-transfected with indicated wild type 3′UTR reporters or constructs with deleted miR-137 binding sites (3′UTRΔ), and mature miR-137 RNA duplexes, miR-137 inhibitor, or a combination of both. Luciferase activity was determined at 24 h after transfection and represented as the relative level to cells transfected with the basal luciferase reporter without UTR (control). (H) Oct4 3 UTR luciferase construct was used as a miR-137 non-target control. The error bar represents the SD of three independent experiments (n = 6). Student's t test compared two data sets marked by brackets in the panel. *, Pb 0.001. (I–N) Endogenous miR-137 represses the 3′UTRs of Klf4, Tbx3, and LSD1 in ES cells. R1 ES cells were transfected with indicated 3′UTR reporter constructs and treated with nocodazole (100 ng/ml; 16 h) after 24 h of transfection. The difference between 3′UTR mutant and wild-type luciferase reporters of Klf4 (I and J), Tbx3 (K and L), and LSD1 (M and N) reflects the magnitude of repression. The error bar represents the SD from three independent experiments. Student's t test compared two data sets marked by brackets in the panel. *, Pb 0.01.

(7)

mouse ES cells because these cells are relatively deficient of endogenous miRNAs (Melton et al., 2010). Dgcr8−/− ES cells were co-transfected with luciferase constructs and mature miR-137 RNA duplexes, small, double-stranded RNA molecules, designed to mimic endogenous mature miR-137 functions when transfected into cells. A luciferase reporter with no 3′UTR, which is resistant to any miRNA repression in ES cells (negative control), and transfection without mature miR-137 RNA duplexes (mock transfection) were used as controls. The optimum concentration of mature miR-137 RNA duplexes required for the repression of the reporter constructs was determined by transfecting different concentrations ranging from 10 to 200 nM with LSD1 3′UTR plasmid. We selected 100 nM of mature miR-137 RNA duplexes for further studies based on the maximum repression observed with wild type luciferase reporter activity without affecting the control and mutant reporter expression. Transfection of miR-137 signifi-cantly reduced the luciferase activity of the wild-type reporter constructs of Klf4, Tbx3, and LSD1 (Figs. 2B, D, and F). No reduced luciferase activity was observed when the constructs were cotransfected with miR-137 inhibitor, a chemically modified, single stranded nucleic acid that was designed to specifically bind to and inhibit the activity of miR-137 (Figs. 2B, D, and F). Moreover, cotransfection of mature miR-137 RNA duplexes with miR-137 inhibitor completely abolished the repression mediated by miR-137 (Figs. 2B, D, and F). Mutant reporters and an Oct4 3′UTR luciferase reporter construct

which lacks a miR-137 target site were not repressed by miR-137. These results suggest that a target site is required for the repression of the reporters by miR-137 (Figs. 2C, E, G, and H). Taken together, these results show that miR-137 directly targets Klf4, Tbx3, and LSD1 3′UTRs in ES cells.

We then studied the role of endogenous miR-137 in repressing the Klf4, Tbx3 and LSD1 3′UTR reporters in wild type ES cells (R1) under self-renewal conditions (Nair et al., 2012). At 48 h after transfection, there was a small but significant repression of the wild-type 3′UTR luciferase reporter activities of Klf4, Tbx3, and LSD1 in comparison to the no-UTR control (Figs. 2I, K, and M). In contrast, the respective mutant reporters with deletion of the miR-137 target site had significantly less repression than the wild type reporters (Figs. 2J, L, and N). We further addressed the dependence of 3′UTR reporter repression with the level of miR-137. The expression of miR-137 has been shown to be upregulated by treatment with nocodazole (Fig. 1B). At 24 h after transfection with 3′UTR constructs, the cells were synchronized to M phase by treatment with nocodazole as described previously (Nair et al., 2012). Nocodazole treatment significantly increased the repression of 3′UTR constructs compared to non-synchronized cells (Figs. 2I, K, and M). However, no significant repression was observed with mutant 3′UTR reporters (Figs. 2J, L, and N). The correlation between the increased levels of miR-137 and the repression of the wild type target 3′UTR reporters without

Figure 3 miR-137 represses endogenous Klf4, Tbx3, and LSD1 mRNA and protein. (A–C) Relative mRNA levels of Klf4 (A), Tbx3 (B), and LSD1 (C) in Dgcr8−/−ES cells transfected with mature miR-137 RNA duplexes, miR-137 inhibitor, or the combination of both and mRNA levels were determined by RT-qPCR after 48 h of transfection. (D) The Klf4, Tbx3, and LSD1 protein levels were determined by Western blotting following 48 h after transfection with mature miR-137 RNA duplexes. Lane 1, control; lane 2, miR-137; lane 3, miR-137 inhibitor; lane 4, combination of both transfected cells.β-Actin was used as loading control. Reduction of Klf4, Tbx3, and LSD1 mRNA levels in miR-137 transfected cells correlates with the reduction of the corresponding proteins in these cells. (E) The Oct4 mRNA level measured in these cells remained unchanged in any of the treatment groups. (F–G) Expression of Nanog (F) and Sox2 (G) were significantly repressed in cells transfected with miR-137. All real-time PCR experiments were performed three times in triplicate. Student's t test compared two data sets marked by brackets in the panel. *, Pb 0.001. (H) miR-137 had no effect on the expression of Sox2 3′ UTR luciferase construct. The error bar represents the SD of three independent experiments (n = 6).

