Protein 4.1 deficiency associated with an
altered binding to the spectrin-actin complex of
the red cell membrane skeleton.
F Lorenzo, … , P Lefrançois, J Delaunay
J Clin Invest.
1994;
94(4)
:1651-1656.
https://doi.org/10.1172/JCI117508
.
Protein 4.1 has been defined as a major component of the subcortical skeleton of
erythrocytes. It binds the spectrin--actin scaffold through a 10-kD internal domain. This
binding requires an essential 21-amino acid sequence motif, Motif I, which is retained by
alternative splicing at the late stage of erythroid differentiation. We here analyze the
molecular basis of heterozygous 4.1(-) hereditary elliptocytosis, associated with protein 4.1
partial deficiency, in nine related French families. cDNA sequencing revealed a single
codon deletion (AAA) resulting in a lysine residue deletion within the 10-kD binding domain,
3' of Motif I. The mutated allele was designated allele 4.1 Aravis. In order to assess the
functional effect of the codon deletion, recombinant 10-kD constructs were made and
various binding assays were performed using spectrin, purified spectrin-actin complex, or
red cell membranes. These experiments demonstrated that the deletion of the Lys residue
clearly prevents the binding capacity. Similar results were obtained with a construct
containing the Lys residue but lacking Motif I. These data strongly suggest that the binding
site to the spectrin-actin complex must contain the Lys 447 (or 448), and therefore resides
not only on Motif I but extends 3' of this essential motif.
Research Article
Find the latest version:
http://jci.me/117508/pdf
Protein
4.1
Deficiency
Associated with
an
Altered
Binding
to
the
Spectrin-Actin Complex
of the Red Cell Membrane
Skeleton
F. Lorenzo,* N. Dalla Venezia,* L. Morle,*F. Baklouti,** N.Alloisio,*M.-T. Ducluzeau,*L.Roda,§P.
LefranmoisO
andJ.Delaunay*
*CNRS URA 1171, InstitutPasteur deLyon, 69365LyonCedex07, France; tHematology Section, Department ofInternal Medicine and
Human Genetics, Yale University School of Medicine,NewHaven, Connecticut 06510;and
'Centre
Hospitalier, Annecy, FranceAbstract
Protein 4.1 has been defined as amajor componentof the subcortical skeleton of erythrocytes. Itbindsthe spectrin-actin scaffold througha 10-kD internal domain. This
bind-ing requires an essential 21-amino acid sequence motif,
Motif I, which is retained by alternative
splicing
at thelate stageof erythroid differentiation. We hereanalyze
the mo-lecular basis of heterozygous 4.1 ( -) hereditary ellipto-cytosis, associated with protein 4.1 partialdeficiency,
innine relatedFrenchfamilies. cDNA sequencing revealedasingle codon deletion (AAA) resulting inalysine
residue deletion withinthe1O-kD binding domain, 3' of MotifI.The mutated allelewasdesignated allele 4.1 Aravis.Inorderto assessthe functional effect of the codon deletion, recombinant 10-kD constructs weremade andvarious bindingassays were per-formed using spectrin, purified spectrin-actin complex,orred cell membranes. These experiments demonstrated that
the deletion of the Lys residue clearlyprevents thebinding capacity. Similar resultswereobtained witha construct con-taining the Lys residue but lacking Motif I. These data stronglysuggest that the binding site tothe spectrin-actin complex mustcontain the Lys 447(or448), and therefore resides not only onMotifIbut extends 3' of this essential motif. (J. Clin. Invest. 1994.
94:1651-1656.)
Keywords: he-reditary elliptocytosis * protein 4.1 * codon deletion * red cell skeleton * genetic isolateIntroduction
Protein4.1 is amajorcomponent ofthe red cell skeleton that strengthensthespectrin-actin latticeandcontributestothe skel-eton anchoring to the membrane via the cytoplasmic domains of transmembrane proteins ( 1, 2). Functional studies have es-tablished that thebindingtothespectrin-actin complexof pro-tein 4.1residesin a 10-kDinternal domain (3, 4)(see Fig. 1). The erythroid form ofprotein 4.1 is now known to be a
F. Lorenzo andN.Dalla Venezia contributed equally to this study.
F.Lorenzo's present address is
Gdnethon,
1, ruedel'Internationale,BP60, 91002 Evry Cedex, France. L. Roda's present address is Centre Hospitalier, BP 1640, Papeete, Tahiti. Address correspondence to N. DallaVenezia, CNRS URA 1 171, Institut Pasteur de Lyon, 69365 Lyon Cedex07, France.
Receivedfor publication 29November 1993 and in revisedform 11
July1994.
member ofacomplex protein family that arises from a
single
gene
by
alternativemRNAsplicing (5, 6).Oneparticularsplic-ingeventinvolvesa21-amino acid sequencemotif,also called Motif I, the retention of which at the late stage of red cell development was found to be critical for protein 4.1 binding activity (7-12) (see Fig. 1). 4.1(-)HE designates avariety ofhereditary elliptocytosis
(HE)'
associated with a reductionor avirtual absence ofprotein 4.1 in themembrane,
reflecting
aheterozygousor ahomozygousstate,respectively(forreview
see reference2).
