• No results found

Recapitulation of the Sexual Cycle of the Primary Fungal Pathogen Cryptococcus neoformans var. gattii: Implications for an Outbreak on Vancouver Island, Canada

N/A
N/A
Protected

Academic year: 2020

Share "Recapitulation of the Sexual Cycle of the Primary Fungal Pathogen Cryptococcus neoformans var. gattii: Implications for an Outbreak on Vancouver Island, Canada"

Copied!
10
0
0

Loading.... (view fulltext now)

Full text

(1)

Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Recapitulation of the Sexual Cycle of the Primary Fungal Pathogen

Cryptococcus neoformans

var.

gattii

: Implications for an Outbreak

on Vancouver Island, Canada†

James A. Fraser,

1,2

Ryan L. Subaran,

1

Connie B. Nichols,

1

and Joseph Heitman

1,2,3,4

*

Departments of Molecular Genetics and Microbiology,1Medicine,3and Pharmacology and Cancer Biology4and

Howard Hughes Medical Institute,2Duke University Medical Center, Durham, North Carolina 27710

Received 27 June 2003/Accepted 26 July 2003

Cryptococcus neoformansis a human fungal pathogen that exists as three distinct varieties or sibling species:

the predominantly opportunistic pathogensC. neoformansvar.neoformans(serotype D) andC. neoformansvar.

grubii(serotype A) and the primary pathogenC. neoformansvar.gattii(serotypes B and C). While serotypes A and D are cosmopolitan, serotypes B and C are typically restricted to tropical regions. However, serotype B

isolates of C. neoformans var. gattii have recently caused an outbreak on Vancouver Island in Canada,

highlighting the threat of this fungus and its capacity to infect immunocompetent individuals. Here we report a large-scale analysis of the mating abilities of serotype B and C isolates from diverse sources and identify unusual strains that mate robustly and are suitable for further genetic analysis. Unlike most isolates, which

are of both the a andmating types but are predominantly sterile, the majority of the Vancouver outbreak

strains are exclusively of themating type and the majority are fertile. In an effort to enhance mating of these

isolates, we identified and disrupted the CRG1 gene encoding the GTPase-activating protein involved in

attenuating pheromone response.crg1mutations dramatically increased mating efficiency and enabled mating

with otherwise sterile isolates. Our studies provide a genetic and molecular foundation for further studies of this primary pathogen and reveal that the Vancouver Island outbreak may be attributable to a recent recombination event.

Mating in the microbial world reassorts genomes, increases genetic diversity, and produces strains that can colonize new environmental niches. In several microorganisms, mating is also linked to pathogenicity. In the parasiteToxoplasma gondii, meiosis produces more-pathogenic isolates by recombining the genomes of two less-virulent strains (13, 42). In the plant fungal pathogenUstilago maydis, mating is required for infec-tion of maize because it is the filamentous dikaryon form that is pathogenic (for a review, see reference 32). In the human fungal pathogenCryptococcus neoformans, the␣mating type has been linked to virulence (25) and sexual recombination produces spores, the suspected infectious propagule (43; J. Cohen, J. R. Perfect, and D. T. Durack, Letter, Lanceti:1301, 1982).

C. neoformans is a haploid, encapsulated yeast that is the

most common cause of fungal meningitis, which is fatal if untreated (17, 22, 29).C. neoformansstrains can be classified into three divergent varieties and four serotypes based on capsular antigens:C. neoformansvar.neoformans(serotype D),

C. neoformansvar.grubii(serotype A), andC. neoformansvar.

gattii (serotypes B and C). Serotypes A (the most clinically

prevalent) and D are opportunistic pathogens that infect im-munocompromised individuals throughout the world, whereas the divergent B and C serotypes are primary pathogens that

infect predominantly immunocompetent hosts (40). In contrast to serotypes A and D, which are cosmopolitan and most fre-quently associated with pigeon guano, the serotype B and CC.

neoformansvar.gattiiis usually restricted to tropical and

sub-tropical regions of the world, where it is found in association with woody debris of eucalyptus trees (10).

Mating among serotype D strains (the least virulent variety) has been well characterized, and a congenic pair has been created to facilitate genetic analysis (16, 25). In contrast, the first accounts of the characterization of mating among serotype

A C. neoformans var. grubii strains have only recently been

reported (18, 35), an advance that was made possible by the discovery ofaisolates long thought to be extinct (30, 45). The sexual system is bipolar (involvinga and␣ cell types) and is dependent on an unusually large mating type locus (28).

Serotype A (C. neoformansvar.grubii) strains exist predom-inantly as clonal isolates of the␣mating type throughout the world (12, 23, 47). In contrast, mixed populations ofaand␣C.

neoformans var. gattii strains have been identified colonizing

hollows of eucalyptus trees in the Australian environment, where there is a relatively high incidence of cryptococcosis in native animals and indigenous human populations (4, 11, 14, 15). Despite the presence of both mating types, no meiotic recombination has been detected, suggesting that this ecolog-ical niche may support only clonal propagation of yeast cells and that sexual development occurs elsewhere if at all (15).

Interest in the primary pathogenic form ofC. neoformans

has increased due to an outbreak ofC. neoformansvar.gattii

infection on Vancouver Island in Canada. Prior to 1999, an average of two or three cases of cryptococcosis occurred an-nually in British Columbia and were caused by infections with * Corresponding author. Mailing address: Department of Molecular

Genetics and Microbiology, 322 CARL Building, Research Dr., Duke University Medical Center, Durham, NC 27710. Phone: (919) 684-2824. Fax: (919) 684-5458. E-mail: [email protected].

† The supplemental material for this article may be found at http: //ec.asm.org/.

1036

on September 8, 2020 by guest

http://ec.asm.org/

(2)

serotype D. Since 1999, more than 66 human cases in otherwise healthy individuals, with at least four fatalities, have been re-ported and are attributable to infection with serotype B (M. Fyfe, W. Black, M. Romney, P. Kibsey, L. MacDougall, M. Starr, M. Pearce, C. Stephen, L. Stein, S. Mak, B. Emerson, J. Isaac-Renton, and D. Patrick, 5th Int. Conf. Cryptococcus Cryptococcosis, abstr. P1.1, 2002). There has also been an equally large increase in the rate of infection of animals, in-cluding dogs, cats, and porpoises (41). On Vancouver Island,

C. neoformansvar.gattiihas been found in association with a

number of native tree species (Douglas fir, alder, maple, and Garry oak) rather than eucalyptus trees, a previously identified environmental source of this variety. This expansion of the serotype B habitat to include nontropical areas increases the human risk of acquiring cryptococcosis and makes it para-mount to understand the mechanisms by whichC. neoformans

var.gattiireproduces sexually.

Our studies address the role of sexual reproduction in the life cycle and virulence ofC. neoformans. The majority of C.

neoformansvar.gattiistrains are sterile under most laboratory

conditions. Although the perfect state of C. neoformans var.

gattiiwas first reported over 25 years ago (21), these findings

have proven difficult to reproduce (14, 26, 31, 34). Here we have recapitulated and extensively analyzed the sexual cycle of

C. neoformans var. gattii. First, we describe conditions that

support mating of a number of serotype B and C isolates from diverse sources. Second, we show that the vast majority of isolates from the Vancouver Island outbreak are fertile and that all are of the␣mating type. Third, we identify a pair ofa

and ␣ strains that mate robustly to produce viable meiotic progeny, providing a platform for genetic studies. Finally, we perform targeted gene disruptions in this variety and define a conserved role for the regulator of G protein signaling (RGS) protein Crg1 in pheromone sensing by demonstrating that

crg1⌬ strains mate more vigorously than wild-type strains.

