Test 3 2011
1. Which of the following primers can amplify the following DNA segment by PCR? 3'
ATAGGCATAGGCCCATATGGCATAAGGCTTTATAATATGCGATAGGCGCTGGTCAG 9 0.030 a) 5'ATAGGCATAGGC and 5'TATCCGTATCCG
33 0.108 b) 5'ATAGGCATAGGC and 3'CTGACCAGCGCC 4 0.013 c) 5'CTGACCAGCGCC and 5'GACTGGTCGCGG 233 0.764 d) 5'TATCCGTATCCG and 3'GGCGCTGGTCAG## 26 0.085 e) 5'ATAGGCATAGGC and 5'CCGCGACCAGTC
2. Restriction fragments from which of the following enzymes could be ligated together. The cleavage site is indicated with an apostrophe (').
Enzyme A B C D E
Cleavage site GTTAA'C TTATA'A GTATA'C GAATT'C G'TATAC 11 0.036 a) A and D
145 0.475 b) B and C## 61 0.200 c) C and E 3 0.010 d) B and E
85 0.279 e) none of the above
3. Which of the following amino acids when present in the middle of a polypeptide is not charged at pH 13?
2 0.007 a) E 221 0.725 b) K## 1 0.003 c) D 21 0.069 d) Y
60 0.197 e) None of the rest
4. Which of the followings best describes a protein molecule at pH ABOVE its isoelectric point?
1 0.003 a) most soluble 1 0.003 b) least soluble 1 0.003 c) least stable
293 0.961 d) negatively charged## 9 0.030 e) positively charged
5. If the pKs for glycine's amino and carboxylic groups are 9.0 and 3.0 respectively and the solution pH is 6. Which of the following statement is correct regarding the form of glycine shown in Figure 11 (R=H).
17 0.056 a) It does not exist in nature
2 0.007 b) It can only be produced in test tube
6. Which of the following polypeptides is most likely to assume beta conformation at pH 2? 3 0.010 a) poly-E
261 0.856 b) poly-Y## 5 0.016 c) poly-A 9 0.030 d) poly-D 27 0.089 e) poly-L
7. Which of the following polypeptides is most likely to assume alpha helical conformation at pH 2?
11 0.036 a) polylysine
247 0.810 b) polyglutamic acid## 18 0.059 c) polyglycine
2 0.007 d) polyserine 27 0.089 e) polyvaline
8. Which of the following polypeptides is most likely to assume a random coil conformation at pH 14?
11 0.036 a) poly-K 241 0.790 b) poly-G## 11 0.036 c) poly-A 16 0.052 d) poly-R 25 0.082 e) poly-Q
9. Considering most protein molecules have pIs around 7 and that the buffer used in a
particular polyacrylamide gel electrophoresis (PAGE) maintains the pH at around 8.5, which of the followings is correct
53 0.174 a) Protein sample will migrate towards the cathode (- electrode) 233 0.764 b) Protein sample will migrate towards the anode (+ electrode)## 4 0.013 c) Proteins that have a pIs below 7 will not enter the gel
1 0.003 d) Larger proteins will run faster due to higher charge density 13 0.043 e) Proteins with higher net positive charges will run faster
10. A mixture of protein molecules having pIs ranging from 4 to 12 is analyzed on an
IsoElectric Focusing device where protein molecules are separated according to their attraction towards the electrodes. Which of the followings is correct?
5 0.016 a) Protein molecules with higher molecular weight migrate closer to the cathode (- electrode)
1 0.003 b) Protein molecules with lower molecular weight migrate closer to the cathode (- electrode)
251 0.823 c) Protein molecules with higher pI migrate closer to the cathode (- electrode)## 44 0.144 d) Protein molecules with lower pI migrate closer to the cathode (- electrode) 4 0.013 e) All given answers are incorrect.
276 0.905 b) Native protein structures are only slightly more stable than their denatured forms##
10 0.033 c) Primary determinants of protein stability are Hydrogen bonding and ion pairing 4 0.013 d) Hydrophobic effect contributes relatively little to a protein's stability