Starting frompreviousstudies on4.1(-)HE (13), we de-lineatedasmall geneticisolate foranovel protein 4.1 variant, protein 4.1 Aravis. This variant lacked one lysine residue at
position 447 (or 448), in the 3' portion of the 10-kD domain. Various assays using recombinant 10-kD domain established that the single lysine deletion abolishes the binding tospectrin,
to the spectrin-actin complex or to the red cell membrane. These data, together with the genetic analysis of protein 4.1 Aravis carriers, suggest the lysine deletion to be the molecular basis of protein 4.1 deficiency.
Methods
Epidemiological, clinical, and routine biochemical studies. This investi-gation was initiated from a set of nine families with symptomless
4.1 (-)HE recruitedon arandom basis (13). These families failed to form a homogeneous group as shown by Northern blot analysis (13) and/orgenealogicalstudies (14). Only fourfamilies,BE,BG, DU, and
GR,werecloselyrelated. They resided in or originated fromtwovalleys in the Aravis mountains (French Northern Alps). In view of a possible foundereffect,weassumedthatthe present-day inhabitants of thisarea,
being of local descent formostof them, would exhibitanunusuallyhigh incidence of 4.1 (- )HE. An epidemiological survey (blood smears) of school children showed that 6 children out of 155 (3.87%) presented withHE(14). To establish the 4. 1 (-) nature of HE, we assayed protein 4.1(SDS-PAGE) in the parents displaying elliptocytosis, the inheritance pattern of elliptocytosis being dominant. Five additional 4.1 (-)HE
families were identified: BG2, BG3, GO, GP, and VD (see Fig. 2). They proved to be related to one another as well as to the four above families throughacomplex pattern of endogamy (14). Retrospectively, the mutation (described below) was recognized in all the kindreds from the cluster which could be reinvestigated in this respect. Taken together,
asmall genetic isolate foraparticular4.1(-) allele has been outlined.
Furthermore,wescreened the mutation (defined below) in a number of other 4.1(-)HEfamilies. Some were from the French Northern Alps, but failedto belongtotheisolate; i.e., families BU, CA, LA, and PE (13), andfamilyMI (unpublished results). Other families were from distinct areas: PAfrom France (15); SA from Spain (16); BO from Italy; andDAfrom Tunisia (unpublished results). Six normal controls
1.Abbreviations usedinthispaper:HE,hereditary elliptocytosis; GST,
glutathione- S-transferase.
J.Clin. Invest.
© The AmericanSocietyfor Clinical Investigation, Inc.
0021-9738/94/10/1651/06 $2.00
Table1. Sequences of Oligonucleotides Used
Sense strand Antisensestrand
I GC(GAATTC)GAAGGACTTGAAGAGTGCTCC (708-728) II GC(GAATTC)TTGCCTGGTCTGAGCTrGAGT(1745-1725) IIIGC(GAATrC)GCCTGGAGAGCAAGAGCAGT(1544-1563) IV
GC(GAATTC)AAGGGCAGAGTrGGGGTAGG
(2774-2755)V GC(GAATTC)GACAAGAGTCAAGAGGAGATC (2160-2180) VI GC(GAATTC)GGTGAGTGAGTGGATAAGCGT(2284-2264)
VII AGTGTGGACAATAGGGA (2426-2410)
VIIIGGTGGCTCGTCTTCCTT (1996-1980)
IX ACGTGTCTCTGAAATCC (2591-2575)
X GCA(GGATCC)AGAAGAAAAAGAGAGAAAGACTAG (2030-2109) XII GC(GAATTC)CCTCAAGTTCGGAAGGGTGAGTGAG(2294-2275) XIGCA(GGATCC)AGGATTTAGACAAGAGTCAAGAG (2152-2174)
Numbers in parentheses indicatethe exactlocationof eacholigonucleotidewithin thesequence publishedbyConboyetal. (6).
were chosen among non-HEmembersofseveral 4.1(-)HE kindreds
or wereindividuals unrelatedtoany 4.1 (- )HEfamily.
Evaluation of protein 4.1 (based on SDS-PAGE andscanning of
the stained gels)and Westernblot analysiswereperformedaspreviously describedorreferredto(13, 17).
Studieson cDNAandgenomicDNA.Totalreticulocyte mRNAwas preparedfrom peripheral bloodaspolysomal precipitates.2
jig
of RNA were reversetranscribed andPCRamplifiedaspreviously describedorreferredto(18),usingsequence specificprimers (Table I and Fig. 1). In general, 30 cycles ofamplification wereperformed (denaturation: 92TC,60 s;annealing:60(C, 30 s;extension:720C,60 s).
PCR productswereanalyzedon3%NusieveGTGgels(FMC
Bio-Products, Rockland, ME) and cloned into EcoRI-digested M13 mp 18
Vector (Pharmacia, Uppsala, Sweden). DNA sequencing was
per-formed using specific primers(Table I andFig.1) ortheM13 sequenc-ingprimer-40 (USB,Cleveland,OH).PCR-amplifiedcDNA was also
digestedwithXmnI,orAlwNI (New England Biolabs, Beverly, MA), and analyzedon3.5% Nusieve GTG gels (FMC BioProducts).
Genomic DNA wasprepared from peripheral blood leukocytes
ac-cordingto standard procedures (includingaribonuclease A treatment ofthe leukocytes nuclei), orusing the InstaGene Purification Matrix (Bio-Rad, Richmond, CA). 200ng werePCR amplifiedasdescribed above. The productsweresubmittedtoXmnImappingandanalyzedon
6% Nusieve GTG gels (FMC BioProducts).