Taken together, our studies provide a genetic and molecular foundation for further studies of this primary pathogen and reveal that the Vancouver Island outbreak may be attributable to a recent recombination event in an unusual, fertile clade of

C. neoformans.

MATERIALS AND METHODS

Strains, media, and mating assays.Reference strains used in this study were the congenic serotype D strains JEC20 (a) and JEC21 (␣) (16, 25). Strains were grown on yeast extract-peptone-dextrose (YEPD) medium. Mating assays were carried out on V8 medium (24) (5% [vol/vol] V8 juice, 3 mM KH2PO4, 4%

[wt/vol] agar) at pH 5 or 7, carrot medium (5% [vol/vol] carrot juice, 3 mM KH2PO4, 4% agar), or synthetic low ammonium dextrose (SLAD) medium. The

ability to mate was tested against the serotype D tester strains JEC20 and JEC21, the serotype C strains NIH312 (␣) and B4546 (a), andcrg1⌬mutant derivatives JF101 (␣) and JF109 (a). Strains were pregrown on YEPD agar for 2 days, and a small amount of cells was removed and patched onto solid mating medium either alone or mixed with a reference strain. Plates were incubated at room temperature in the dark for 9 days and assessed by light microscopy for filament and basidiospore formation.

Molecular techniques.Standard methods were performed as described by Sambrook et al. (37). Serotyping was done using the Crypto Check serotyping kit from Iatron Laboratories (Tokyo).C. neoformansgenomic DNA for Southern blot analysis was prepared as described by Pitkin et al. (36).C. neoformans biolistic transformation was performed using the technique for serotype D as described by Davidson et al. (7).

Primers.Sequences of primers are as follows: STE12␣U, CAATCTCAAAGCG GGGACAG; STE12␣L, CTTTGTTTCGGTCCTAATACAGCC; JOHE6013,

GCAACCAATCACTATGAA; JOHE6014, TGTGATCTGGTTCATGTA; JOHE8733, GCTGCGAGGATGTGAGCTGGA; JOHE8734, TCCATCTTG TTCAATCATAGACATGTTGGGCGAGTT; JOHE8735, AACTCGCCCA ACATGTCTATGATTGAACAAGATGGA; JOHE8736, ACCCCTTACCG CCTTCACTCAGAAGAACTCGTCAAG; JOHE8737, CTTGACGAGTTC TTCTGAGTGAAGGCGGTAAGGGGT; JOHE8738, GGTTTATCTGTAT TAACACGG; JOHE8896, CCCCTTCAACACAGCTCTTTA; JOHE8897, CAAGCCACCGGTCCTTATCCC; JOHE8987, AAGTTCGGACTGATTT ATTCA; JOHE8988, CGGAGGATAGAAGCTGTAAGCCAAAGTAAGG GGTAAGTTGGCAGA; JOHE8989, CCGTGTTAATACAGATAAACCGT CTTCAGAATACGAAAAGGACGA; JOHE8990, AAGCAAGACGGGAC TTATTGT; JOHE9365, CAGAAACGGTAACGGGAGCAC; JOHE9366, GCCCCTTCTTTCCTTATTCCT; JOHE9421, ATCCGCCCTCGAGTC AAA; JOHE9422, TGGCGACCGACTGTAGAT; JOHE9779, CCTTACTCCAT AACCCGCTAC; JOHE9780, AATTTCATAACGCTTTGGGAA; JOHE9787, ACACCGCCTGTTACAATGGAC; JOHE9788, CAGCGTTTGAAGATGGAC TTT; JOHE9574, ATTCGCCACCGGTTTATCTGTATTAAC; JOHE9575, ATT CGCCCTTTAAACGAGGATGTGAGC; JOHE9592, GAGTTCAGGCTTTTTC ATAGACATGTTGGGCGAGTT; JOHE9593, AACTCGCCCAACATGTCTAT GAAAAAGCCTGAACTC; JOHE9594, ACCCCTTACCGCCTTCACCTATTC CTTTGCCCTCGG; JOHE9595, CCGAGGGCAAAGGAATAGGTGAAGGCG GTAAGGGGT.

Determination of mating type.Mating type was established by PCR using genomic DNA prepared with the Camgen yeast genomic DNA extraction kit (Whatman BioSciences Ltd., Cambridge, United Kingdom) with primers specific to theSTE20a(JOHE9421-JOHE9422),STE12␣(STE12␣U-STE12␣L),MFa (JOHE9787-JOHE9788), andMF␣(JOHE9779-JOHE9780) genes. PCR was repeated twice.

Plasmids.The Neormarker cassette clone pJAF1 was generated by combining

the serotype A strain H99ACT1promoter (JOHE8733-JOHE8734), the trans-poson Tn5Neorgene (JOHE8735-JOHE8736), and the H99TRP1terminator

(JOHE8737-JOHE8738) via overlap PCR using primer pair JOHE8733-JOHE8738 and cloned into plasmid pCR-TOPO2.1. The Hygrmarker cassette

clone pJAF15 was created in an equivalent fashion by combining theACT1 promoter (JOHE8733-JOHE9592), the Hygrgene (JOHE9593-JOHE9594), and

theTRP1terminator (JOHE9595-JOHE8738) via overlap PCR using primer pair JOHE8733-JOHE8738 and cloned into plasmid pCR-TOPO2.1. Bacterial arti-ficial chromosomes (BACs) containing the serotype BCRG1gene (Australian isolates WM276 BAC 2B19 and E566 BAC 2B13) were identified by hybridiza-tion with a 1.2-kbCRG1PCR fragment (JOHE6013-JOHE6014) from the se-rotype A strain H99. Based on results of Southern blot analysis, theCRG1gene was subcloned as a 6.5-kbXhoI fragment into pBluescript SK⫺SalI to yield plasmids pJAF2 (WM276) and pJAF3 (E566). Sequencing of the 6.5-kb sub-clones revealed only one single nucleotide polymorphism between the two iso-lates. TheCRG1reconstitution plasmid was created by amplifying the pCH233 Natrcassette (JOHE9574-JOHE9575), digesting it withAgeI/DraI, and using it to

replace theNgoMIV/BsaA1 f1 origin fragment of pBluescript SK⫺to give the Natrcloning plasmid pJAF13. The WM276CRG1gene was then subcloned from

pJAF2 into pJAF13 as a 6.6-kbApaI/PstI fragment, yielding pJAF14. Disruption of theCRG1gene.crg1deletion alleles for the Australian isolates were generated by replacing the 3-kbEco47III/SpeI fragment of theCRG1gene in plasmid pJAF2 with the Natrcassette from plasmid pCH233 and the Neor

cassette from plasmid pJAF1 as anEcoRV/XbaI fragment to yield plasmids pJAF4 and pJAF6, respectively.

