Human creatine kinase B complementary DNA Nucleotide sequence, gene expression in lung cancer, and chromosomal assignment to two distinct loci

Human creatine kinase-B complementary DNA.

Nucleotide sequence, gene expression in lung

cancer, and chromosomal assignment to two

distinct loci.

F J Kaye, … , A F Gazdar, E A Sausville

J Clin Invest.

1987;

79(5)

:1412-1420.

https://doi.org/10.1172/JCI112969

.

Using a small cell lung cancer (SCLC) cDNA library, we obtained clones for the creatine

kinase-B (CK-B) gene and determined the nucleotide sequence for the protein coding and

3' untranslated region (3' UT). The human translated protein spans 381 residues and the

amino acid homology with rabbit CK-B is greater than 98%. We have demonstrated that a

nucleic acid probe encompassing the protein coding region will also hybridize to CK-M

sequences while a probe derived from the 3' UT region is CK-B specific. When a

B-isoenzyme specific sequence is hybridized to Eco RI cut genomic DNA, two independent

restriction fragment polymorphisms are detected. We have subsequently localized these

two CK-B homologous sequences to chromosomes 14q32 and 16. Finally, we show that

increased levels of CK-B seen in SCLC are not accompanied by gene amplification or

rearrangement, but reflect a greatly enhanced level of CK-B specific mRNA that is not seen

in non-SCLC lines thus far examined.

Research Article

Find the latest version:

Human Creatine

Kinase-B complementary

DNA

Nucleotide Sequence, Gene Expression in Lung Cancer, and

Chromosomal

_Assignment

to

Two Distinct

Loci

FredericJ.Kaye,0.WesleyMcBride,* James F.Battey, Adi F. Gazdar,and Edward A. Sausville

National CancerInstitute-NavyMedical OncologyBranch and_*LaboratoryofBiochemistry, NationalCancerInstitute,

National Institutes ofHealth, and NavalHospital, Bethesda,Maryland 20814

Abstract

Usingasmall cell lungcancer(SCLC) cDNA library,weobtained

clones for the creatine kinase-B (CK-B) geneand determined

thenucleotidesequencefor the protein coding and3'untranslated

region (3' UT). The human translated proteinspans381residues

and theamino acid homology with rabbit CK-B is>98%. We have demonstrated thatanucleicacid probeencompassing the

protein coding region will also hybridize to CK-M sequences

whileaprobederived from the 3' UT region is CK-B specific.

WhenaB-isoenzyme specificsequenceis hybridizedtoEco RI cutgenomic DNA, twoindependent restriction fragment poly-morphismsaredetected. We have subsequently localizedthese twoCK-B homologous sequences tochromosomes 14q32 and 16.Finally,weshow thatincreased levels of CK-BseeninSCLC arenotaccompanied bygene amplification or rearrangement,

butreflectagreatly enhanced level of CK-B specific mRNA that

isnotseenin non-SCLC lines thus far examined.

Introduction

Thecreatine kinasesare afamily ofenzymeswithahighly

con-servedproteinsequence,whichareinvolvedinthemaintenance of ATPat sites of cellular work(1). Three cytoplasmic (non-mitochondrial) isoenzymes of creatine kinase (CK)'arereadily

identified inhuman tissue. Theseisoenzymesaredimeric mol-ecules withtwodissociable subunitsdesignatedasM-(muscle) orB- (brain)typethatcanreassociatetoform the electropho-retically distinct MM, BB,orMBisotypes. Recent investigations

have determined that the amino acidsequences of these two

subunitsareencodedbydistinctgenes(2, 3). Despitethe

exis-tenceof CK-MorCK-Bcyclic complementary DNA(cDNA)

clones from severalanimalspecies (2-8),the basisforthe tissue

specific expressionof theseisoenzymesisnotknown.

Elevated levels ofthe BBisoenzymeofCK have been detected

intumorsamples obtainedfrom patientswith small celllung

cancer(SCLC) (9). Marked elevation of the BBisoenzyme of

CK, as measured with a radioimmunoassay, was previously

Address reprint requests to Dr. Kaye, NCI-Navy Medical Oncology Branch, Building 8,Room5101,NavalHospital, Bethesda,MD 20814.