Purification ofspectrin andprotein 4.1. Preparation ofred cell
membranes wascarried out asdescribed before (17). Crude spectrin
extract wasobtained by washing the ghosts twicein 1 mM ,B-mercapto-ethanol, 1 mM EDTA, 0.3 mM PMSF, pH 9.5 (with NH40H), and incubation for 30minat37°C(19).Underthese conditions, the spectrin
extract wasdevoid of protein4.1 asassessedby Westernblot. Protein 4.1 was extracted fromspectrin-depleted vesicleswith1 M
KCl
(20)and thenpurifiedby selective interaction with inositol hexaphosphate (21). Spectrin andprotein4.1 weredialyzed overnight against buffer
A(130mM
KCl,
20 mMNaCl,0.1 mMEGTA, 10mMTris, pH 7.4). Their concentrationwasestimated by Bradfordassay(22).Plasmid constructs andprotein expression ofthe 10-kDdomain.
PrimersX toXII(TableIandFig. 1)wereusedtospecificallyamplify
the10-kDdomain ofprotein4.1fromaHEheterozygote.Fourdifferent fragmentsweregeneratedbyPCR.Theywill be referredto as1OK(+I), 1OK(-I), 1OK*(+I),and10K*(-I)(*HEallele),whetherthey
con-tain(+1)orlack(-I)Motif Isequence.Thefragmentsweredigested
with BamHI andEcoRI,andclonedinto pGEX-3X expression vector
(Pharmacia).Theconstructs werefully sequencedtoascertain the
ab-senceofanadditionalsequencechangethat would result from the PCR
experiments.
The fourproductswereexpressedin E.coli HB101 (GIBCOBRL, Gaithersburg, MD),asglutathione-S-transferase (GST) fusionproteins (23). Overnightculturesweredilutedto1:50withLuria broth medium
andgrown to an
ODww.,,,
of0.6. Isopropylthiogalactopyranoside wasadded upto0.1 mM andbacteria weregrownfor an additional 2 h. Cellswereharvestedandresuspendedin1:50 culture volume ofalysis
buffercontaining50 mMTris,50 mMNaCl, 1 mMEDTA,0.15 mM
PMSF, pH8.0at0°C. Theyweretreatedfor 15 min at0°Cwith 2mg/
mllysozymeandforanadditional15min with 0.2mg/ml
deoxyribonu-clease I, 7 mM MgCl2, 1% TritonX-100, 1 mM PMSF. The GST-fusionproteinswerepurifiedfrom thelysatesaspreviouslydescribed
(23) using glutathione-Sepharose4B beads(Pharmacia).Protein
con-centration was determined using the method ofBradford (22). The
purityofthe fusionproteins wasassessedby 12.5% SDS-PAGE,and
Western blot analysis using anti-protein 4.1 antibodies. Two minor bands(31and29kD) copurifiedwith theproteins containingMotif I
(GST-1OK[+I]andGST-1OK*[+I]).Theywereidentifiedas proteo-lytic products of the constructs astheywererevealedby anti-protein
4.1 antibodies(not shown);the amount of the minorproductsincreased
upon storageatthereciprocal expenseof intact constructs at 4°C(not shown).
Binding assays. Increasing amounts (0.2-5
Ag)
of fusion 10-kDdomains (GST-1OK[+I], GST-1OK[-I], GST-1OK*[+I],
GST-1OK*[-I])wereincubatedwith 10
Ag
ofspectrinfor1 h at25°Cin 50Al
ofbinding buffer (bufferAcontaining 1 mMEDTA, 0.5 mMDlT).Eachsamplewasthenappliedto a3.5%polyacrylamide
nonde-naturing gelandelectrophoresedasdescribed before (24).
G-actin(Sigma Chemical Co.,St.Louis, MO)waspolymerizedat
aconcentration of 1 mg/ml in 100 mM KCl, 2mMMgC12, 0.2mM
ATP, 0.2mM CaCl2, and 10 mM DTI at 25°C for 1 h beforeuse.
Binding assayswereperformedaspreviously described (4)withsome
modifications. 6
jig
of fusion10-kD domainswereincubated with 10/sg
ofspectrinand 15jsg
ofF-actin for 30minat25°C. Incubationwascontinued for 1 h at0°Cin 110
/s
ofbinding buffer (5 mM phosphate, 0.5 mM DlT, 2 mM MgCl2, 0.2 mM ATP in buffer A). 100,l
ofeach1-
3OkDAUG
ji-tL
4,123~
-S 1I SkD IOD 22/24kD i
I UGAI
--177
1129021811
III
4-1I
.*4-4- VVI 4 4-Vill VH IX
X Xl Xll
Erythrold protein 4.1 isoform
3' cDNA
4-IV
Figure1.Schematic representationofprotein
4.1 cDNA. Functional domains issued from
chymotryptic digestionaredepictedontop.
Thelocationand size(bp,Arabicnumerals)
of the known motifsareindicated. I
desig-natesthe21 -amino acidsequencecalled Motif I.Oligonucleotidesaredenotedusing
sample wascentrifuged for 30minat20,000rpmto sedimentF-actin
and associatedpolypeptides. Supernatantandpelletfractionswere ana-lyzed on 9% SDS-PAGE.