With the use of theCRG1gene sequence from strain WM276, overlap primers were designed to allow the construction of deletion alleles in strains NIH312, B4546, and R265 without the need to subclone and sequence theCRG1gene. Building upon the technique of deletion allele generation by overlap PCR (6), we found that the process could be simplified by avoiding the use of chimeric primers for the marker segment, reducing the number of gene-specific primers required from six to four (Fig. 1). Furthermore, the design of the Neorand Hygr

cassettes allows the same primer sets to be used for either a Neor, Natr, or Hygr

disruption cassette. PCR was used to generate CRG1 5⬘ (JOHE8987-JOHE9094), 3⬘ (JOHE8989-JOHE8990), and Neor (JOHE8733-JOHE8738)

products, which were combined in a PCR overlap reaction (JOHE8987-JOHE8990) to yield strain-specificCRG1 deletion alleles. We used biolistic transformation for each strain of interest, introducing the appropriate circular plasmid (in strains WM276 and E566) or overlap PCR product (in strains B4546, NIH312, and R265) and selecting for resistance to G418 (200␮g/ml) or nourseo-thricin (100␮g/ml).crg1⌬transformants were identified by Southern blotting using the 6.5-kb WM276CRG1gene fragment as a probe (data not shown). Homologous integration frequencies were higher with overlap PCR products (7 of 60 for B4546, 6 of 70 for NIH312, and 15 of 32 for R265) than with circular

on September 8, 2020 by guest

http://ec.asm.org/

(3)

plasmid-bornecrg1deletion alleles (2 of 86 and 2 of 65 for the E566 Natrand

Neoralleles, respectively, and 2 of 17 for the WM276 Neorallele).

Restriction fragment length polymorphism (RFLP) analysis.Fragments of the PLB1(27) andSOD1(3) genes were amplified from strains NIH312 and B4546 by PCR using the JOHE8896-JOHE8897 and JOHE9365-JOHE9366 primers pairs, respectively, and sequenced. Comparison revealed unique restriction sites in each gene—aBglI restriction site present only in thePLB1gene of strain NIH312 and aBsaJI restriction site present only in theSOD1gene of strain B4546. For analysis of meiotic progeny and diploids, gene fragments were PCR amplified as described above and DNA was incubated with 1 U of the appro-priate restriction enzyme and buffer for 2 h and separated on a 1.5% agarose gel. Slide matings.Glass microscope slides were sterilized, placed at a 20° angle in a plastic petri dish by using a sterile microfuge tube, and coated with a thin layer of molten V8 agar, with 5 ml of liquid V8 medium added to the bottom of each. The strains to be mated were resuspended in distilled H2O, and 10␮l was

pipetted at the apex of the slide and allowed to drain down the slide, creating a mating patch 3 to 4 cm in length and 0.5 cm wide. Slides were incubated at room temperature for 3 to 5 days in the dark.

Microscopy and staining.For filament staining, slides were transferred to a fresh petri dish, washed three times with 10 ml of phosphate-buffered saline (PBS), fixed in 10 ml of 70% ethanol for 20 min, washed three times with PBS, permeabilized with 1% Triton X-100 in PBS for 10 min, and washed three times with PBS prior to staining. To visualize septa and DNA, filaments from matings were incubated in a 10-ml preparation of calcofluor white (fluorescent brightener 28 F-3397; Sigma) at 20␮g/ml and a 5,000⫻dilution of a 5 mM solution of Sytox Green (Molecular Probes) in PBS for 20 min. Agar sections containing filaments were mounted on fresh microscope slides with 5␮l of antifade (1 mg ofp -phenylenediamine/ml in 50% glycerol).

Bright field, differential interference microscopy (DIC), and fluorescent im-ages were captured with a Zeiss Axioskop 2 Plus fluorescent microscope equipped with an AxioCam MRM digital camera and corresponding software.

Environmental scanning electron microscopy (ESEM) was performed using a Philips XL30 ESEM TMP (FEI Company, Portland, Oreg.). Mating reactions were carried out on V8 plates, fixed by exposure to osmium tetroxide vapor for 30 min, and excised blocks of agar were adhered to prechilled stubs by using double-sided tape. The samples were viewed with a secondary electron detector at pressures of 5.2 to 5.5 torr and temperatures of 2.5 to 4.4°C and with a beam of 15 to 18 kV. Working distance ranged from 8.7 to 11 mm.

Nucleotide sequence accession numbers.The sequence for theCRG1genes of strains WM276 and E566 has been deposited in GenBank under accession number AY327612. The accession numbers for the partial sequences of the SOD1andPLB1genes are AY327613 and AY327615 for NIH312 and AY327614 and AY327616 for B4546, respectively.

RESULTS

Intervarietal mating ofC. neoformansvar.gattiistrains.

Pre-vious analyses of C. neoformans var. gattii mating involved intervarietal mating between serotype D tester strains and se-rotype B or C strains of the opposite mating type (21). We employed a similar approach and systematically analyzed the ability of a collection of 145 serotype B and C strains to mate with congenic serotype Da(JEC20) and␣(JEC21) strains on V8 pH 7 medium (see Table S1 in the supplemental material). Our collection consisted of three groups: laboratory serotype B (20) and C (14) isolates from diverse sources, Vancouver Is-land outbreak serotype B isolates (83), and Australian serotype B isolates (28).

Analysis of the lab isolates revealed that 18 of 34 (53%) were sterile when mated with the appropriate serotype D tester strain. Of the 47% that did mate, mating was exclusively with partners of a single mating type (aor␣). Accordingly, PCR analysis of these isolates with primers for␣-specific anda -spe-cific genes revealed that each isolate was of a single mating type (see Table S1 in the supplemental material).

The Australian isolates exhibited a different pattern. Of the clinical isolates, three of six (50%) mated with the tester strains. In contrast, 100% (22 of 22) of the environmental isolates were sterile. Overall, only 10% of isolates obtained from Australia were fertile.

Importantly, the majority of the Vancouver Island outbreak isolates were fertile (70%, or 58 of 83). In contrast to isolates from Australia and elsewhere, which were bothaand␣, all of the Vancouver isolates were of the␣mating type. Additionally, the mating abilities of the Vancouver Island outbreak isolates were not correlated with their clinical or environmental ori-gins.

A C. neoformans var. gattii pair can mate robustly. Most previous attempts to recapitulate mating ofC. neoformansvar.

gattii used the type cultures NIH444 (serotype B and mating

type␣) and NIH191 (serotype C and mating typea). We found that both of these isolates mated with the appropriate serotype D tester strains, but mating to each other was much more difficult to detect and produced only a very weak mating reac-tion that was restricted to V8 pH 5 or carrot medium and required incubation for 6 weeks (data not shown).