Portions of this workwerepresentedatthe AnnualMeetingof the

AmericanSocietyfor ClinicalInvestigation, Washington, DC, May 1986, andpublishedinabstract form(1986.Clin. Res.34:691A).

Receivedfor publication3September1986.

1.Abbreviations used in thispaper:CK,creatinekinase;RFLP, restriction fragment length polymorphism; SCLC,small celllungcancer;SM,

skel-etalmuscle;3'UT,3'untranslatedregion.

The Journalof ClinicalInvestigation,Inc. Volume79, May1987, 1412-1420

noted in 49/50 cell lines established in our laboratory from pa-tients withSCLC (10). In contrast, CK-BB levels in non-SCLC

lineswere considerablylower or negligible in most cases. The level of this enzyme thus is a reliable marker of SCLC and may be offunctional importance in determiningaspects of the small cellphenotype, including the neuroendocrine features unique tothis tumor(1 1).

Inthis studywe have cloned and sequenced a cDNA copy of themessenger (mRNA) for the human B-isoenzyme of CK from acDNA library prepared from a SCLC cell line. We have

demonstrated that thecoding region of this clone will cross-hybridize with both M- and B-type isoenzymes. Using a prepared

fragment fromthe3'untranslated region as a CK-B-specific se-quence, wehave then examined expressionin RNA of the cre-atinekinase gene in cell linesrepresenting different histologic types oflungcancer.Wehavealsoinvestigatedthe arrangement ofthis gene in genomic DNA. Two independent, high-frequency Eco RI polymorphic siteswereidentified that we relate to two

CK-Bspecificsequenceslocatedondifferent chromosomes.

Methods

Celllinesand cell culture. TheSCLC celllineswereestablishedfrom clinically derivedspecimens by propagationinselective mediaasdescribed previously(10). Humanpromyelocyticcell lineHL60 was obtained from J.Trepel, National CancerInstitute,Bethesda, MD.

Isolation ofcDNAandgenomicclones. ASCLC cDNAlibraryin lambdagtlOwasconstructedfrompoly (A)-selectedRNAisolated from cellline NCI-H378,asdescribedpreviously (12),andwasscreened with aclonedrabbit CK-B cDNAprobe described byPickeringandSchimmel (2) andkindlyprovided byG. Daouk. Severalnon-full lengthhuman cDNAcloneswereisolated,thelargestmeasuring1.1 kb.Additional5' cDNA sequencewasobtainedbyprimerextensionasdescribedbyCooper

andOrdahl(13).Genomic CK-Bspecificcloneswereisolatedbyscreening

apartialMboI-digestedhumanplacentallibraryin Charonphage28A withasubclone from themost5'regionof the human cDNA sequence. Nucleotide sequence of both strands ofcDNA, employingtheSanger

dideoxynucleotidechain terminationmethod,wereobtained with

over-lappingMl 3phageclones(14,15).Duetothe lackof useful restriction

enzyme sites toward the 3' end of the cDNAclones,overlappingBal 31

digestedMl3phageclonesweregeneratedforsequencing (16).

Nucleic acids. DNA, totalRNA,andpoly(A)-selectedRNAwere

extracted from the humanlungcancercell linesaspreviouslydescribed

(17-19). In addition, total RNA was extracted from human skeletal muscleobtainedatautopsy. DNA and RNAweretransferredto nitro-celluloseafterelectrophoresis through

nondenaturing

or

formaldehyde

containing gels,respectively (20, 21).Hybridizationofnitrocellulosefilters

with[32P]dCTPnick-translated DNAfragmentswere_performedas de-scribed(22).

RNAaseprotection assay. 10

gg

oftotalRNAfromeither human skeletal muscleor alungcancercelllinewasallowedto

_hybridize

12-15hwitha32P-labeledRNAprobepreparedby

using

thepSP6vector

Thehybridization mixwasthendigestedwith RNAase Aresultingin completedigestion of allsingle-stranded regions.Conditions for hybrid-ization anddigestion withRNAase were aspreviouslydescribed (24,

25).Theprotectedregions ofourRNAprobewereidentified by

dena-turing 6%acrylamideelectrophoresis and autoradiography.