Competition assays ofGST-10K(+I) domainand purified native
protein 4.1 for binding to the spectrin-actincomplexwereperformedas describedabove,with thefollowing modifications: thebinding mixture
contained a limiting amount ofspectrin (2.5
Ag),
5jig
ofF-actin, and3
yg
ofGST-lOK(+I) domain so that all the spectrin boundto theconstruct inabsenceof protein4.1. Increasingamountsofprotein4.1 were added in a total volumeof540 Al,and 400ulwascentrifuged for
2 h at 20,000 rpm. Thepellets were analyzed byelectrophoresis and scanned as mentioned aboveusingactinasreference.
Incorporationofincreasing amountsoffusion 10-kDdomainsinto
freshlyprepared red cell membranes wasperformedaspreviously
de-scribed (25).Afraction (30 1I) ofeachsamplewasanalyzedon12.5% SDS-PAGE, and scanned as referred above using glyceraldehyde 3-phosphatedehydrogenase (G3PDH)asreference.
Results
Protein 4.1deficiency. Members of 8outof the 9 related fami-lies wereinvestigated atthe
protein
level(Fig. 2).
Consistent with previous studies (13, 17), a protein 4.1deficiency
of 30% was encountered in 13 HE members(11.91±1.00).
Similar reduction
(11.35±1.60)
wasfound in 14 HEheterozy-gotes from 8outof the9 kindredsnot
belonging
totheisolate (See Methods) vs. 16.31±1.50 in normal controls (n = 13). In all 4.1 HE heterozygotes, the reduction of protein 4.1 was significant (P < 0.01).Asingleaminoacid deletion
defines
allele4.1 Aravis. Pre-liminary data obtained infamily
DU,belonging
to theisolate,
havesuggested the absence ofagene rearrangement. Northern blotanalysis failedtodetect anyqualitative orquantitative de-fect of themRNA(13).
Twopairs of
primers,
I/HI
andHI/IV(Fig.
1; TableI)
weredesigned to amplify two overlapping
regions
of the mRNAencompassing the entire erythroid coding sequence. The re-sulting PCR products obtained in
family
GPwerecloned and sequenced. No sequencechange was found in the5'
half of the cDNA. On the contrary, the3' region
revealed aAAAcodon deletion in7 clones outof 12 (Fig. 3). This change results in the loss of alysine
residue from theLys447-Lys448
tandem. (Amino acids werenumbered accordingto Conboyet al. (6), and starting from the downstream AUG.However,
the57-bp
motif, absent from the erythroid isoform, was not taken into account.) The abnormal allelewasdesignated allele 4.1 Aravis. The nucleotide sequence change generatesanXmnI restric-tion site. Digesrestric-tion of the PCR product (primers III/ VI) yielded two fragments of 625 and 75 bp instead of a 700-bp fragment
(data
notshown).
Protein 4.1 mRNA wasalso amplified using primers I and VI. The
resulting
1536-bp fragment was digested with XmnI. Fragments of 1,536 bp (normal allele) and of 1,461 and 75 bp (mutated allele)were obtained (data not shown). These find-ings ruledoutthe presenceof an additional alteration that would, in particular, have prevented cDNA priming with primer I. Nucleotide sequencing revealed a GGA GCA GCT se-quence(-Gly-Ala-Ala-)
together with the expected sequenceGGAGCAGCA GCT
(Gly-Ala-Ala-Ala;
positions 336-339)(6)
(datanotshown).
The alanineskipping
was observed in 20% of the sequenced clones. This modification abolished a AlwNIsite, giving riseto a 697-bp product (primers III/IV), instead of 405- and 295-bp products (data not shown). It wasv v
I
.1
2@
BE
R
.10
v* v v*
I .1
2
BG
I
.10V*
V * V*
I
m
2
DU
11~
~~
*V V*
1
GR
If
.10
v
I
A2@
BG2
11
'1983
v
I
.1 2BG3
/1984 /1987
V*
I A
2.1
GO
R
.10
/1983
V*
I
'm *20
GP T
I
.10
/1983
V* v
I
10
2(1)
VD
/19v
1983Figure2. The pedigreesof theninefamiliesformingthe cluster.(o)
Allelecodingfor normalprotein4.1.(-)4.1(-)HEalleleas mani-festedbythe presenceofnumerouselliptocytesin bloodsmears. Fami-liesofthe leftcolumn have beenpresented beforeindetail(13). Newly
detectedkindredsappear in theright column: BG2, BG3, GO, VD, and
GP(14).Theprobands (/)wereschoolchildren recognizedupon an
epidemiologicalsurvey. cDNAcloningwascarriedoutin individual GP 1.2.Weindicatedthemembersin whomSDS-PAGE ofredblood
cell membraneproteins (v) and/or screening ofthe mutationatthe
gene level(*) wereperformed. (SDS-PAGEcouldnotbeperformed
infamilyBG2, but BG2I.1 is the brother of BG3 I.1.Likewise,the
screeningof the mutationatthe gene level could not be done in any of these twokindreds, however,botharecloselyrelatedtofamilyBG
[left]thatwasfullyinvestigated).
found in both thenormal and the altered alleles. The present featurelikely reflects an alternative splicing in the vicinity of
anintron/exon
boundary-tagcag/CA
GCT instead of tag/CAGCAGCT (E.J. Benz, Jr., S.C. Huang, and F. Baklouti, unpub-lished data).