Further analysis of our collection revealed an alternative pair of serotype C isolates (NIH312,␣, and B4546,a) (Fig. 2) that mated with serotype D tester strains and robustly with each other. These isolates also mated with the type strains

NAT/NEO/HYG JOHE8733

JOHE8738 GSP1

GSP4 GSP3

GSP2

CRG1

A

GSP1

YFG1 5'

GSP4

YFG1 3'

NAT/NEO/HYG

B

YFG1 5' NAT/NEO/HYG YFG1 3'

C

FIG. 1. Simplification of the creation of knockout constructs by using overlap PCR. We found that only four gene-specific primers (GSP), as opposed to six, were required to create knockout constructs. The flanking regions of the gene to be deleted were amplified (A) us-ing one normal (GSP1-GSP4) and one chimeric (GSP2-GSP3) primer for each side. The marker cassette was amplified using the oligonucle-otides JOHE8733 and JOHE8738, which work with the Natr(NAT),

Neor(NEO), and Hygr(HYG) cassettes. Like the products of normal

overlap PCR, the three products were combined with the primers GSP1 and GSP4 (B) and amplified to yield the final knockout con-struct (C). For disruption ofCRG1, the primers JOHE8987 (GSP1), JOHE9094 (GSP2), JOHE8989 (GSP3), and JOHE8990 (GSP4) were used.

on September 8, 2020 by guest

http://ec.asm.org/

(4)

NIH444 and NIH191. We retested our collection of 146 iso-lates with this new mating pair. All of the strains that were mating competent with the serotype D testers also mated with these serotype C tester strains (see Table S1 in the supplemen-tal material; Fig. 2). Additionally, we detected mating with 18 additional isolates from Vancouver Island (nine clinical or veterinary and nine environmental) that failed to mate with the serotype D strains, raising the percentage of mating-competent outbreak isolates from 70 to 91%.

Morphology of mating serotype C strains.Based on

exam-ination by light microscopy and ESEM, filaments produced by mating of the serotype Caand ␣strains B4546 and NIH312 exhibit morphological features characteristic of those pro-duced by mating of basidiomycetes, including segregation of two haploid nuclei per filament cell and the production of fused clamp connections that enable faithful segregation of these nuclei. In contrast to serotype D crosses, which produce long peripheral hyphae, the intervarietal and serotype C intra-varietal crosses produce abundant, shorter filaments primarily above the mating reaction. Calcofluor white staining revealed the presence of fused clamp connections (Fig. 3). Also unlike mating serotype D strains, mating serotype C strains form a protrusion from the subapical cell to which the clamp fuses, reminiscent of the peg structures observed inCoprinus cinereus

(Fig. 3A) (20). This structure was not observed in serotype D in intervarietal crosses with serotype C (data not shown). Sytox

Green staining revealed that each filament cell was dikaryotic and contained paired, comigrating nuclei (Fig. 3).

ESEM was used to more closely examine the filaments pro-duced during mating. In both serotype D and serotype C mat-ing reactions, abundant filaments form, which in turn develop immature basidia. Four evenly spaced buds form simulta-neously on the surface of the basidium and develop into basi-petal chains of spores through consecutive rounds of budding (Fig. 4B). The serotype C rod-shaped spores are approximately twice as long as their lemon-shaped elliptical serotype D coun-terparts (Fig. 4B).

The morphology of the mating Vancouver isolates differed from that of the serotype C isolates. While the serotype C mating pair produced intermediate-length aerial filaments over the vegetative mass, the Vancouver isolates produced basidia on stunted filaments close to the surface of the colony. How-ever, the morphologies of the basidia and spores were the same as those of serotype C.

Dominant selectable markers inC. neoformansvar.gattii.To

facilitate molecular studies of spore formation in C.

neofor-mans var.gattii, we investigated the efficacy of several

domi-nant markers in serotypes B and C. We confirmed that biolistic transformation of strains NIH312, B4546, R265, WM276, and E566 with the Natrcassette (33) plasmid pCH233 conferred resistance to nourseothricin (100 ␮g/ml). Firstly, this verified that we could use biolistic transformation to transform a

vari-A

F

E

D

C

B

FIG. 2. Morphology of matingC. neoformansvar.gattiipairs.C. neoformansisolates were mated on V8 pH 7 medium on glass slides for 3 days, and morphology was observed. DIC microscopy allowed comparison of the mating ability and morphology of the congenic serotype D pair (JEC20 [serotype D and mating typea]⫻JEC21 [serotype D and mating type␣] [crosses are hereafter indicated in the form JEC20 Da⫻JEC21 D␣]) (A) with those of the robustly mating serotype C pair (B4546 Ca⫻NIH312 C␣) (B) and a serotype B-serotype C pair including one of the Vancouver isolates (B4546 Ca⫻R265 B␣) (C). All three of theseC. neoformansvar.gattiiisolates underwent intervarietal mating with the serotype D congenic pair. (D) B4546 Ca⫻JEC21 D␣. (E) JEC20 Da⫻NIH312 C␣. (F) JEC20 Da⫻R265 B␣. A comparison of morphologies of mating pairs (scale bar, 200␮m) and basidial spore chain morphologies (inset) (scale bar, 20␮m) is given.

on September 8, 2020 by guest

http://ec.asm.org/

(5)

ety of serotype B and C strains, and secondly it demonstrated that the serotype A strain H99ACT1promoter that drives the cassette can function in all four serotypes.

Building upon the design of the Natrcassette, we generated two derivatives by overlap PCR, replacing the Natr coding region with the Tn5Neorgene (pJAF1) or theEscherichia coli Hygr gene (pJAF15). Biolistic transformation of serotype A strain H99, serotype B strains R265, WM276, and E566, sero-type C strains NIH312 and B4546, and the serosero-type D strain JEC21 with these plasmids confirmed that pJAF1 and pJAF15 were sufficient to confer resistance to G418 (200 ␮g/ml) and hygromycin B (200␮g/ml), respectively, in all four serotypes of

C. neoformans. Previous marker cassettes designed to confer

resistance to hygromycin B had not functioned in serotypes B and C (5).

Differentially marked serotype C strains mate to produce

recombinant spores. The morphology ofC. neoformans var.

gattii is distinct from those ofC. neoformansvar.neoformans

andC. neoformansvar.grubii, asC. neoformansvar.gattiiforms

both round and elongated cells during infection (44) and elon-gated spores during mating (21). Elonelon-gated vegetative cells also form during growth on V8 medium irrespective of the mating partner and are difficult to distinguish from basidio-spores during microdissection. Therefore, to select meiotic progeny, we differentially marked the serotype C mating pair NIH312 and B4546 by biolistic transformation with the Natr and Neorcassettes. These marked strains (MATNatr[JF65] and MATa G418r ura5 [JF66]) were mated for 6 days and plated onto YEPD medium containing nourseothricin and G418. Similar to results with serotype D, stable Natr G418r diploids were obtained at 37°C that were thermally dimorphic, growing as yeast at 37°C but self-filamentously on V8 medium at 25°C (38). By selecting at 30°C, we could identify NatrG418r recombinant isolates that were not thermally dimorphic. To validate that these were bona fide meiotic progeny, we ana-lyzed the segregation of four markers in a subset of the non-filamentous isolates and observed recombinant progeny (Fig. 5). The markers includedura5(from theaparent), RFLPs in thePLB1andSOD1genes, and the MAT locus (aand␣). This analysis demonstrates that a random spore analysis approach can be used to isolate mating-competent meiotic progeny of serotype C.