(8)

affecting the expression of mutant reporters in nocodazole treated cells suggests that endogenous miR-137 also targets the 3′UTRs of Klf4, Tbx3, and LSD1.

Overexpression of miR-137 reduces the levels of endogenous Klf4 and Tbx3 in ES cells

miRNAs can downregulate gene expression by one of two post-transcriptional mechanisms: mRNA cleavage or transla-tional repression (Bartel, 2004). Because the luciferase assay does not readily distinguish between these mechanisms, we further examined how miR-137 represses the endogenous Klf4, Tbx3, and LSD1 in ES cells. The Dgcr8−/−ES cells were transfected with mature miR-137 duplexes, and we mea-sured the mRNA and protein levels of endogenous Klf4, Tbx3, and LSD1. Cells transfected with miR-137 inhibitor and mock transfections were used as controls. RT-qPCR and Western blot analyses showed that the mRNA and protein levels of Klf4, Tbx3, and LSD1 were significantly reduced in cells transfected with mature miR-137 RNA duplexes compared to controls (Figs. 3A–C, and D). However, the pluripotency factor, Oct4, which lacks the miR-137 target site, remained unchanged in these cells (Fig. 3E). Cotransfection of the mature miR-137 duplexes with the miR-137 antisense inhibitor abolished the gene repression caused by miR-137 (Figs. 3A–C, and D). These findings indicate that Klf4, Tbx3, and LSD1 are repressed by destabilization of their mRNAs by miR-137. These results are also consistent with the capacity of endogenous miR-137 in ES cells to repress ectopic 3′UTR reporters of Klf4, Tbx3, and LSD1 (Figs. 2B, D, and F). We also observed the downregulation of transcription factors Nanog and Sox2 in cells transfected with miR-137 (Figs. 3F and G). However, the absence of a miR-137 target site in Nanog and Sox2 and the observation that Sox2 3′UTR luciferase reporter was not repressed by miR-137 (Fig. 3H) suggest that Sox2 is not a direct target of miR-137, and the repression observed in these cells may be mediated by an indirect effect of miR-137.

Overexpression of miR-137 modulates the proliferation of R1 ES cells

The cell cycle-dependent expression of miR-137 in ES cells and its upregulation during differentiation suggest a functional role for miR-137 in ES cell self-renewal as well as in differentiation. To determine the role of miR-137 in cell proliferation, R1 ES cells growing under self-renewal conditions were transfected with mature miR-137 duplexes, and cell proliferation was analyzed. In comparison to the control and miR-137 inhibitor transfected cells, miR-137 caused a significant drop in proliferation rate (Fig. 4A), which was abolished when cells were co-transfected with miR-137 inhibitor. We also investi-gated whether the maintenance of self-renewal under normal culturing conditions would be affected by increased miR-137 by analyzing the self-renewal marker alkaline phosphatase. The loss of alkaline phosphatase staining was evident from as early as 2 days after transfection. In comparison to the control and miR-137 inhibitor, transfection of mature miR-137 RNA duplexes induced changes in colony morphology and caused a significant loss of alkaline phosphatase staining, indicative of differentiation (Figs. 4B and C). These results indicate that the significant drop in cell proliferation was caused by the

differentiation of cells transfected with miR-137 and not by cell death. To rule out the non-specific effects of mature miR-137 RNA duplexes, we co-transfected duplexes with miR-137 inhibitor, this completely prevented the loss of alkaline phosphatase staining caused by miR-137 (Figs. 4B and C). We also stained these cells for the self-renewal marker, Nanog; LSD1, a direct target of miR-137; and cytochrome c, as a control. As shown inFig. 5, transfection of mature miR-137 duplexes significantly reduced the levels of Nanog and LSD1 (Fig. 5A) without affecting the levels of cytochrome c in these cells (Fig. 5B). Taken together, our results suggest that temporal expression of miR-137 plays an important role in the normal cell cycle progression of ES cells, and its continued expression most likely inhibits cell proliferation.

Overexpression of miR-137 induces differentiation of ES cells in vitro

ES cells show the early stages of embryogenesis and can differentiate into all three primary embryonic germ layers; the endoderm, mesoderm, and ectoderm; depending on culture conditions (Evans and Kaufman, 1981). Therefore, we used EB cultures to determine the differentiation potential of miR-137 in ES cells. We transfected the ES cells growing on gelatin-coated plates under self-renewing conditions with mature miR-137 RNA duplexes, miR-137 inhibitor, or a combination of both. After 24 h, cells were trypsinized and allowed to form EBs (D0) onto non-adherent bacterial culture plates in ES medium without the leukemia inhibitory factor (LIF) for 4 days (D4) as described previously (Nair, 2006). Transfection of ES cells with miR-137 caused changes in EB morphology, characterized by the appearance of a large number of flat cells with enlarged cytoplasm, even when the cells were maintained in complete ES medium without any differentiation-inducing agents (Fig. 6A). The miR-137-induced morphological changes were completely prevented by co-transfection with miR-137 inhibitor (Fig. 6A).