We tested the lysine codon deletion at the genomic level
using
XmnIdigestion of PCR products. PrimersVandVIde-signed
withinthe same exon were used for PCR amplification(Fig.
3).
This AAA deletion was screened at the gene level in at leastone4.1(-)HEmemberfromeachofthe6 otherfamilies
belonging
totheisolate(Fig.
2).It wasfoundinall4.1(-)HEheterozygotes.
In contrast, itwas encountered neither in 12of the 4.1 (-)HE
heterozygotes (from
the 9kindredsnotbelong-ing
totheisolate,
seeMethods),
norin6 non-HE controls.proposita
5'
G
A
T
C
normal
G
A
T
C
.~..
"M,.'
.;I,
i 0 :_- '8#*}ift5' A G Ser 444 TJ
G
A Glu
G_ C
T Leu G_ A A Lys
A_ A A Lys
G_
A A Asn T T Phe450
3,
p
p
c
c
hd1
141
t
Alj
138
-_ _ em
756
63io
Figure 3. Protein 4.1 cDNA and genomic DNA analysis. (Left) Nucleotide sequencing of reticulocytes 4.1cDNA clones. (4) Lackofthe AAA
trinucleotide. (Right) Protein4.1 genomic DNAwasPCRamplified with primers V/VI. (P) 4.1 (-) heterozygote GP 1.2; (C)non-HEcontrol; (+ and -)presenceand absence of XmnIenzyme,respectively. The fragment sizesareindicated (bp): 141 bp,normal; 138bp,mutant,uncleaved; 75 and 63 bp,mutant, cleaved; hd, heteroduplexes.
domainswereassayed fortheirbindingto spectrin inabinary
complex. IncreasingamountsofGST-1OK(+I)constructwere
incubatedwith 10 Mgofcrudespectrin and subsequently electro-phoresedon nondenaturing polyacrylamide gel (Fig. 4). Only
nativefreespectrin,mainlydimers andtetramers,wouldmigrate whereasprotein4.1-spectrincomplexesremain trappedin the wells (24)(Fig. 4). Theamountof freespectrindecreased in proportionasthequantityofGST-1OK(+I)domain increased. The minimum concentration of GST-1OK(+I) domain,
re-quiredtocomplexall thespectrin molecules,was 1.8Mg.
Con-structs lacking Motif I (GST-1OK[-I] andGST-1OK*[-I]) didnotbind to spectrin (Fig. 4), even athighconcentrations (upto5
Mg).
Thesefindingswereexpectedknowingthat MotifIsequence is essentialtothebinding (8, 11, 12). Remarkably,
nobindingwasobserved withGST-1OK*(+I)constructwhich carries thelysinedeletion(Fig. 4). Both GST alone and heat-denatured GST-1OK(+I) were unable to bind spectrin (not shown). Theseexperiments suggested that the lysinedeletion alters asequence critical for thebinary complex formation.
Ternarycomplex formationoccurswhen protein 4.1, orits
chymotryptic 10-kD fragment,areaddedtospectrin and F-actin (4).A secondbindingassay,basedondifferential
sedimenta-tion, wasperformedwith GST-IOK(+ I), GST-1OK(-I), and
GST-1OK*(+I) constructs (Fig. 4). As expected,
GST-1OK(+ I) was theonly product allowing the sedimentation of
spectrinas aternarycomplex. Binding experiments performed withGST-1OK(-I)orGST-IOK*(+I)domains generated the
samepatternaswith severalnegativecontrols(spectrin+actin,
spectrin + GST-1OK(+I), or spectrin + actin + denatured
GST-1OK(+I)).
Competitionassaysofthe GST-1OK(+I)domain and native protein 4.1 for the binding to spectrin-actin complex estab-lished that the construct mimics the native protein (Fig. 5); half of the GST-1OK(+I)domain was displaced by0.5 mole equivalentsofprotein 4.1,andupto 90% of theconstructwas
displaced by a5 moleexcessofprotein4.1. These results are
quite similar to previous data using 10-kD domain without
GST (12).
a b Figure Bindingassays
---~-~10-kD domain ofprotein4.1 to
P
S
P
S P S P S P spectrin(left) andspectrin-actin
Sp
_
= complex (right). (Left)Nondena-turing gelelectrophoresisof
spec-trinincubated with10-kDdomain.
(Lane a) spectrin (10
pg);
(lanes b-d)spectrin (10 pg)incubated[)_w _ .x a ~~~~Ac_
_'__MO_
'AM -- with SpigofGST-1IOK
(+I),
GST-1OK(-I),or
GST-__
v --
1OK*(+
I),respectively.
D, spec-° ~~~~~~~~~~trindimer; T. spectrintetramner.(Right)Sedimentationanalysisof
spectrin-actin complexesin thepresenceof10-kD domainonSDS-PAGE. (Lane a)spectrin(Sp) (10 Mg)incubated with F-actin (Ac) (15 ,ug); (lanes b-d)spectrin(10
Hg)and F-actin(15 ,ug)incubated with 6 jg ofGST-1OK(+I) (.), GST-1OK(-I) (o),orGST-1OK*(+I) (*),respectively; (lane e)spectrin
(10 Mg)incubated withGST-1OK(+I) (6 Mg)in the absence of F-actin. S, supernatant;P, pellet.