Chromosomalmapping. Localization of the CK-B gene was per-formed by examinationofDNAextractedfromapanel of human-rodent

somatic cellhybrids. These methods have beenpreviouslydescribed in

detail(26).

Results

Human CK-B cDNA sequence. The restriction map and

se-quencingstrategy for the human CK-B cDNA is shown in Fig. 1.ThecDNA sequenceofthe human CK-Bprotein codingand 3'UTispresented in Fig. 2. As demonstrated frompriorsequence

analysis in different animal species (2-8),there is remarkable

evolutionary conservationinthe

primary

structureof thecoding region oftheB-subunit from humanand rabbitsources.There

isasinglelong openreading frame, in both human and rabbit cDNAs, beginning with an ATG startcodon atposition 9 in

Fig. 2 and spanning 1,143 base pairs(bp)to the termination codonatposition 1,152. Nucleotidehomologybetween species is in excessof94%. Inaddition,as mostnucleotidechangesare

silent, homology between

species

of the translated 381 amino

acidprotein is>98%. Comparisonof the sequence of B- with

M-isoenzymesrevealsadecreased, but still substantial, homology withinstretchesoftheproteincoding region(Fig. 2).In contrast, the 3' UTcontainsnosequenceconservationbetween the brain andmuscleisoenzymesyetpersistent

interspecies

homology

be-tweenhuman andrabbitbrainsequences.ThusaDNA sequence

confined to the 3' UT region could serve as aCK-B specific

probe. Accordingly, a 115 bpfragment fromthe 3' UT ofour

human cDNA clone (nucleotide position 1142 to 1257) was

subcloned.

Tissue

specificity of

theCK-B

probe.

Todetermine the

spec-ificity of the subcloned probe fromthe 3'UT, total RNAwas

preparedfromhuman psoas muscleobtainedat autopsy orfrom

aSCLC cell line.Asshown inFig. 3A,a 1.

1-kb fragment

des-ignated pCK4, which encompasses overthree-quarters ofthe CK-B protein codingsequence (from nucleotide position 270

tothepoly-Atail),hybridizesto a1.6-kb species presentinmuscle RNA.Incontrast,whenequal amountsoftotal RNAisolated fromSMishybridized to the 3'UT-derivedCK-Bspecific probe, nosignal isseen even

after

aprolonged exposure as shown. To prove further the isoenzyme specificity of the 3' untranslated

fragment,aRNAaseprotection assay was performed as seen in

0

E toc U2

C,) a.C) C

AAAA

1 200 400 600 800 1000 1200

ATG TGA

Figure 1. Restriction map, nucleotide coordinates, and sequencing strategyfor the human CK-B cDNA. Due to the lack of useful restric-tion enzyme sites toward the 3' end of the cDNA, overlapping Bal 31

digestedM13phageclones were generated for sequencing ( 16). In

ad-dition,confirmatory sequence data was obtained 5' of the Sst I site withoverlapping CK-B genomic clones.

Fig. 3 B. Total RNA isolated from SCLC cell line NCI-H592 protects an - 115 bp antisense species derived from the 3' UT

from RNAasedigestion.In contrast, RNA from skeletal muscle doesnotprotect anyportion of the probe from digestion. The threecloselyspaced bands in the SCLC RNA lane(at1 7, 114,

and 11 1 bp) represent digestion by RNAase of several nucleotides fromoneend ofourprobeand do notreflect the presence of

differingmRNA species. Thiswasestablishedbyhybridizing the antisense RNA probe with six independently isolated CK-B cDNA clones followed by RNAase digestion. The autoradio-graphic pattern from each RNA:DNA hybridwasidentical to

thatdepicted in Fig. 3 B (data not shown). Thus, we conclude by sequence analysis, Northern blot, and RNAase protection experiments that our human clonesare B-isoenzyme derived and can be used to explore tissue specific expression of this iso-enzyme gene.