To test whether differentiation of EBs by miR-137 was associated with the repression of Klf4, Tbx3, and LSD1, the expression of these genes was analyzed by RT-qPCR. Consistent with reported studies, the expression of ES cell markers Oct4, Klf4, and Tbx3 was decreased in 4 day old EBs (D4) (Ivanova et al., 2006; Martin-Ibanez et al., 2007; Sajini et al., 2012; Wei et al., 2005; Zhang et al., 2010). Moreover, in EBs transfected with miR-137, there was significant downregulation of Klf4, Tbx3, and LSD1, without affecting the expression of Oct4 (Figs. 6B–E). These results suggest that the repression of Klf4, Tbx3, and LSD1 by miR-137 correlates with the increased differentiation of ES cells. Furthermore, the upregulation of neuronal (Sox1 and Tuj1), endoderm (Foxa2 and Sox17), and mesoderm (Brachyury and Mixl1) markers in cultures of EBs transfected with mature miR-137 duplexes (Figs. 6F–K) suggests that miR-137 accelerates the differentiation of ES cells into all three lineages.

Previous studies have shown that miR-137 could inhibit proliferation and induce differentiation of tumor cells (Kozaki et al., 2008; Silber et al., 2008). Given that miR-137 is essential for the maturation of neurons (Ripke et al., 2011; Silber et al., 2008; Smrt et al., 2010; Sun et al., 2011a), we next examined whether miR-137 induces differentiation of

(9)

ES cells to a neuronal lineage. In EB differentiation assays, we stained the cells for the expression of the neuronal marker, Tuj1, and the miR-137 target, LSD1. As shown in Fig. 7, we observed a significant increase in the number of cells that express Tuj1 following transfection with miR-137 mimic. Moreover, the Tuj1-positive cells also showed cellular morphology characteristics of differentiation (flat and elongated cells) and low levels of LSD1 (Figs. 7A and B). miR-137-induced morphological changes, the induction of Tuj1, and the repression of LSD1 were prevented when cells were cotransfected with miR-137 inhibitor (Figs. 7A and B).

These data together suggest that miR-137 accelerates differentiation of ES cells by repressing its targets, including Klf4, Tbx3, and LSD1.

To further confirm the involvement of miR-137 in neurogenesis, we tested whether downregulation of miR-137 could impair the differentiation of ES cells into neurons. To inactivate the endogenous miR-137 during differentiation, ES cells were transfected with miR-137 inhibitor or a control inhibitor, allowed to form EBs, and then differentiated into neurons by culturing for 12 days (Nair, 2006). Transfection of miR-137 inhibitor dramatically decreased the percentage of

Figure 4 Overexpression of miR-137 inhibits ES cell proliferation. (A) miR-137 significantly reduced cell proliferation. R1 ES cells transfected with mature miR-137 RNA duplexes and cultured in complete ES medium with LIF for 4 days. The growth rate was evaluated by CellTiter-Blue assay and the results are normalized to control ES cells (mean ± s.e.m., n = 8). (B) Alkaline phosphatase staining of control, mature miR-137 RNA duplexes, miR-137 inhibitor, and a combination of both. Transfected R1 ES cells after being cultured in complete ES medium with LIF for 5 days. (C) Relative numbers of alkaline phosphatase positive and negative colonies in panel B. Mean ± SD from triplicate measurements are plotted.

(10)

Tuj1-positive cells; Tuj1-positive staining was mainly observed in rounded cells compared to the control and cells transfected with a control inhibitor (Figs. 8A and B). The differentiated cells (NC) also expressed low levels of the Klf4, Tbx3, and LSD1 proteins, compared to undifferentiated ES cells (ESC) (Fig. 8C). To further determine the contribution of miR-137 in the differentiation of ES cells to neurons, we assessed the expression of ES cell and neuronal genes in differentiated cells transfected with miR-137 inhibitor by RT-qPCR. The ES cell transcription factors were expressed at very low levels or were undetectable when ES cells were differentiated into neuronal cells (Figs. 8D–H). In contrast, many of the neuronal transporters and channels were highly expressed in differ-entiated neurons (Figs. 8L–Q). The inhibition of miR-137 significantly impaired the downregulation of Klf4, Tbx3, and LSD1 (Figs. 8G–I). A small but significant increase in the levels of Nanog, Oct4, and Sox2 was also observed in miR-137 inhibited cells (Figs. 8D–E). The increased levels of pluripotency factors in miR-137 inhibited cells were also correlated with decreased levels of neuronal genes such as Calb1, Kcnn1, Scn3a, Slc1a3, and NeuroG2. No changes in the levels of CoREST were observed in any of the treatment groups (Fig. 8K). This suggests that miR-137 is involved in the proper gene expression and maturation of neurons, at least in our in vitro differentiation system.