A
444Ser G
_T
G Glu A
_G Leu T _G A Lys A
G
A Asn A T
449Phle T
3'
a b c d e Figure 5. Competition of the
GST-Sp_ IOK( +I) domain and native protein
4.1 for the binding tospectrin-actin complex. (Lanes a-e)Spectrin (Sp) (2.5
pg),
F-actin(Ac) (5pg),
andGST-lOK(+I)(e) (3pg)
wereAc-Ac incubated with
increasing
amountsofprotein4.1(-.)(0,3.3, 6.6, 19.8, and33jig)correspondingto0,0.5,
* 1, 3, and 5 mole ratiosrespectively.
Pellets were resolved by SDS-PAGE. In contrast with
binding conditions presented on Fig. 4(right),alimiting amountof spectrin has been used.
To ascertain the binding defect of protein 4.1 Aravis to spectrin-actin complex in situ, incorporation of the GST-lOK*(+ I) constructinto red cell membranes was assayed.
In-creasing amounts ofGST-1OK(+I) and GST-lOK(-I)
con-structs wereused aspositiveandnegative controls, respectively. TheGST-1OK *(+I) didnot associate to the red cell membranes
(Fig. 6).
Discussion
Afterthe recentdescription ofallele 4.1 Madrid(16), harboring apoint mutationin thedownstream initiationcodon, allele 4.1 Aravisis thesecond alleleresponsible of 4.1(-)HEto be de-finedatthe gene level. It islikelythat mostmutations responsi-blefor4.1 (- ) HE areprivate, beingrestricted tosinglefamilies. The recurrence of allele 4.1 Aravis is the consequence of the endogamic structure of a community living in an isolated area(14).
Thenormalquality and quantity of total protein4.1 mRNA ruled out a major transcriptional or posttranscriptional defect. Wetherefore hypothesized that protein4.1 Aravis was synthe-sized but was unable to bind to the membrane. The lack of binding ofthe constructGST-1OK*(+I) to spectrin, the spec-trin-actin complex and red cell membranesstrongly supported this assumption. The absence ofone lysine from the
Lys447-Lys448
tandemproducesasdrasticeffects onthe binding to the spectrin-actin complexasthe lack of Motif I (constructGST-1OK[-I]).
Therefore, the 21-amino acidmotif(position 407 to427) is not theonlypartofthe 10-kD domain that is critical for binding to the spectrin-actin complex. Position 447 (or 448) alsoappears to becrucial in this respect. Itbelongs to an a helix (26) which may be disrupted by the absence ofone lysine residuefromtheLys447-Lys448
tandem.It is noteworthy that this amino acid sequence is ahighly conservedregionamong mammals (100% sequencehomology between human, mouse, and dog) (27, 28), avians (95% se-quencehomologybetweenhuman andchicken)(29), and am-phibians (30);there isperfectconservationofthe
Lys447-Lys448
tandem among these species.
Unboundprotein4.1Aravis must berapidly degraded,even though Western blots did not evidence low molecular weight species in the membrane (13). The possibility remains that a small amount ofprotein4.1 Aravis is present in the membrane. Subtle differences probably exist between 4.1(-)HE alleles but they stand below the sensitivity threshold of SDS-PAGE analysis. Inthe present case, the absenceofasingleamino acid would resultin thecomplete(or nearcomplete)lack of mutated
a
b
cd
.
U
1 2.5
UN
25 10 kl) domain (pg)
r60)
-40
I
-30
_ _
10
,i
-2
_
i
50
Figure 6.Incorporation of the 10-kD domaintored cell membranes. 400
MI
of red cell membraneswereincubatedwithincreasingamountsofGST-1 OK(+I)
(5),
GST-IOK(-I) (n),andGST-1OK*(+I) (n). Sampleswereelectrophoresedandincorporationofeachconstructwas evaluatedby scanning of the gel,usingG3PDH as reference. Binding assay using 25
jig
of eachconstructispresentedin the upper left inset. (Lane a) Red cellmembranes; (Lanesb-d)red cellmem-branesincubated withGST-lOK(+I)(e),
GST-1OK(-I),
orGST-lOK*(+I),respectively;G,G3PDH.
protein 4.1, whereas aprotein 4.1 variant, missing the 63 and 177nucleotidemotifs (31),was still able to beincorporatedin the membrane(31 ). However,there is some evidence(31 )that the amount of this truncatedprotein 4.1 was low, manifesting in a consistent fashion thebinding defect.
Binding of protein 4.1 to nonspectrin proteins has been evidenced. Indeed, it isnowestablished that - 20%ofprotein 4.1 output contributes to the skeleton anchoring to the mem-brane, probably through an interaction of the 30-kD domain withglycophorin C and p55 (32-34).Protein 4.1 Aravis con-tains an intact 30-kD domain; therefore, onemay assume that bindingtononspectrin proteinsmustbe unaltered inthis particu-lar case. In fact, quantitative analysis, recently reported (34), has shown aslight
p55
decrease in 4.1 (- )HE heterozygotes, including patients here found to carry 4.1 Aravis allele. To reconciletheseconflicting findings,wemayspeculate that bind-ingto the spectrin-actin complexis aprerequisite forbindingto glycophorin C and p55. Alternatively, the lysine deletion may generate asecondaryconformationalchangethat also pre-vents anefficient bindingof the 30-kD domainto p55.