CK gene expression in lung cancer. Fig. 4 examines the expression of the CK gene in several lung cancer cell lines. All SCLC cell lines screened to date express abundant quantities of a 1.6-kb CK message. In addition, in RNA from several cell lines higher molecular weight species are apparent, perhaps pre-cursors tothe mature mRNA. In contrast to the easily detected CK-B mRNA in SCLC, non-SCLC cell lines NCI-H125 and NCI-H23 have markedly decreased, butnotabsent, expression of CK. An additional non-SCLC cell line, NCI-H460, which has previously been shown to contain neurosecretory granules (A. F. Gazdar,unpublished observation), has an intermediate level ofexpression. Fig. 5 shows that, using a 5' cDNA probe overlapping the coding region that would detect CK-Bor CK-M species, total and poly

(A)-selected

RNA from SCLC cell linesNCI-H82andNCI-H592againexpress anabundant 1.6-kb message. In contrast, equal amounts of total and poly (A)-selected RNA fromrapidly dividing undifferentiated HL60cells donotshow any expression of CK-B. This result implies that expression of CK-B is not merely correlated with rapid cell growth, asHL60 cells grow as or more rapidly than the lung cancer-derived cell lines. In experiments not shown, it was found that induction ofHL60 differentiation to a monocytic phenotype

bydibutyrylcAMPwasnotaccompanied byasignificantincrease in CK geneexpression.

Analysis ofCK-BspecificRNAexpression of a panelof

tu-morcelllinesusingtotal RNA and theantisense3' untranslated

probeis shown in Fig. 6. AllSCLC celllinesscreenedcontain largeamountsofCK-Bspecific mRNA. In contrast, total RNA extractedfromthe promyelocyticcelllineHL60 orfromlung

cancercelllines derived from adenocarcinoma, large cell, ad-enosquamousorsquamouscarcinomado notofferappreciable

protectionofthe CK-B specific probe. Examination ofthe RNA

samples, by ethidium bromide-stained gel electrophoresis,

showed no differences in the amount or quality of the RNA

preparationsusedfromthedifferent cell lines (data not shown). Wetherefore conclude that the low levels of CK-B activity in non-SCLCderived tumors or cell lines (9) reflect a decrease in theabundance ofCK-B mRNA in these different histologic

cat-egoriesofhuman lung cancer.

AnalysisofgenomicDNAandevidencefortwoCK-B genes.

To explore the basis for enhanced CK-B gene expression in

SCLC,aneffortwas made to localize this gene and to examine

whetheramplification or rearrangement of this locus had oc-curred.GenomicDNAdigestedwith EcoRI from severallung

10 20 30 40 50 60 70 80 90

0 H-B CCGCCGCCATGCCCTTCTCCAACAGCCACAACGCACTGAAGCTGCGCTTCCCGGCCGAGGACGAGTTCCCCGACCTGAGCGCCCACAACAACCACATGGC

R-B

---C---A-G---T---R-M

---G---GG---C---AAGTAC---AA--A-AA-T---G----A---G---T---AAA---H-B MetProPheSerAsnSerHisAsnAlaLeuLysLeuArgPheProAlaGluAspGluPheProAspLeuSerAlaHisAsnAsnHisMetAl

R-B Thr Thr

R-M Gly Thr LysTyr AsnTyrLysSer Glu Tyr Lys

100 H-B CAAGGTGCTGACCCCCGAGCTGTACGCGGAGCTGCGCGCCAAGAGCACGCCGAGCGGCTTCACGCTGGACGACGTCATCCAGACAGGCGTGGACAACCCG

R-B

---A---A--G----C---C---C---C---R-M ---C--C---AA-A-A----GAG---TC---C- T---- ----A---A

H-B aLysValLeuThrProGluLeuTyrAlaGluLeuArgAlaLysSerThrProSerGlyPheThrLeuAspAspVaiIIeGlnThrGlyValAspAsnPro

R-B MetAsp

R-M Asp LysLys Asp Glu

200 H-B GGCCACCCGTACATCATGACCGTGGGCTGCGTGGCGGGCGGCGAGGAGTCCTACGAAGTGTTCAAGGATCTCTTCGACCCCATCATCGAGGACCGGCACG R-B

---TT---T-A---ACG-C---G---G---R-M --G----T-T---CT-T-A---ACG---C--G----G---C----C----H-B GlyHisProTyrIleMetThrValGlyCysValAlaGlyGlyGluGluSerTyrGluValPheLysAspLeuPheAspProIleIleGluAspArgHisG