Discussion

In the present study, we have shown that miR-137, a neuronally-enriched miRNA, is expressed in ES cells at the mitotic phase of the cell cycle and its expression is highly upregulated during differentiation into the neuronal linage. We uncovered a direct link between miR-137 and ES cell

transcription factors, Klf4 and Tbx3. It appears that miR-137 has a dual function in ES cells depending on their expression status. While its expression in the mitotic phase indicates that miR-137 is involved in cell division, increased levels of the miRNA during differentiation appear to be involved in the maturation of ES cell-derived neurons. The data could indicate that the dynamic responses of miR-137 seem to be involved in mediating the balance between self-renewal and differentiation by regulating the expression levels of its direct targets, including Kfl4, Tbx3, and LSD1; and indirectly Nanog, Sox2, and possibly others. Our findings are consistent with the reports that miRNAs promote mouse ES cell differentiation through posttranscriptional attenuation of key ES cell tran-scription factors (Tay et al., 2008; Xu et al., 2009).

miR-137 is a known regulator of neuronal development and its expression has been found to increase during neuronal differentiation (Ripke et al., 2011; Silber et al., 2008; Smrt et al., 2010; Sun et al., 2011a). This study demonstrates that miR-137 has a role in ES cell proliferation and differentiation. We have shown that miR-137 is expressed in ES cells in a cell cycle-dependent manner and is highly upregulated during differentiation of ES cells into neuronal linage. These results suggest that miR-137 may be involved in cell cycle progression or differentiation depending on the cellular context it is expressed in. This finding is consistent with previous reports, which show that miR-137 negatively regulates cell proliferation and accel-erates neural differentiation of embryonic neural stem cells (Silber et al., 2008; Sun et al., 2011b). miR-137 has been shown to mediate differentiation by targeting many genes including CDK6, a regulator of the cell cycle and dif-ferentiation (Silber et al., 2008); Ezh2, a histone methyltransferase (Szulwach et al., 2010); Jarid1b, a

Figure 5 Overexpression of miR-137 represses the expression of self-renewal marker Nanog in ES cells. R1 ES cells were transfected with mature miR-137 RNA duplexes or miR-137 inhibitor and cultured in complete ES medium with LIF for 5 days. The cells were stained with antibodies to Nanog (red) and LSD1 (green) (A) or with Nanog (red) and cytochrome c (green) (B). Representative images were shown.

(11)

histone H3 lysine 4 demethylase (Tarantino et al., 2010); Mib1, a ubiquitin ligase (Smrt et al., 2010); and TLX, an orphan nuclear receptor (Sun et al., 2011b). In this study, we showed that miR-137 is also able to target the 3′UTRs of Klf4 and Tbx3 and regulate self-renewal and differentiation of ES cells.

Previously, LSD1 was identified as a miR-137 target in the neural stem cells of embryonic brains (Sun et al., 2011b) and in colorectal cancer cells (Balaguer et al., 2010). The interaction between miR-137 and LSD1 has been shown to play a critical role in the molecular circuitry controlling neural stem cell proliferation and differentiation during neural development (Sun et al., 2011b). Recent reports have demonstrated that high levels of LSD1 are needed to maintain the undifferentiated state of embryonic stem cells,

and its expression has been shown to be downregulated during ES cell differentiation (Adamo et al., 2011). In ES cells, we found that miR-137 also targets the transcription factors, Klf4 and Tbx3, in addition to LSD1. Transfection of mature miR-137 RNA duplexes into ES cells caused the repression of the Klf4, Tbx3, and LSD1 3′UTR assays; downregulation of endogenous Klf4, Tbx3, and LSD1 mRNA and proteins; and triggered premature differentiation in our EB assays. The cotransfection of miR-137 and miR-137 inhibitor completely abolished the gene repression and differentiation mediated by the miR-137. The inhibition of miR-137 impeded the dendritic morphogen-esis and phenotypic maturation of ES cell-derived neurons, and the altered gene expression in these cells further suggests an important role for miR-137 in the differentiation of ES cells in vitro.

Figure 6 Overexpression of miR-137 promotes differentiation of embryonic stem cells and represses Klf4, Tbx3, and LSD1. (A) Phase-contrast images showing the morphologies of EBs at day 4. Control (top left); miR-137 (top right); miR-137 inhibitor (bottom left); combination of both (bottom right). (B–E) RT-qPCR analysis of relative Klf4, Tbx3, LSD1, and Oct4 expression levels in EBs at days 0, 2, and 4. The R1 ES cells growing on gelatin coated plates were transfected with mature miR-137 duplexes, inhibitor, or a combination of both. After 24 h (Day 0), cells were dissociated and plated in a non-adherent plate to form EBs for 4 days (D4). The expression levels of each gene in the control at indicated days were arbitrarily set to one. The relative expression levels in EBs transfected with mature miR-137 RNA duplexes, miR-137 inhibitor, or a combination of both were normalized to the control mRNA levels of the corresponding day. The gene expression of Klf4 (B), Tbx3 (C), and LSD1 (D) was significantly repressed in miR-137 transfected cells, whereas the repression was completely prevented when cells were cotransfected with both miR-137 and miR-137 inhibitor. (F–K) RT-qPCR analysis of neuronal (Sox1 and Tuj1), endoderm (Foxa2 and Sox17), and mesoderm (Brachyury and Mixl1) markers in EBs transfected with mature miR-137 duplexes. All RT-qPCR experiments were performed three times in triplicate and the error bars denote SD. *, Pb 0.001.