We thank all the families for their generous cooperation; Drs. E. J. Benz, Jr. and S. C. Huang for communicating unpublished data; Drs. A. lolascon, E. Miraglia del Giudice, and R. Kastally for providing us with some 4.1 (-)HE control samples; Drs. J.-M. Robert and G. Brunet for helpful discussions; Ms. S. Cavagna and M.-F. Barboza for their participation in the family studies; and Ms. N. Connan for preparing themanuscript.
This work was supported by the Association
Franqaise
contre les Myopathies, the Conseil de la Region Rh6ne-Alpes, the Universit6Claude-Bernard Lyon-I, theCentre National de la Recherche
Scienti-fique(URA 1171 ), the Institut Pasteur de Lyon, and the Institut National de la Santeetde laRechercheMddicale(CRE 930405).
References
1. Delaunay, J., N. Alloisio, L.Morl6, and B. Pothier. 1990. The red cell skeleton and its genetic disorders. In Molecular Aspects of Medicine. Volume
11,Number 3. H. Baum, J. Gergely, and B. L. Fanburg, editors. Pergamon Press, Oxford.
2.Conboy, J. G. 1993. Structure, function and molecular genetics of erythroid membrane skeletalprotein 4.1 in normal and abnormal red blood cells. Semin. Hematol. 30:58-73.
3. Leto, T. L., and V. T. Marchesi. 1984. A structural model of human erythrocyteprotein4.1. J. Biol. Chem. 259:4603-4608.
4.Correas, I., T. L. Leto, D. W.Speicher,and V. T. Marchesi. 1986. Identifi-cation of the functional site of erythrocyte protein 4.1 involved in spectrin-actin associations. J. Biol. Chem. 261:3310-3315.
5. Tang, T. K., Z. Qin, T. Leto, V. T. Marchesi, and E. J. Benz, Jr. 1990. Heterogeneity of mRNA andproteinproducts arisingfromtheprotein4.1 gene inerythroid andnonerythroidtissues. J.Cell Biol. 110:617-624.
6.Conboy, J. G., J. Y. Chan, J. A.Chasis,Y. W.Kan, and N. Mohandas. 1991. Tissue-anddevelopment-specificalternative RNAsplicing regulates expression of multiple isoforms oferythroidmembraneprotein4.1. J.Biol. Chem.
266:8273-8280.
7.Tang, T. K., T. L. Leto, I. Correas,M. A. Alonso, V. T.Marchesi, and E. J. Benz Jr. 1988. Selective expression of an erythroid-specific isoform of protein 4.1. Proc. Natl. Acad. Sci. USA. 85:3713-3717.
8.Tang,T.K.,W.Horne,V. T.Marchesi,and E. J.Benz,Jr.1989. Selective
expressionand function of exons retainedorexcludedfrom matureprotein4.1 mRNAsinerythroidandnon-erythroidtissues. Clin. Res. 37:550a.(Abstr.)
9.Baklouti,F., T. K.Tang,S. C. Huang, and E. J. Benz Jr. 1992. Structure and utilization of exon/intronjunctionsof theprotein4.1 gene thatareselectively
utilized inerythroidand muscle cells. Blood. 80:273a. (Abstr.)
10. Chasis, J. A., L. Coulombel, J. Conboy, S. McGee, K. Andrews,Y.W. Kan, and N. Mohandas. 1993.Differentiation-associatedswitches inprotein4.1
expression; synthesisofmultiplestructural isoformsduringnormal human eryth-ropoiesis.J.Clin. Invest.91:329-338.
11.Discher, D., M.Parra,J.G.Conboy,and N.Mohandas. 1993.
Mechano-chemistryof thealternativelyspliced spectrin-actin bindingdomainin membrane skeletalprotein4.1. J. Biol. Chem. 268:7186-7195.
12.Horne,W.C.,S.C.Huang,P. B.Becker,T. K.Tang,and E.J. Benz Jr. 1993.Tissue-specificalternativesplicingofprotein4.1 insertsan exonnecessary forformationofthe ternarycomplexwitherythrocyte spectrinand F-actin. Blood. 82:2558-2563.
13.Feddal,S., G. Brunet, L.Roda,S.Chabanis,N.Alloisio,L.Morle,M. T. Ducluzeau, J.Marechal,J. M.Robert,E. J. BenzJr.,J.Delaunay,and F.Baklouti.
1991. Molecularanalysisofhereditaryelliptocytosiswith reducedprotein4.1 in the French NorthernAlps.Blood. 78:2113-2119.
14. Brunet, G., M. T. Ducluzeau, L.Roda, P. Lefrancois, F.Baklouti, J. Delaunay, and J. M. Robert. 1993. Diffusion ofaparticular4.1(-) hereditary elliptocytosisallele in the French NorthernAlps.J. Biosoc.Sci. 25:239-247.
15.Alloisio,N., E.Dorleac,R.Girot,and J.Delaunay.1981.Analysisof the redcell membrane inafamily with hereditary elliptocytosis. Totalorpartial
absenceofprotein 4.1.Hum.Genet. 59:68-71.
16.Dalla Venezia, N., F. Gilsanz, N. Alloisio, M. T. Ducluzeau, E. J. Benz Jr., and J. Delaunay. 1992. Homozygous 4.1 (-) hereditary elliptocytosis associ-atedwith a point mutation in the downstream initiation codon of protein 4.1 gene. J. Clin. Invest. 90:1713-1717.