Mutation of the RGS protein Crg1.InSaccharomyces

cer-evisiae, mating is controlled by the pheromone response

path-way, which is conserved inC. neoformans. Detection of

pher-C

Ca x D

α

D

Da x C

α

E

Ca crg1 x C

α

crg1

B

Ca x C

α

A

Da x D

α

FIG. 3. Serotype C strains form dikaryon filaments and fused clamps during mating. Staining filaments from V8 pH 7 medium slide matings with calcofluor white and Sytox Green revealed that, as with serotype D (JEC20 Da⫻JEC21 D␣[Da⫻D␣]) (A), both serotype C (B4546 Ca⫻NIH312 C␣[Ca⫻C␣]) (B) and intervarietal serotype C-serotype D (B4546 Ca⫻JEC21 D␣[Ca⫻D␣] and JEC20 Da⫻ NIH312 C␣[Da⫻C␣]) (C and D, respectively) crosses form dikary-otic filaments with paired nuclei (white arrows) and fused clamp con-nections (grey arrows). These same structures could also be observed in acrg1⌬bilateral cross (JF109 Ca⫻JF101 C␣[Cacrg1⫻C␣crg1]) (E), supporting the observation that these strains undergo enhanced mating, as opposed to haploid fruiting which produces unfused clamps and uninucleate filaments. Scale bar, 10␮m.

on September 8, 2020 by guest

http://ec.asm.org/

(6)

omones by a heterotrimeric G protein-coupled receptor initiates a conserved mitogen-activated protein kinase cascade to activate transcriptional regulators (for a review, see refer-ence 9). In yeast, this pathway is negatively regulated by the RGS protein Sst2, which accelerates the intrinsic GTPase ac-tivity of the G␣ subunit to silence signaling (1, 8). The C.

neoformans SST2homologue is theCRG1gene, andcrg1

mu-tations enhance mating of serotype A (35; P. Wang, personal communication). Here we show that a CRG1-targeted gene disruption enhances mating of serotypes B and C.

The first targeted gene disruption in C. neoformans var.

gattii, that of the serotype BSOD1gene with the use of the

URA5 gene, was recently reported (34). We disrupted the

CRG1gene in the serotype B strain WM276 by using dominant selectable markers that confer resistance to nourseothricin or G418. We also isolatedcrg1::Neormutations in the serotype C mating pair NIH312 (␣) and B4546 (a) and the Vancouver Island clinical isolate R265 (␣).

When cocultured with a strain of the opposite mating type, thecrg1mutant derivatives of NIH312, B4546, and R265 un-derwent much more rapid and proliferative mating reactions than the wild types, producing more hyphae and basidia (Fig.

6). This was also observed in intervarietal matings with sero-type D strains. The enhanced mating of thecrg1mutant strains was restored to the wild-type level when the wild-typeCRG1

gene was reintroduced (data not shown). Comparison of uni-lateral mutant crosses to biuni-lateral mutant crosses revealed that the effect of thecrg1mutation is additive. Deletion ofCRG1

was sufficient to allow mating on YEPD, a medium that usually strongly represses mating, in the case of a unilateral or bilateral cross (data not shown), indicating that this mutation is suffi-cient to bypass the nutritional limitation and desiccation sig-nals normally required forC. neoformansmating.

Mutation ofCRG1 enables mating with a subset of

previ-ously sterile strains.Unlike the crg1serotype C mating pair

and Vancouver isolates, neither of the Australiancrg1⌬strains exhibited any detectable mutant phenotype, nor could the

CRG1 wild-type Australian isolates WM276 (serotype B and mating type␣) or E566 (serotype B and mating typea) mate

with crg1⌬ strains. Also, attempts to identify fusion of the

B4546crg1::Neorstrain JF109 and the E566crg1::Natrstrain JF9 by selecting for diploids at 37°C on YEPD medium con-taining nourseothricin and G418 failed to identify NatrG418r strains. The failure of the Australian isolate E566 to produce

B

A

C x C

C x C

C x C

D x D

C x C

D x D

FIG. 4. Clamp cell formation and ESEM of serotype C basidia. (A) Staining with calcofluor white to analyze clamp cell formation revealed that the morphologies of mating pairs differ in serotype D and serotype C matings. In a serotype D cross (JEC20 Da⫻JEC21 D␣[D⫻D]) (top row, left to right), the clamp cell (large arrows) forms and fuses to the subapical filament cell. In a serotype C cross (B4546 Ca⫻NIH312 C␣[C⫻ C]) (bottom row, left to right), clamp cell fusion involves the formation of a peglike protrusion (small arrows) from the filament subapical to the clamp cell (large arrows), to which the clamp fuses. Scale bar, 5␮m. (B) ESEM of mating serotype C strains (B4546 Ca⫻NIH312 C␣[C⫻C]) shows the formation of four evenly spaced buds on the immature basidia, which develop into chains of smooth, rod-shaped spores. In contrast, mating serotype D strains (JEC20 Da⫻JEC21 D␣[D⫻D]) form more-spherical, rough basidiospore chains. Scale bar, 10␮m.

on September 8, 2020 by guest

http://ec.asm.org/

(7)

mating structures is therefore due to a defect prior to fusion. This suggests that mutation of theCRG1gene increases exist-ing matexist-ing compatibility, leadexist-ing to the production of more mating filaments. To test this hypothesis, we repeated our mating analysis of the original collection of 145 isolates by using NIH312 and B4546crg1⌬mutants as tester strains. In all instances in which strains previously mated with NIH312 or B4546, this reaction was enhanced in acrg1⌬unilateral cross (see Table S1 in the supplemental material). In addition, one more serotype C strain (a total of 10 of 14, or 71%) and three more Vancouver Island environmental isolates (a total of 56 of 59, or 95%) mated. Thecrg1⌬strains are therefore useful tools for analyzing mating ofC. neoformansvar.gattii, allowing

mat-ing to be more readily observed and in some cases enablmat-ing otherwise sterile strains to mate.

DISCUSSION

Recapitulation of mating ofC. neoformans var.gattii. The

role of a sexual cycle in virulence of the human fungal

patho-gen C. neoformans is of great interest, as its importance in

virulence is twofold. First, the vast majority of clinical cases are caused by strains of the ␣mating type, and in serotype D,␣

strains have been shown to be more pathogenic thanastrains in a murine model (25). Second, the basidiospore is thought to be the infectious propagule. The sexual cycle and the compo-nents of the mating signaling cascade of C. neoformansvar.

neoformanshave been studied intensely over the last decade,

and recently this research has been extended to include sero-type A C. neoformans var. grubii, in which a isolates and a complete sexual cycle have only recently been identified (18, 30, 35, 45). In contrast, the sexual cycle ofC. neoformansvar.

gattiiwas first reported almost 30 years ago (21). Here we have

recapitulated the original data on mating ofC. neoformansvar.

gattiiand extended these original studies by identifying strains

that mate robustly with one another and with a large number of clinical and environmental isolates. Independently, Tscharke and Kwon-Chung have also identified serotype B strains capable of mating (R. L. Tscharke and K. J. Kwon-Chung, Abstr. 103rd Gen. Meet. Am. Soc. Microbiol., abstr. F-063, 2003). The recapitulation of data on mating and the discovery of robustly mating strains provide a platform for the generation of congenic serotype C strains and serve as an important foundation for genetic studies of this variety.

As we have previously observed for serotype A (35), someC.

neoformansvar.gattiiisolates are sterile, some are fertile, and

others are capable of mating only with certain tester strains. This preference for mating partners can potentially be ex-plained by three possible mechanisms. First, cryptic speciation events may be occurring that restrict mating between some members of the population, as has occurred in several other fungi, such asCoccidioides immitisandCoccidioides posadasii

(19). Second, a spontaneous loss of mating ability may be occurring in nature or during laboratory passage, as has re-cently been reported forC. neoformansserotype D strains (46). Third, alterations in the mating type locus may lead to a loss or restriction of mating capacity, and we are currently investigat-ing this possibility by sequencinvestigat-ing the aand ␣ alleles of the MAT locus from strains WM276 and E566.