(12)

Klf4 encodes a krűppel-like zincfinger transcription factor, which is required for the establishment of pluripotency in somatic cells (Takahashi and Yamanaka, 2006). Tbx3 has been reported to maintain ES cell self-renewal (Ivanova et al., 2006); and sustained expression of Tbx3 is sufficient to maintain ES cells in an undifferentiated state in the absence of LIF (Niwa et al., 2009). In mouse ES cells, the transcription factor, Klf4, is mainly activated by the Jak–Stat3 pathway and preferentially activates Sox2; whereas, Tbx3 is preferentially regulated by the phosphatidylinositol-3-OH kinase–Akt and mitogen-activated protein kinase pathways and predominantly stimulates Nanog (Niwa et al., 2009; Zhang et al., 2010). However, activation of Klf4 and Tbx3 is not required for the expression of Oct4 in ES cells (Niwa et al., 2009). We showed that miR-137 also represses Nanog and Sox2 without affecting the expression of Oct4 in these cells. However, both Nanog and Sox2 lack miR-137 target sites; and miR-137 failed to repress Sox2 3′UTR activity. Our results suggest that miR-137 targets components of the self-renewal pathway in ES cells in order to promote differen-tiation by repressing Klf4 and Tbx3, which may indirectly downregulate Sox2 and Nanog.

The downregulation of miR-137 in numerous cancers (Balaguer et al., 2010; Chen et al., 2010; Silber et al., 2008), as well as our findings that miR-137 induces differentiation of ES cells, raises the possibility that miR-137 functions as a pro-differentiation factor in a lineage-specific fashion

depending on the cellular context. The targeting of Klf4, Tbx3, and LSD1 supports this notion, as Klf4, Tbx3, and LSD1 are highly expressed in undifferentiated ES cells and in many forms of cancers (Fillmore et al., 2010; Hayami et al., 2011; Lim et al., 2010; Lomnytska et al., 2006; Lv et al., 2012; Renard et al., 2007; Schulte et al., 2009; Vance et al., 2005; Wei et al., 2010). Recent evidence indicates that miR-137 represses LSD1 in human carcinoma cells and in mouse neural stem cells as they begin to differentiate and is required for normal differentiation (Balaguer et al., 2010; Sun et al., 2011b). Klf4 is one of the four factors that, together, are sufficient to reprogram human fibroblasts into pluripotent cells (Takahashi and Yamanaka, 2006); and the overexpression of Tbx3 has been shown to increase the efficiency of the derivation of induced pluripotent stem cells (Han et al., 2010). It would be interesting to determine, though, whether elevated miR-137 in mitotic cells is a factor of self-renewal or is involved in differentiation, as demonstrated by the overexpression of miR-137 in non-dividing cells.

Conclusions

Here, we show that miR-137 is highly expressed in M phase ES cells and shows increased expression in differentiated neuro-nal cells. We also demonstrate that the increased expression

Figure 7 miR-137 promotes differentiation of ES cells toward a neuronal lineage. (A–B) Immunocytochemical staining demonstrates the differentiation of R1 ES cells transfected with the mature miR-137 RNA duplexes, miR-137 inhibitor, or a combination of both, 4 days after EB formation (5 days after transfection). Cells were stained for LSD1 (red) and Tuj1 (green). Lower (A) and higher (B) magnifications are shown. Scale bar, 250 and 40μm, respectively.

(13)

Figure 8 miR-137 participates in neuronal differentiation of mouse R1 ES cells. (A) Immunostaining for Tuj1 (green) and histone H3 (red) was performed at day 12 of differentiation, showing typical neurite formation in control (right panel) and cells transfected with a control inhibitor (left panel). The same analysis was performed in cells transfected with miR-137 inhibitor (middle panel) and shows a reduction in Tuj1 immunoreactivity, together with reductions in neurite outgrowth. Representative photomicrographs are shown. (B) Tuj1-positive cells in control; cells transfected with control inhibitor or miR-137 inhibitor were counted at day 12 of differentiation and expressed as percentage to control (mock-transfected) cells. The average of three culture replicates for each combination is shown, with error bar indicating the SD. *, Pb 0.001. (C) Representative Western blots showing the levels of indicated proteins in ES cells and neuronally differentiated cells for 12 days. (D–Q) RT-qPCR analysis to examine the expression levels of ES cells and neuronal genes in cells transfected with control and miR-137 inhibitor at day 12 of differentiation. Transcript levels were normalized usingβ-actin, α-tubulin, and rps11 in these cells and compared with the levels in ES cells or neuronally differentiated ES cells for 12 days. All RT-qPCR experiments were performed two times in triplicate and the error bars represent SD. *, Pb 0.001.

(14)

of miR-137 attenuates the levels of Klf4, Tbx3, and LSD1 during differentiation and its inhibition upregulates these genes and disrupts neuronal maturation. Our results indicate that miR-137 plays a role in the maintenance and differenti-ation of ES cells.

Author contributions

V.D.N. planned, designed and supervised the project. K. J., C. R., and V.D.N. carried out the experiments and analyzed the data. V.D.N. wrote the manuscript.

Conflicts of interest

The authors declare no competing financial interests.

Acknowledgments

We thank Stuart Sealfon for helpful discussions, Kenneth Kosik

for Oct4 and Sox2 3′UTR constructs, and Sun Li for Tbx3 3′UTR

constructs.

References

Adamo, A., Sese, B., Boue, S., Castano, J., Paramonov, I., Barrero,

M.J., Izpisua Belmonte, J.C., 2011.LSD1 regulates the balance

between self-renewal and differentiation in human embryonic stem cells. Nat. Cell Biol. 13, 652–660.

Balaguer, F., Link, A., Lozano, J.J., Cuatrecasas, M., Nagasaka, T.,

Boland, C.R., Goel, A., 2010.Epigenetic silencing of miR-137 is

an early event in colorectal carcinogenesis. Cancer Res. 70, 6609–6618.