R-B Phe CysAsp Ala Glu Glu

R-M Phe CysAsp Thr Glu Gin

300 H-B GCGGCTACAAGCCCAGCGATGAGCACAAGACCGACCTCAACCCCGACAACCTGCAGGGCGGCGACGACCTGGACCCCAACTACGTGCTGAGCTCCGGGGT

R-B

---C---T---GC----R-M -G----T---A----C---CA--- A---G---CA-A--T--G---

C---C---C---AGCC-C--H-B lyGlyTyrLysProSerAspGluHisLysThrAspLeuAsnProAspAsnLouGlnGlyGlyAspAspLeuAspProAsnTyrValLeuSerSerGlyVa

R-B Arg

R-M Phe Thr Lys HisGlu Lys His Arg

400 H-B GCGCACGGGCCGCAGCATCCGTGGCTTCTGCCTCCCCCCGCACTGCAGCCGCGGGGAGCGCCGCGCCATCGAGAAGCTCGCGGTGGAAGCCCTGTCCAGC

R-B

---T---G---G---C---G---G---G---R-M

---C---AAG----A-ACG--G---TC---T--C---G---G-G---T-C---CAA---H-B lArgThrGlyArgSerIleArgGlyPh.CysLeuProProHisCysSerArgGlyGluArgArgAlaIleGluLysLeuAlaValGluAlaLeuSerSer

R-B Val

R-M Lys TyrThr Val Ser Asn

500 H-B CTGGACGGCGACCTGGCGGGCCGATACTACGCGCTCAAGAGCATGACGGAGGCGGAGCAGCAGCAGCTCATCGACGACCACTTCCTCTTCGACAAGCCCG

R-B

---C---A-G---C---R-M

---ACG---GT-CAA---GAAG---C-C--G---C---CA---G---H-B LeuAspGlyAspLeuAlaGlyArgTyrTyrAlaLeuLysSerMetThrGluAlaGluGlnGlnGlnLeuIleAspAspHisPheLeuPheAspLysProV

R-B

R-M Thr GluPheLys Lys Pro Gin

600 H-B TGTCGCCCCTGCTGCTGGCCTCGGGCATGGCCCGCGACTGGCCCGACGCCCGCGGTATCTGGCACAATGACAATAAGACCTTCCTGGTGTGGGTCAACGA

R-B---C---G---T---C---A

----R-M

----C--G---G---T---C---C----G---H-B alSerProLeuLQuLeuAlaSerGlyMetAlaArgAspTrpProAspAlaArgGlyIleTrpHisAsnAspAsnLysThrPheLeuValTrpValAsnGl

R-B Ile

R-M Ser

700 H-B GGAGGACCACCTGCGGGTCATCTCCATGCAGAAGGGGGGCAACATGAAGGAGGTGTTCACCCGCTTCTGCACCGGCCTCACCCAGATTGAAACTCTCTTC

R-B

---C-C-C----G---CTG---GGAGA----R-M ---C---G--- -C---C---CG---GTG--G--GCAGA---GGAGA----T

H-B uGluAspHisLeuArgValIleSerMetGlnLysOlyGlyAsnMetLysGiuValPh.ThrArgPheCysThrGlyLeuThrGlnIleGluThrLeuPhe

R-B Asn

R-M Glu Arg Val GlnLys GluIle

800 H-BAAGTCTAAGGACTATGAGTTCATGTGGAACCCTCACCTGGGCTACATCCTCACCTGCCCATCCAACCTGGGCACCGGGCTGCGGGCAGGTGTGCATATCA

R-B ---A----C---C---G---C---C----R-M

---AAAGCT-G-C--CCC---TGAG---G-G---G---T-GG--C---CG-G-H-B

LysSerLysAspTyrGluPheMetTrpAsnProHisLeuGlyTyrIlLouThrCysProSerAsnLeuGlyThrGlyLeuArgAlaGlyValHisIlieL

R-B Asn

R-M LysAlaGlyHisPro Glu Val Gly Val

900 H-B AGCTGCCCAACCTGGGCAAGCATGAGAAGTTCTCGGAGGTGCTTAAGCGGCTGCGACTTCAGAAGCGAGGCACAGGCGGTGTGGACACGGCTGCGGTGGG

R-B ---C---CC---C---C-

C---G---T---C--C---R-M---- G-GC---A---CCCC-- ----A-T--C-CC--C---C--G---G---

G--C---C---H-B ysLeuProAsnLeuGlyLysHisGluLysPheSerGluValLouLysArgLauArgLauGInLysArgGlyThrGlyGlyValAspThrAlaAlaValGI