Targeted gene disruption using dominant selectable

mark-ers in serotypes B and C. In addition to the availability of

genetic analysis, the ability to perform targeted disruptions is an essential attribute with regard to a model organism. Our studies presented here demonstrate that the Natr, Hygr, and Neorcassettes can be used as dominant selectable markers in

C. neoformans var. gattii to readily disrupt genes by biolistic

transformation and homologous recombination, providing valuable tools for facilitating molecular manipulation of the genome. The ability to transform a range of clinical and envi-ronmental isolates by using plasmids that can function in other varieties not only provides a tool for performing targeted dis-ruptions inC. neoformansvar.gattiibut also allows the option

PLB1

SOD1

STE12

α

STE20a

NIH 312 CDC

B4546

Diploid

Progeny 1

JF65 JF66 Progeny 2 Progeny 3 Progeny 4

URA5

+

+

+

-

+

+

-

+

+

MAT

α

a

α

a

a

a

α α

a/

α

MF

α

MFa

FIG. 5. Analysis of meiotic progeny of a serotype C cross. The mating mixture of two marked strains—MAT␣Natr(JF65) and MATa

G418rura5(JF66)—was plated onto YEPD medium containing both

nourseothricin and G418 to select for recombinants. The parental strains and four progeny, in addition to diploid controls, were analyzed by PCR analysis for the segregation of RFLPs in thePLB1andSOD1 genes and the mating type loci by using primers for the STE12␣, STE20a,MF␣, andMFagenes. Segregation of the ability to grow in the absence of uracil supplementation (URA5) and the ability to mate with the parental strains B4546 (serotype C and mating typea) and NIH312 (serotype C and mating type␣) was also tested.

on September 8, 2020 by guest

http://ec.asm.org/

(8)

of utilizing marker constructs and gene regulatory sequences designed for use in serotype A or D.

The Vancouver Island outbreak is attributable to an

unusu-ally fertile set of isolates.Attention has recently focused on the

primary pathogenic form ofC. neoformansdue to an outbreak on Vancouver Island, Canada. The presence ofC. neoformans

var. gattii on Vancouver Island indicates that this primary

pathogen is not restricted to tropical regions. Our study reveals that, unlike isolates originating from elsewhere in the world, the strains from the Vancouver Island outbreak are exclusively of the ␣ mating type. Furthermore, the vast majority of the outbreak isolates are fertile. This observation gives rise to several possible models. In the first, mating and meiotic re-combination in a fertile clade may have given rise to an isolate with increased virulence, expanded host range, or an altered environmental niche. In the second, the fertility of the isolates may increase the production of the infectious propagule, in-creasing the incidence of infection. Third, the outbreak may be attributable to a so far unobserved ability of these isolates to undergo haploid fruiting, which perhaps explains the presence of exclusively␣isolates. Finally, the relationship between the outbreak and the fertility of these isolates may be coincidental.

Australian environmental isolates are sterile.In contrast to

the fertility of isolates from Vancouver Island and elsewhere in the world is the infertility of the Australian environmental isolates, as we were unable to identify mating of any of these isolates. This finding supports previous reports that failed to

identify recombining populations in association with eucalyp-tus trees (15). In contrast, 50% (three of six) of clinical isolates were fertile. These isolates may have originated elsewhere or may be due to the production of spores from rare environmen-tal isolates. It is still possible that the conditions for mating of this subset of isolates differ from those for mating of the fertile strains identified thus far and that given appropriate conditions or mating partners these strains may be capable of undergoing sexual recombination. This represents an important avenue of study, as the C. neoformansvar. gattiigenome project that is currently under way uses a sterile Australian environmental isolate (WM276) (J. Kronstad, personal communication). One possibility is that these geographically isolated strains no longer have functional mating type loci. To investigate this prospect, we are currently sequencing the mating type loci of both␣(WM276) anda(E566) isolates. Molecular analysis of the mating type loci of these environmental isolates may reveal the reason for this infertility, providing not only the means to render the platform sequence reference strain WM276 fertile but also insight into the fertility of strains from elsewhere in the world.

Disruption of the RGS protein-encoding gene CRG1

en-hances mating of C. neoformansvar. gattii. InC. neoformans

var.grubii, loss of the RGS protein Crg1 required for

phero-mone desensitization enhances mating. Disruption of the

CRG1gene greatly enhanced mating of both serotype C iso-lates and an isolate from the Vancouver Island outbreak and

A

E

D

H

B

F

C

G

Ca x C

α

Ca crg1 x C

α

Ca x C

α

crg1

Ca crg1 x C

α

crg1

Ca x B

α

Ca crg1 x B

α

Ca x B

α

crg1

Ca crg1 x B

α

crg1

FIG. 6. Thecrg1⌬mutation accelerates mating. MatingC. neoformansisolates andcrg1⌬mutant strains were incubated on V8 pH 7 medium on glass slides for 3 days, and their morphology was observed by using DIC microscopy. A comparison of the effects of thecrg1⌬mutation on mating ability was performed on V8 pH 7 medium. Compared to the serotype C wild-type crosses (B4546 Ca⫻NIH312 C␣[Ca⫻C␣] and B4546 Ca⫻R265 B␣[Ca⫻B␣]) (A and E, respectively), introducing acrg1⌬mutant in unilateral crosses (JF109crg1⌬Ca⫻NIH312 C␣[Cacrg1⌬ ⫻C␣], B4546 Ca⫻JF101crg1⌬C␣[Ca⫻C␣crg1⌬], JF109crg1⌬Ca⫻R265 B␣[Cacrg1⌬ ⫻B␣], and B4546 Ca⫻JF117crg1⌬B␣[Ca⫻ B␣crg1⌬]) (B, C, F, and G, respectively) increased the amount of filamentation and basidia production. This effect was even greater in bilateral crosses (JF109crg1⌬Ca⫻JF101crg1⌬C␣[Cacrg1⌬ ⫻C␣crg1⌬] and JF109crg1⌬Ca⫻JF117crg1⌬B␣[Cacrg1⌬ ⫻B␣crg1⌬]) (D and H,

respectively). Scale bar, 200␮m.

on September 8, 2020 by guest

http://ec.asm.org/

(9)

conferred the ability to mate with a subset of partners that appeared to be sterile when crossed with a wild-type strain. Furthermore, thecrg1⌬mutation overrides the nutritional and desiccation signals normally required for mating. In direct con-trast to strains from Vancouver Island, environmental isolates originating from Australia had no identifiable sexual cycle de-spite deletion of the CRG1gene in either or both strains in crosses.

It is striking that the RGS protein mutations exert related phenotypes in the two divergent organismsS. cerevisiaeandC.

neoformans, enhancing pheromone responsiveness in both and

enhancing mating ofC. neoformans. This said, there are also interesting distinctions between the phenotypes of anS.

cer-evisiae sst2mutant and the crg1mutant ofC. neoformans. In

contrast to the alteration in cellular morphology and the re-duced mating ability of ansst2⌬mutant (9, 39),crg1⌬strains show no alteration in growth morphology in the absence of a partner and undergo increased mating. Comparison of fungal RGS proteins reveals that all of them contain two N-terminal DEP (Dishevelled, Egl-10, Pleckstrin) domains, except theC.

neoformansCrg1 protein, which appears to contain only one.