Bartel, D.P., 2004.MicroRNAs: genomics, biogenesis, mechanism,

and function. Cell 116, 281–297.

Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P., Guenther, M.G., Kumar, R.M., Murray, H.L., Jenner, R.G., Gifford, D.K., Melton, D.A., Jaenisch, R., Young,

R.A., 2005.Core transcriptional regulatory circuitry in human

embryonic stem cells. Cell 122, 947–956.

Calabrese, J.M., Seila, A.C., Yeo, G.W., Sharp, P.A., 2007. RNA

sequence analysis defines Dicer's role in mouse embryonic stem cells. Proc. Natl. Acad. Sci. U. S. A. 104, 18097–18102.

Chambers, I., Tomlinson, S.R., 2009.The transcriptional foundation

of pluripotency. Development 136, 2311–2322.

Chen, H., Shalom-Feuerstein, R., Riley, J., Zhang, S.D., Tucci, P., Agostini, M., Aberdam, D., Knight, R.A., Genchi, G., Nicotera,

P., Melino, G., Vasa-Nicotera, M., 2010.miR-7 and miR-214 are

specifically expressed during neuroblastoma differentiation, cortical development and embryonic stem cells differentiation, and control neurite outgrowth in vitro. Biochem. Biophys. Res. Commun. 394, 921–927.

Dejosez, M., Zwaka, T.P., 2012. Pluripotency and nuclear

reprogramming. Annu. Rev. Biochem. 81, 737–765.

Evans, M.J., Kaufman, M.H., 1981. Establishment in culture of

pluripotential cells from mouse embryos. Nature 292, 154–156.

Fillmore, C.M., Gupta, P.B., Rudnick, J.A., Caballero, S., Keller,

P.J., Lander, E.S., Kuperwasser, C., 2010. Estrogen expands

breast cancer stem-like cells through paracrine FGF/Tbx3 signaling. Proc. Natl. Acad. Sci. U. S. A. 107, 21737–21742.

Han, J., Yuan, P., Yang, H., Zhang, J., Soh, B.S., Li, P., Lim, S.L., Cao, S., Tay, J., Orlov, Y.L., Lufkin, T., Ng, H.H., Tam, W.L.,

Lim, B., 2010. Tbx3 improves the germ-line competency of

induced pluripotent stem cells. Nature 463, 1096–1100.

Hayami, S., Kelly, J.D., Cho, H.S., Yoshimatsu, M., Unoki, M., Tsunoda, T., Field, H.I., Neal, D.E., Yamaue, H., Ponder, B.A.,

Nakamura, Y., Hamamoto, R., 2011. Overexpression of LSD1

contributes to human carcinogenesis through chromatin regula-tion in various cancers. Int. J. Cancer 128, 574–586.

Ivanova, N., Dobrin, R., Lu, R., Kotenko, I., Levorse, J., DeCoste,

C., Schafer, X., Lun, Y., Lemischka, I.R., 2006.Dissecting

self-renewal in stem cells with RNA interference. Nature 442, 533–538.

Kim, J., Chu, J., Shen, X., Wang, J., Orkin, S.H., 2008.An extended

transcriptional network for pluripotency of embryonic stem cells. Cell 132, 1049–1061.

Kozaki, K., Imoto, I., Mogi, S., Omura, K., Inazawa, J., 2008.

Exploration of tumor-suppressive microRNAs silenced by DNA hypermethylation in oral cancer. Cancer Res. 68, 2094–2105.

Lewis, B.P., Shih, I.H., Jones-Rhoades, M.W., Bartel, D.P., Burge,

C.B., 2003.Prediction of mammalian microRNA targets. Cell 115,

787–798.

Li, M., Liu, G.H., Izpisua Belmonte, J.C., 2012. Navigating the

epigenetic landscape of pluripotent stem cells. Nat. Rev. Mol. Cell Biol. 13, 524–535.

Lim, S., Janzer, A., Becker, A., Zimmer, A., Schule, R., Buettner, R.,

Kirfel, J., 2010. Lysine-specific demethylase 1 (LSD1) is highly

expressed in ER-negative breast cancers and a biomarker predicting aggressive biology. Carcinogenesis 31, 512–520.

Lomnytska, M., Dubrovska, A., Hellman, U., Volodko, N.,

Souchelnytskyi, S., 2006. Increased expression of cSHMT,

Tbx3 and utrophin in plasma of ovarian and breast cancer patients. Int. J. Cancer 118, 412–421.

Lv, T., Yuan, D., Miao, X., Lv, Y., Zhan, P., Shen, X., Song, Y., 2012.

Over-expression of LSD1 promotes proliferation, migration and invasion in non-small cell lung cancer. PLoS One 7, e35065.

Marson, A., Levine, S.S., Cole, M.F., Frampton, G.M., Brambrink, T., Johnstone, S., Guenther, M.G., Johnston, W.K., Wernig, M., Newman, J., Calabrese, J.M., Dennis, L.M., Volkert, T.L., Gupta, S., Love, J., Hannett, N., Sharp, P.A., Bartel, D.P., Jaenisch, R.,

Young, R.A., 2008. Connecting microRNA genes to the core

transcriptional regulatory circuitry of embryonic stem cells. Cell 134, 521–533.