8 0.026 e) Secondary structure of a protein determines its 3D structure
12. Chaperonins such as the GroEL/ES system function ____. 0 0.000 a) with thermophilic proteins only
2 0.007 b) at low pH
302 0.990 c) in an ATP-dependent fashion## 1 0.003 d) in vitro only
0 0.000 e) in a non-aqueous environment
13. When collagen is heated to produce gelatin, which of the following interactions is being broken?
4 0.013 a) hydrophobic effects 4 0.013 b) van der Waals interactions 4 0.013 c) hydrogen bonds
23 0.075 d) non-covalent interactions
270 0.885 e) all listed interactions are being broken##
14. It is understood that a ligand binds in a non-cooperative manner when: 275 0.902 a) it displays a hyperbolic binding curve##
14 0.046 b) binding of a ligand to one site affects the binding of additional ligands to other sites
8 0.026 c) the ligand interacts with multiple binding sites simultaneously 5 0.016 d) a sigmoidal binding curve is generated
3 0.010 e) all of the rest
15. Please select the false statement regarding myoglobin 1 0.003 a) It is a globular protein
48 0.157 b) The heme group binds carbon monoxide with a higher affinity than oxygen 13 0.043 c) When the Fe(II) is exposed to oxygen extensively outside the body, it undergoes irreversible oxidation and will change to Fe (III)
3 0.010 d) The change in oxidation state of myoglobin is accompanied by a colour change 239 0.784 e) It is an excellent oxygen transporter##
16. Which of the followings is not correct?
1 0.003 a) Oxygen binds to hemoglobin in a sigmoidal fashion, indicating cooperative binding
9 0.030 b) Oxygen binding to hemoglobin induces conformational changes beyond the local region next to the heme group
272 0.892 c) Structural changes upon oxygen binding to hemoglobin are limited to the local region next to the heme group##
17. Which of the following is false about sickle cell anemia? 3 0.010 a) it has a genetic basis
2 0.007 b) heterozygotes for the allele have improved resistance to malaria 271 0.889 c) it involves a mutation of V --> E##
9 0.030 d) a dangerous effect of this disease is a state called sickle cell crisis 20 0.066 e) none of the rest
18. What is the likely consequence of a mutation that stabilizes the T-form of hemoglobin? 5 0.016 a) The mutated hemoglobin has increased tendency to form methemoglobin 14 0.046 b) The mutated hemoglobin tends to form S fiber
259 0.849 c) The mutated hemoglobin has decreased affinity to oxygen##
25 0.082 d) The mutated hemoglobin shows decreased affinity to Carbon dioxide 2 0.007 e) none of the answers
19. Hemoglobin S has a Glutamate to Valine mutation resulting in formation of S fiber. Which of the following residues on hemoglobin S if mutated to glutamate may lower the risk of sickle cell formation (Figure 7)?
135 0.443 a) Asp G1 (99)## 21 0.069 b) Thr C3 (38) 22 0.072 c) Asp G1 (94) 12 0.039 d) Asn G4 (102) 115 0.377 e) none of the answers
20. According to Table 3, which of the following is not correct
6 0.020 a) the p50 of hemoglobin Yakima is lower than that of normal hemoglobin 9 0.030 b) the p50 of hemoglobin Kansas is higher than that of hemoglobin Yakima 7 0.023 c) the p50 of hemoglobin Kansas is higher than that of normal hemoglobin 53 0.174 d) hemoglobin Yakima binds O2 tighter than hemoglobin Kansas
230 0.754 e) all answers are correct##
21. If the P50 for Hb F is 1.8 torr, and the P50 for Hb A is 20 torr. Which of the following statements is correct at oxygen pressure of 3 torr?
277 0.908 a) Hb F has much higher affinity to oxygen than Hb A## 15 0.049 b) Hb F has much lower affinity to oxygen than Hb A 7 0.023 c) Hb F has similar affinity to oxygen as Hb A
2 0.007 d) Hb F has higher affinity to carbon dioxide than oxygen 4 0.013 e) Hb F has lower affinity to carbon dioxide than oxygen
22. Which is the following is not true about BPG 3 0.010 a) it binds to deoxyhemoglobin
280 0.918 b) it increases hemoglobin's oxygen affinity## 10 0.033 c) it keeps hemoglobin in the deoxy conformation
5 0.016 d) it has lower affinity to fetal hemoglobin than to mother's hemoglobin 7 0.023 e) its level is increased during high altitude acclimation
23. What is the likely consequence of a mutation involving Tyr C7 alpha -> Lysine in hemoglobin S (Figure 7)?
8 0.026 a) The mutated hemoglobin S has increased tendency to form methemoglobin 58 0.190 b) The mutated hemoglobin S tends to form S fiber##
64 0.210 c) The mutated hemoglobin S has increased affinity to oxygen
74 0.243 d) The mutated hemoglobin S shows decreased affinity to Carbon dioxide 101 0.331 e) none of the answers
24. Hemoglobin S has a Glutamate to Valine mutation resulting in formation of S fiber. Which of the following residues on hemoglobin S if mutated to glutamate will possible lower the risk of sickle cell formation?
277 0.908 a) Leu 88## 12 0.039 b) Phe CD1 5 0.016 c) His E7 8 0.026 d) Val E11 3 0.010 e) His F8
25. Which of the followings is not correct?
4 0.013 a) Oxygen binding to hemoglobin promotes the transition to the oxy form 9 0.030 b) CO2 decreases oxygen's affinity to hemoglobin through the Bohr effect 6 0.020 c) BPG decreases hemoglobin's oxygen affinity by binding to deoxyhemoglobin 3 0.010 d) BPG binds tighter to maternal hemoglobin than to fetal hemoglobin