InS. cerevisiae, these domains have been implicated in

signal-ing the stress response pathway (2), and this function may have been lost inC. neoformans, perhaps explaining whycrg1⌬ mu-tant strains do not display any detrimental phenotypes.crg1⌬

mutant strains therefore represent a valuable tool in the fur-ther analysis of mating and subsequent production of the in-fectious propagule by this primary human pathogen.

In summary, these studies provide insight into a factor that may have contributed to the outbreak on Vancouver Island and a starting point for the generation of congenic pairs of this variety. Additionally, comparison of serotype B and C, Van-couver, and Australian isolates to the opportunistic serotype A and D pathogens provides a model to address the central question of how an opportunistic organism escapes immune control and evolves into a primary pathogen.

ACKNOWLEDGMENTS

We thank Jim Kronstad, Wiley Schell, June Kwon-Chung, and Wie-land Meyer for strains and Leslie Eibest for valuable assistance in performing ESEM (NSF award no. DBI-0098534). The Natrcassette

subclone pCH233 was generously provided by Christina Hull. We thank Christina Hull, Ping Wang, Tom Mitchell, John Perfect, and Jim Kronstad for advice and comments on the manuscript.

This work was supported in part by NIAID R01 grant AI50113 to Joseph Heitman and NIAID PO1 program project grant AI44975 to the Duke University Mycology Research Unit. Joseph Heitman is a Burroughs Wellcome Scholar in Molecular Pathogenic Mycology and an associate investigator of the Howard Hughes Medical Institute.

REFERENCES

1. Apanovitch, D. M., K. C. Slep, P. B. Sigler, and H. G. Dohlman.1998. Sst2 is a GTPase-activating protein for Gpa1: purification and characterization of a cognate RGS-G␣protein pair in yeast. Biochemistry37:4815–4822. 2. Burchett, S. A., P. Flanary, C. Aston, L. Jiang, K. H. Young, P. Uetz, S.

Fields, and H. G. Dohlman.2002. Regulation of stress response signaling by the N-terminal dishevelled/EGL-10/pleckstrin domain of Sst2, a regulator of G protein signaling inSaccharomyces cerevisiae.J. Biol. Chem.277:22156– 22167.

3. Chaturvedi, S., A. J. Hamilton, P. Hobby, G. Zhu, C. V. Lowry, and V. Chaturvedi.2001. Molecular cloning, phylogenetic analysis and three-dimen-sional modeling of Cu, Zn superoxide dismutase (CnSOD1) from three varieties ofCryptococcus neoformans.Gene268:41–51.

4. Chen, S., T. Sorrell, G. Nimmo, B. Speed, B. Currie, D. Ellis, D. Marriott, T. Pfeiffer, D. Parr, K. Byth, et al.2000. Epidemiology and host- and

variety-dependent characteristics of infection due toCryptococcus neoformansin Australia and New Zealand. Clin. Infect. Dis.31:499–508.

5. Cox, G. M., D. L. Toffaletti, and J. R. Perfect.1996. Dominant selection system for use inCryptococcus neoformans.J. Med. Vet. Mycol.34:385–391. 6. Davidson, R. C., J. R. Blankenship, P. R. Kraus, M. de Jesus Berrios, C. M. Hull, C. D’Souza, P. Wang, and J. Heitman.2002. A PCR-based strategy to generate integrative targeting alleles with large regions of homology. Micro-biology148:2607–2615.

7. Davidson, R. C., M. C. Cruz, R. A. Sia, B. Allen, J. A. Alspaugh, and J. Heitman.2000. Gene disruption by biolistic transformation in serotype D strains ofCryptococcus neoformans.Fungal Genet. Biol.29:38–48. 8. Dohlman, H. G., D. Apaniesk, Y. Chen, J. Song, and D. Nusskern.1995.

Inhibition of G-protein signaling by dominant gain-of-function mutations in Sst2p, a pheromone desensitization factor inSaccharomyces cerevisiae.Mol. Cell. Biol.15:3635–3643.

9. Dohlman, H. G., and J. W. Thorner.2001. Regulation of G protein-initiated signal transduction in yeast: paradigms and principles. Annu. Rev. Biochem. 70:703–754.

10. Ellis, D. H., and T. J. Pfeiffer.1990. Natural habitat ofCryptococcus neofor-mansvar.gattii.J. Clin. Microbiol.28:1642–1644.

11. Fisher, D., J. Burrow, D. Lo, and B. Currie.1993.Cryptococcus neoformans in tropical northern Australia: predominantly variantgattiiwith good out-comes. Aust. N. Z. J. Med.23:678–682.

12. Franzot, S. P., J. S. Hamdan, B. P. Currie, and A. Casadevall.1997. Mo-lecular epidemiology ofCryptococcus neoformansin Brazil and the United States: evidence for both local genetic differences and a global clonal pop-ulation structure. J. Clin. Microbiol.35:2243–2251.

13. Grigg, M. E., S. Bonnefoy, A. B. Hehl, Y. Suzuki, and J. C. Boothroyd.2001. Success and virulence in Toxoplasma as the result of sexual recombination between two distinct ancestries. Science294:161–165.

14. Halliday, C. L., T. Bui, M. Krockenberger, R. Malik, D. H. Ellis, and D. A. Carter.1999. Presence of␣andamating types in environmental and clinical collections ofCryptococcus neoformans var.gattii strains from Australia. J. Clin. Microbiol.37:2920–2926.

15. Halliday, C. L., and D. A. Carter.2003. Clonal reproduction and limited dispersal in an environmental population ofCryptococcus neoformansvar. gattiiisolates from Australia. J. Clin. Microbiol.41:703–711.

16. Heitman, J., B. Allen, J. A. Alspaugh, and K. J. Kwon-Chung.1999. On the origins of congenic MAT␣and MATa strains of the pathogenic yeast Cryp-tococcus neoformans.Fungal Genet. Biol.28:1–5.

17. Hull, C. M., and J. Heitman.2002. Genetics ofCryptococcus neoformans. Annu. Rev. Genet.36:557–615.

18. Keller, S. M., M. A. Viviani, M. C. Esposto, M. Cogliati, and B. L. Wickes. 2003. Molecular and genetic characterization of a serotype A MATa Cryp-tococcus neoformansisolate. Microbiology149:131–142.

19. Koufopanou, V., A. Burt, and J. W. Taylor.1997. Concordance of gene genealogies reveals reproductive isolation in the pathogenic fungus Coccid-ioides immitis.Proc. Natl. Acad. Sci. USA94:5478–5482.

20. Kues, U.2000. Life history and developmental processes in the basidiomy-ceteCoprinus cinereus.Microbiol. Mol. Biol. Rev.64:316–353.

21. Kwon-Chung, K. J.1976. A new species ofFilobasidiella, the sexual state of Cryptococcus neoformansB and C serotypes. Mycologia68:943–946. 22. Kwon-Chung, K. J., and J. E. Bennett.1992. Cryptococcosis, p. 396–446.In

K. J. Kwon-Chung and J. E. Bennett (ed.), Medical mycology. Lea & Fe-biger, Philadelphia, Pa.

23. Kwon-Chung, K. J., and J. E. Bennett.1978. Distribution of alpha and a mating types of Cryptococcus neoformans among natural and clinical iso-lates. Am. J. Epidemiol.108:337–340.