Martin-Ibanez, R., Urban, N., Sergent-Tanguy, S., Pineda, J.R.,

Garrido-Clua, N., Alberch, J., Canals, J.M., 2007. Interplay of leukemia

inhibitory factor and retinoic acid on neural differentiation of mouse embryonic stem cells. J. Neurosci. Res. 85, 2686–2701.

Melton, C., Judson, R.L., Blelloch, R., 2010. Opposing microRNA

families regulate self-renewal in mouse embryonic stem cells. Nature 463, 621–626.

Murchison, E.P., Partridge, J.F., Tam, O.H., Cheloufi, S., Hannon,

G.J., 2005.Characterization of Dicer-deficient murine

embry-onic stem cells. Proc. Natl. Acad. Sci. U. S. A. 102, 12135–12140.

Nair, V.D., 2006.Activation of p53 signaling initiates apoptotic death in

a cellular model of Parkinson's disease. Apoptosis 11, 955–966.

Nair, V.D., Ge, Y., Balasubramaniyan, N., Kim, J., Okawa, Y.,

Chikina, M., Troyanskaya, O., Sealfon, S.C., 2012.Involvement

of histone demethylase LSD1 in short-time scale gene expression changes during cell cycle progression in embryonic stem cells. Mol. Cell. Biol. 32, 4861–4876.

Niwa, H., Ogawa, K., Shimosato, D., Adachi, K., 2009.A parallel

circuit of LIF signalling pathways maintains pluripotency of mouse ES cells. Nature 460, 118–122.

Pauli, A., Rinn, J.L., Schier, A.F., 2011. Non-coding RNAs as

regulators of embryogenesis. Nat. Rev. Genet. 12, 136–149.

Ramalho-Santos, M., Yoon, S., Matsuzaki, Y., Mulligan, R.C., Melton,

D.A., 2002. “Stemness”: transcriptional profiling of embryonic

and adult stem cells. Science 298, 597–600.

Renard, C.A., Labalette, C., Armengol, C., Cougot, D., Wei, Y., Cairo, S., Pineau, P., Neuveut, C., de Reynies, A., Dejean, A.,

Perret, C., Buendia, M.A., 2007.Tbx3 is a downstream target of

(15)

beta-catenin survival functions in liver cancer. Cancer Res. 67, 901–910.

Ripke, S., Sanders, A.R., Kendler, K.S., Levinson, D.F., Sklar, P.,

Holmans, P.A., Ln, D.Y., Duan, J., 2011.Genome-wide

associ-ation study identifies five new schizophrenia loci. Nat. Genet. 43, 969–976.

Sajini, A.A., Greder, L.V., Dutton, J.R., Slack, J.M., 2012.Loss of

Oct4 expression during the development of murine embryoid bodies. Dev. Biol. 371, 170–179.

Schulte, J.H., Lim, S., Schramm, A., Friedrichs, N., Koster, J., Versteeg, R., Ora, I., Pajtler, K., Klein-Hitpass, L., Kuhfittig-Kulle, S., Metzger, E., Schule, R., Eggert, A., Buettner, R.,

Kirfel, J., 2009. Lysine-specific demethylase 1 is strongly

expressed in poorly differentiated neuroblastoma: implications for therapy. Cancer Res. 69, 2065–2071.

Silber, J., Lim, D.A., Petritsch, C., Persson, A.I., Maunakea, A.K., Yu, M., Vandenberg, S.R., Ginzinger, D.G., James, C.D., Costello, J.F., Bergers, G., Weiss, W.A., Alvarez-Buylla, A.,

Hodgson, J.G., 2008.miR-124 and miR-137 inhibit proliferation

of glioblastoma multiforme cells and induce differentiation of brain tumor stem cells. BMC Med. 6, 14.

Silva, J., Smith, A., 2008.Capturing pluripotency. Cell 132, 532–536.

Smrt, R.D., Szulwach, K.E., Pfeiffer, R.L., Li, X., Guo, W., Pathania, M., Teng, Z.Q., Luo, Y., Peng, J., Bordey, A., Jin, P., Zhao, X.,

2010. MicroRNA miR-137 regulates neuronal maturation by

targeting ubiquitin ligase mind bomb-1. Stem Cells 28, 1060–1070.

Stefani, G., Slack, F.J., 2008. Small non-coding RNAs in animal

development. Nat. Rev. Mol. Cell Biol. 9, 219–230.

Sun, G., Ye, P., Murai, K., Lang, M.F., Li, S., Zhang, H., Li, W., Fu,

C., Yin, J., Wang, A., Ma, X., Shi, Y., 2011a.miR-137 forms a

regulatory loop with nuclear receptor TLX and LSD1 in neural stem cells. Nat. Commun. 2, 529.

Sun, S.G., Zheng, B., Han, M., Fang, X.M., Li, H.X., Miao, S.B., Su,

M., Han, Y., Shi, H.J., Wen, J.K., 2011b.miR-146a and

Kruppel-like factor 4 form a feedback loop to participate in vascular smooth muscle cell proliferation. EMBO Rep. 12, 56–62.

Szulwach, K.E., Li, X., Smrt, R.D., Li, Y., Luo, Y., Lin, L., Santistevan,

N.J., Li, W., Zhao, X., Jin, P., 2010.Cross talk between microRNA

and epigenetic regulation in adult neurogenesis. J. Cell Biol. 189, 127–141.