R-B His Gin

R-M AlaHis Ser Pro Glu Ile Thr

1000 H-B CGGGGTCTTCGACGTCTCCAACGCTGACCGCCTGGGCTTCTCAGAGGTGGAGCTGGTGCAGATGGTGGTGGACGGAGTGAAGCTGCTCATCGAGATGGAG

R-B ---T---_{C--- -C}

---C---T---R-M

-TC---G---A-T---C---G---CG--C---C----A---C----T---T---CA-GG-G---H-B

yGlyValPheAspValSerAsnAlaAspArgLeuGlyPh.SerGluValGluLeuValGlnMetValValAspGlyValLysLeuLeuIleGluMetGlu

R-B

R-M Ser Ile Ser Gin Leu MetVal

1100 H-B CAGCGGCTGGAGCAGGGCCAGGCCATCGACGACCTCATGCCTGCCCAGAA

*A

GCCCGGCCCACACCCGACACCAGCCCTCGTGCTTCCTAACTTATT

R-B --- ---GTG--T-C---C ---R-MA--AA---A-A---T---A-G--C--C---G-AGGCGCGCAG--CGC-G-CG-CG-C---GC-TG-AGG-GCCC--CGCC

H-B GlnArgLeuGluGlnGlyGlnAlaIleAspAspLeuMetProAlaGlnLysTer

R-B

R-M LysLys Lys Ser MetIle

1200 H-B

_{GCCTGGGCAGTGCCCACATGCACCCCTGATGTTGCCCGTCTGGCGAGCCCTTAGCCTTGCTGTAGAAGGACTGTCCGTCACCCTTGGTAGAGTTTATTTT}

R-B

---C---C-G---C---GA-GT-CA----G-G-CT---C---GACTTGT

---G---CC---C---R-M

_{CG-A-C--GCGCGG-C-CG-GGG-T-G--GT-CCAG-CAA---GCCC-GTCGTCTGCGT-CTGGCC-ATGAAA-G-C--C-T-ACACCTCGC-G-CCCGG}

1300 H-B TTTGATGGCTAAGATACTGCTGATGCTGAAATAAACTAGGGTTTTGGCCTGCAAAAAAAA

R-B

---GT---C---R-M

AGCTCC-C-C-CCTCCGGAGCACCTCCTG-CGGCTGGC---GGGGGGGGCT-GGCTCCCGGCGTGTCTGGAGCGGGGGCTTTTTCCCCACGCAAAGCAGT

R-MGAATAAAAGCAGCGGCGGCCTTAAAAAAAA

Figure2.The nucleotide and amino acidsequenceof the human CK- figure,wereobtained withanoverlapping CK-B genomic clone and, BcDNA(H-B)is shownonthe first and fourth line of eachset,re- asshown,there iscomplete nucleotide agreement with the rabbit

CK-spectively. Thesecond and fifth line in eachsetrepresenttheprevi- BcDNAcodingregion. The stop codon for the human translated

A

RNA: 2_{(n cn}

28S

18S 1.6KB

PROBE: 3' UT

B

BP

117 _a

114_

PROBE: Antisense 3'UT

pCK4 ) CPK-CODINGSEQUENCE]

* pCK4

I- I 3' UT

Figure 3. (A) Tissuespecificity of the CK-B probe. Northern blot anal-ysis. 10,gof total RNAisolated from human skeletal muscle, desig-natedasSM,weretransferred to nitrocellulose filter after electrophore-sis. The right lanewasprobed with the prepared insert of pCK4 (nu-cleotideposition270tothepoly-A tailas seeninFig. 2) and the left lanewithafragmentfrom the 3' untranslated(3UT)region (position 1142to1257 as seen inFig. 2). (B) RNAase protection assay. The

un-digestedanti-sense3'UTprobe spans 165 bpasit containsastretchof linker nucleotidesatboth endsof the probe.Hybridizationof CK-B mRNAwiththis anti-sense probe should protect 115bp.