24. Kwon-Chung, K. J., J. E. Bennett, and J. C. Rhodes.1982. Taxonomic studies onFilobasidiellaspecies and their anamorphs. Antonie Leeuwenhoek 48:25–38.

25. Kwon-Chung, K. J., J. C. Edman, and B. L. Wickes.1992. Genetic associa-tion of mating types and virulence inCryptococcus neoformans.Infect. Im-mun.60:602–605.

26. Kwon-Chung, K. J., B. L. Wickes, L. Stockman, G. D. Roberts, D. Ellis, and D. H. Howard.1992. Virulence, serotype, and molecular characteristics of environmental strains ofCryptococcus neoformansvar.gattii.Infect. Immun. 60:1869–1874.

27. Latouche, G. N., T. C. Sorrell, and W. Meyer.2002. Isolation and charac-terisation of the phospholipase B gene ofCryptococcus neoformans var. gattii. FEMS Yeast Res.2:551–561.

28. Lengeler, K. B., D. S. Fox, J. A. Fraser, A. Allen, K. Forrester, F. S. Dietrich, and J. Heitman.2002. Mating-type locus ofCryptococcus neoformans: a step in the evolution of sex chromosomes. Eukaryot. Cell1:704–718.

29. Lengeler, K. B., and J. Heitman.2002.Cryptococcus neoformansas a model fungal pathogen, p. 513–557.InH. D. Osiewacz (ed.), Molecular biology of fungal development. Marcel Dekker, Inc., New York, N.Y.

30. Lengeler, K. B., P. Wang, G. M. Cox, J. R. Perfect, and J. Heitman.2000. Identification of the MATa mating-type locus ofCryptococcus neoformans reveals a serotype A MATa strain thought to have been extinct. Proc. Natl. Acad. Sci. USA97:14455–14460.

31. Madrenys, N., C. De Vroey, C. Raes-Wuytack, and J. M. Torres-Rodriguez.

on September 8, 2020 by guest

http://ec.asm.org/

(10)

1993. Identification of the perfect state ofCryptococcus neoformansfrom 195 clinical isolates including 84 from AIDS patients. Mycopathologia123:65–68. 32. Martinez-Espinoza, A. D., M. D. Garcia-Pedrajas, and S. E. Gold.2002. The Ustilaginales as plant pests and model systems. Fungal Genet. Biol.35:1–20. 33. McDade, H. C., and G. M. Cox.2001. A new dominant selectable marker for

use inCryptococcus neoformans.Med. Mycol.39:151–154.

34. Narasipura, S. D., J. G. Ault, M. J. Behr, V. Chaturvedi, and S. Chaturvedi. 2003. Characterization of Cu, Zn superoxide dismutase (SOD1) gene knock-out mutant ofCryptococcus neoformans var. gattii: role in biology and viru-lence. Mol. Microbiol.47:1681–1694.

35. Nielsen, K., G. M. Cox, P. Wang, D. L. Toffaletti, J. R. Perfect, and J. Heit-man.2003. The sexual cycle of Cryptococcus neoformansvar.grubiiand virulence of congenicaand␣isolates. Infect. Immun.71:4831–4841. 36. Pitkin, J. W., D. G. Panaccione, and J. D. Walton.1996. A putative cyclic

peptide efflux pump encoded by the TOXA gene of the plant-pathogenic fungusCochliobolus carbonum.Microbiology142:1557–1565.

37. Sambrook, J., E. F. Fritsch, and T. Maniatis.1989. Molecular cloning: a laboratory manual, 2nd ed., vol. 1–3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

38. Sia, R. A., K. B. Lengeler, and J. Heitman.2000. Diploid strains of the pathogenic basidiomyceteCryptococcus neoformansare thermally dimorphic. Fungal Genet. Biol.29:153–163.

39. Siekhaus, D. E., and D. G. Drubin.2003. Spontaneous receptor-independent heterotrimeric G-protein signalling in an RGS mutant. Nat. Cell Biol.5:231– 235.

40. Speed, B., and D. Dunt.1995. Clinical and host differences between infec-tions with the two varieties ofCryptococcus neoformans.Clin. Infect. Dis. 21:28–34.

41. Stephen, C., S. Lester, W. Black, M. Fyfe, and S. Raverty.2002. Multispecies outbreak of cryptococcosis on southern Vancouver Island, British Columbia. Can. Vet. J.43:792–794.

42. Su, C., D. Evans, R. H. Cole, J. C. Kissinger, J. W. Ajioka, and L. D. Sibley. 2003. Recent expansion of Toxoplasma through enhanced oral transmission. Science299:414–416.

43. Sukroongreung, S., K. Kitiniyom, C. Nilakul, and S. Tantimavanich.1998. Pathogenicity of basidiospores ofFilobasidiella neoformans var. neoformans. Med. Mycol.36:419–424.

44. Vanbreuseghem, R., and M. Takashio.1970. An atypical strain of Crypto-coccus neoformans (San Felice) Vuillemin 1894. II. CryptoCrypto-coccus neoformans var.gattiivar.nov.Ann. Soc. Belge Med. Trop.50:695–702.

45. Viviani, M. A., M. C. Esposto, M. Cogliati, M. T. Montagna, and B. L. Wickes.2001. Isolation of aCryptococcus neoformansserotype A MATa strain from the Italian environment. Med. Mycol.39:383–386.

46. Xu, J.2002. Estimating the spontaneous mutation rate of loss of sex in the human pathogenic fungus Cryptococcus neoformans. Genetics 162: 1157–1167.

47. Xu, J., R. Vilgalys, and T. G. Mitchell.2000. Multiple gene genealogies reveal recent dispersion and hybridization in the human pathogenic fungus Cryptococcus neoformans.Mol. Ecol.9:1471–1481.

on September 8, 2020 by guest

http://ec.asm.org/

Figure

FIG. 1. Simplification of the creation of knockout constructs byusing overlap PCR. We found that only four gene-specific primers
FIG. 2. Morphology of mating C. neoformansD congenic pair. (D) B4546 CVancouver isolates (B4546 C(A) with those of the robustly mating serotype C pair (B4546 Cpairs (scale bar, 200and morphology was observed
FIG. 3. Serotype C strains form dikaryon filaments and fusedclamps during mating. Staining filaments from V8 pH 7 medium slide
FIG. 6. The crg1on glass slides for 3 days, and their morphology was observed by using DIC microscopy

References

Related documents

The major factors that affect the attached growth in the biological process are the hydraulic retention time, biofilm growth and thickness; media surface area, media volume in

sector, and that some occurences will be predictable and some will not, so it needs early warning system that could detect early chaotic conditions and take action

(A) The drug or other substance has a low potential for abuse relative to the drugs or other substances in schedule IV. (B) The drug or other substance has a currently accepted

B χ ) of the medium, we obtained an expression of the threshold pump electric field ( E th ), the resultant gain coefficients (steady-state as well as transient g B TB , )

In order to explore the relationship between the explanatory variables with the dependent variable different econometric models like multiple regression to examine

Contains: Water (Aqua), Butyrospermum Parkii (Shea Butter) Fruit, Cocos Nucifera (Coconut) Oil, Cetyl Alcohol, Theobroma Cacao (Cocoa) Seed Butter, Helianthus Annuus (Sunflower)

These implications indicate that students should be promoted and directed to (1) set goals that reflect the phases of scientific inquiry, (2) form a strategic plan by setting