Takahashi, K., Yamanaka, S., 2006.Induction of pluripotent stem

cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676.

Tarantino, C., Paolella, G., Cozzuto, L., Minopoli, G., Pastore, L.,

Parisi, S., Russo, T., 2010.miRNA 34a, 100, and 137 modulate

differentiation of mouse embryonic stem cells. FASEB J. 24, 3255–3263.

Tay, Y., Zhang, J., Thomson, A.M., Lim, B., Rigoutsos, I., 2008.

MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation. Nature 455, 1124–1128.

Vance, K.W., Carreira, S., Brosch, G., Goding, C.R., 2005.Tbx2 is

overexpressed and plays an important role in maintaining proliferation and suppression of senescence in melanomas. Cancer Res. 65, 2260–2268.

Wang, Y., Baskerville, S., Shenoy, A., Babiarz, J.E., Baehner, L.,

Blelloch, R., 2008. Embryonic stem cell-specific microRNAs

regulate the G1-S transition and promote rapid proliferation. Nat. Genet. 40, 1478–1483.

Wei, C.L., Miura, T., Robson, P., Lim, S.K., Xu, X.Q., Lee, M.Y., Gupta, S., Stanton, L., Luo, Y., Schmitt, J., Thies, S., Wang, W., Khrebtukova, I., Zhou, D., Liu, E.T., Ruan, Y.J., Rao, M., Lim, B.,

2005. Transcriptome profiling of human and murine ESCs

identifies divergent paths required to maintain the stem cell state. Stem Cells 23, 166–185.

Wei, D., Wang, L., Kanai, M., Jia, Z., Le, X., Li, Q., Wang, H., Xie,

K., 2010.KLF4alpha up-regulation promotes cell cycle

progres-sion and reduces survival time of patients with pancreatic cancer. Gastroenterology 139, 2135–2145.

Xu, N., Papagiannakopoulos, T., Pan, G., Thomson, J.A., Kosik,

K.S., 2009.MicroRNA-145 regulates OCT4, SOX2, and KLF4 and

represses pluripotency in human embryonic stem cells. Cell 137, 647–658.

Zhang, P., Andrianakos, R., Yang, Y., Liu, C., Lu, W., 2010.

Kruppel-like factor 4 (Klf4) prevents embryonic stem (ES) cell differen-tiation by regulating Nanog gene expression. J. Biol. Chem. 285, 9180–9189.

Zhang, Z., O'Rourke, J.R., McManus, M.T., Lewandoski, M., Harfe,

B., D. Sun, X., 2011.The microRNA-processing enzyme Dicer is

dispensable for somite segmentation but essential for limb bud positioning. Dev. Biol. 351, 254–265.

Figure

Updating...

References

  1. http://dx.doi.org/10.1016/j.scr.2013.09.001
  2. Stem Cell Research (2013) 11, 1299–1313
  3. LSD1 regulates the balancebetween self-renewal and differentiation in human embryonic
  4. 6609–6618
  5. MicroRNAs: genomics, biogenesis, mechanism,and function. Cell 116, 281
  6. Core transcriptional regulatory circuitry in humanembryonic stem cells. Cell 122, 947
  7. RNAsequence analysis defines Dicer's role in mouse embryonic stem
  8. The transcriptional foundationof pluripotency. Development 136, 2311
  9. miR-7 and miR-214 arespecifically expressed during neuroblastoma differentiation,
  10. Pluripotency and nuclearreprogramming. Annu. Rev. Biochem. 81, 737
  11. Establishment in culture ofpluripotential cells from mouse embryos. Nature 292, 154
  12. Estrogen expandsbreast cancer stem-like cells through paracrine FGF/Tbx3
  13. Tbx3 improves the germ-line competency ofinduced pluripotent stem cells. Nature 463, 1096
  14. Overexpression of LSD1contributes to human carcinogenesis through chromatin
  15. 533–538
  16. An extendedtranscriptional network for pluripotency of embryonic stem
  17. Exploration of tumor-suppressive microRNAs silenced by DNAhypermethylation in oral cancer. Cancer Res. 68, 2094
  18. Prediction of mammalian microRNA targets. Cell 115,787
  19. Navigating theepigenetic landscape of pluripotent stem cells. Nat. Rev. Mol.
  20. Lysine-specific demethylase 1 (LSD1) is highlyexpressed in ER-negative breast cancers and a biomarker predicting
  21. Increased expression of cSHMT,Tbx3 and utrophin in plasma of ovarian and breast cancer
  22. Over-expression of LSD1 promotes proliferation, migration andinvasion in non-small cell lung cancer. PLoS One 7, e35065
  23. 134, 521–533
  24. Interplay of leukemiainhibitory factor and retinoic acid on neural differentiation of
  25. Opposing microRNAfamilies regulate self-renewal in mouse embryonic stem cells.
  26. Characterization of Dicer-deficient murine embry-onic stem cells. Proc. Natl. Acad. Sci. U. S. A. 102, 12135
  27. Activation of p53 signaling initiates apoptotic death ina cellular model of Parkinson's disease. Apoptosis 11, 955
  28. Involvementof histone demethylase LSD1 in short-time scale gene expression
  29. A parallelcircuit of LIF signalling pathways maintains pluripotency of
  30. Non-coding RNAs asregulators of embryogenesis. Nat. Rev. Genet. 12, 136