17.Alloisio, N., L.Morld,E.Dorleac,0.Gentilhomme, D. Bachir, D. Guet-arni, P. Colonna, M. Bost, Z. Zouaoui, L. Roda, D. Roussel, and J. Delaunay. 1985. The heterozygous form of 4.1(-) hereditary elliptocytosis [the 4.1(-) trait].Blood. 65:46-51.
18. Baklouti, F., J. Mar6chal, R. Wilmotte, N. Alloisio, L. Morl6, M. T. Ducluzeau,L. Denoroy, A. Mrad, M. H. Ben Aribia, R. Kastally, and J. Delaunay. 1992. Elliptocytogenica""spectrin Sfax lacks 9aminoacids in helix 3 of repeat 4:evidence for the activation of a cryptic 5'-splicesite in exon 8 of spectrin a-gene. Blood.79:2464-2470.
19.Lecomte,M. C., C. Galand, and P. Boivin. 1982. Proteines hydrosolubles des membranes6rythrocytaires humaines.Differencesdecomposition et de phos-phorylation selon les conditions d'extraction. Nouv. Rev. Fr. Hematol.
24:349-358.
20.Tyler, J. M., W. R. Hargreaves, and D. Branton. 1979. Purification of two spectrin-binding proteins: biochemical and electron microscopic evidence for
site-specificreassociation betweenspectrin and bands 2.1 and 4.1. Proc. Natl. Acad. Sci. USA. 76:5192-5196.
21.ElOuggouti, S., 0.Bournier, P. Boivin,0.Bertrand, and D. Dhermy. 1992.Purification of erythrocyte protein 4.1 by selective interaction with inositol hexaphosphate. Protein Expression Purif. 3:488-496.
22.Bradford,M. M. 1976. A rapid and sensitive method for the quantitation of microgramquantities of proteinutilizing theprincipleofproteindyebinding.
Anal. Biochem. 72:248-254.
23.Smith, D. B., and K. S. Johnson. 1988. Single-steppurificationof polypep-tides expressed in Escherichia coli as fusions with glutathione-S-transferase.
Gene.67:31-40.
24. Garbarz, M., D. Dhermy, M. C. Lecomte, C. Feo, I. Chaveroche, C.
Galand, 0. Bournier, 0. Bertrand,and P. Boivin. 1984. A variant oferythrocyte
membrane skeletal protein band 4.1 associated with hereditary elliptocytosis. Blood.64:1006-1015.
25.Takakuwa, Y., G. Tchernia, M. Rossi, M. Benabadji, and N. Mohandas. 1986. Restoration of normal membranestabilityto unstableprotein4.1-deficient erythrocyte membranes byincorporationofpurified protein4.1. J.Clin. Invest. 78:80-85.
26.Conboy,J.,Y. W.Kan,S. B.Shohet,and N.Mohandas. 1986. Molecular
cloningofprotein4.1,amajorstructural element of the humanerythrocyte mem-brane skeleton. Proc.Natl. Acad. Sci. USA.83:9512-9516.
27.Huang, J. P., C. J. C. Tang, G. H.Kou,V. T.Marchesi,E. J.BenzJr, and T. K. Tang. 1993. Genomic structure of the locusencoding protein 4.1; structural basis forcomplexcombinational patterns oftissue-specific alternative RNAsplicing. J.Biol.Chem. 268:3758-3766.
28. Conboy, J.G.,R.Shitamoto, M. Parra, R.Winardi,A.Kabra,J.Smith,
and N. Mohandas. 1991. Hereditary elliptocytosisdue to both qualitative and
quantitativedefects inmembrane skeletalprotein4.1.Blood. 78:2438-2443. 29. Yew, N.S., H. R. Choi, J. L. Gallarda, and J. D.Engel.1987. Expression ofcytoskeletal protein4.1 duringavianerythroidcellularmaturation. Proc. Natl. Acad. Sci. USA. 84:1035-1039.
30.Giebelhaus, D. H.,D. W.Eib, and R. T. Moon. 1988. Antisense RNA inhibitsexpressionof membrane skeletonprotein4.1during embryonic
develop-mentof Xenopus. Cell. 53:601-615.
31.Marchesi, S. L., J. Conboy, P.Agre, J. T. Letsinger, V. T. Marchesi,
D.W.Speicher,and N. Mohandas.1990.Molecularanalysisof insertion/deletion mutations in protein 4.1 in elliptocytosis. I. Biochemical identification of
re-arrangements in thespectrin/actin binding domainand functional characteriza-tions. J. Clin. Invest. 86:516-523.
32. Leto, T. L.,I. Correas,T. Tobe, R. A. Anderson, and W. C. Horne.
1986. Structure and function of humanerythrocyte cytoskeletal protein4.1. In Membrane Skeletons andCytoskeletal-MembraneAssociations. V.Bennett,C. M.
Cohen,S. E.Lux,and J.Palek,editors. Alan R.Liss, Inc.,NewYork. 201-209. 33.Hemming,N.J.,D. J.Anstee,W. J.Mawby,M. E.Reid,and M. J. A. Tanner. 1994.Localization of theprotein 4.1-bindingsiteonhumanerythrocyte glycophorinsC and D.Biochem.J.299:191-196.
34.Alloisio, N.,N. DallaVenezia,A.Rana,K.Andrabi,P.Texier,F.Gilsanz,