sequences(Fig. 7A). A 27-kb band and two independent, high

frequency Eco RI restriction fragment length polymorphisms (RFLP) onepairat 17and 13 kb and the other at 7.5 and 5.4 kb, are observed in the population of human DNAs examined. We havefurther investigated these Eco RI RFLPs with an

ad-ditionalpanel of23 human DNAs, and have calculated the allelic frequency of the 17-and 13-kb bandsat0.5 and thefrequency of the 7.5- and 5.4-kb allelesat0.15 and 0.85, respectively. We have,in addition, digested normal human genomic DNA (from placenta andspleen) along withsimilarly preparedDNAfrom

several lungcancerspecimensand have not founddifferences in copy numbers of either of the hybridizing bands forCK-B (data not shown). There is, therefore, no evidence for either

rearrangement oramplification of the CKgeneinSCLCdespite extensive evidenceof enhancedexpression.As seen inFig.7B, the3'untranslated probe specific forCK-Bfailstorecognize the 27-kb band, butstill hybridizes to both Eco RI polymorphisms (Fig. 7 B). Restrictionendonuclease mapping of four indepen-dently isolated CK-B genomic clones excludes the possibilityof anEco RI site withinapotential introninthe 3' UT(datanot

shown). Several small,nonoverlapping probesfrom the5'region of theCK-Bgenealsohybridizedtobothpolymorphisms (data notshown). This strongly suggests the presence oftwospecific CK-Brelated sequences in the human genome.

Human chromosomallocalization ofCK-Bhybridizing se-quences. To examine this point directly, human, mouse, and

Chinesehamster genomic DNAs were digested with eight dif-ferent restriction endonucleases, size fractionated by agarose (0.7%) gel electrophoresis, transferredtonylonmembranes, and hybridized with human CK-B cDNA probes. A series of hy-bridizing fragments was detected in each lane after autoradio-graphy, and some hybridizing human bands were not resolved from homologous mouseorhamster bands in each of these di-gests. Neitherof thetwopolymorphic CK-B hybridizing human bands in Eco R1 digestswasresolved from homologous bands in hamster and mouse digests (data not shown). Most of the humanfragments detected with the CK-B probe, however, were resolvedfrom cross-hybridizing rodent sequences in Hind III, Pst I, and Bam HI digests (Fig. 8). DNAs from a panel of

human-hamsterand human-mousehybridsweredigested witheachof thesethreerestrictionendonucleases andanalyzed for the

pres-enceofspecifichuman CK-B

fragments

by Southern hybridiza-tion and representative results are shown (Fig. 8).

CL _g < <8

0. 0. < < 0.0 0. 0. 0.

U

PRB:SL- drvdpK

)CPKCODINGSEQUENCE| RABBIT cDNA

1.1 KB SCLC pCK4

Figure4. RNAexpressioninlungcancercelllines. Thetwo outerlanesin thisfigurerepresent 10Igof

total RNAusedassize markers. In theremaining lanes 2,ggoflungcancer-derivedpoly(A)-selected RNAwereloaded. The cell lines23, 125,and 460

wereisolated frompatientswithnon-SCLC.The other

cell lines inthisfigure originatedfrompatientswith SCLC.Exposure=XAR-5filmwithanintensifying

screenat-70°Cfor 16 h.

Expression of CreatineKinase-B Gene inLungCancer 1415

28S

CELL LINE:

- 0$

I I

28S

18S

1.6KB

0

_

R1

SST

PROBE:

I-1

5'

SUBCLONE

OF pCK4

Figure 5.NegligibleCKexpressioninundifferentiatedHL60cells. 10

,ug

of total(T)or2 ugof poly(A)-selected (PA)RNAfromtwoSCLC celllines (82and592)andfromHL60 cellswereexamined for CK transcripts.Theprobe isalinker-Eco RItoSst Ifragmentfromthe 5'

coding region ofpCK4.

co

~0~

0

h. .. a) 2) co)

2

_{0 C v 0}

CD

ND

' CD

co CD

(D cm CY CM (D 0

J CM N N CY C\N It

ILO LO Tcco C It

BP

PROBE: Antisense 3' UT

Figure6. RNAaseprotectionassaytoinvestigateCK-Bspecific expressioninlungcancercell lines. 10 g oftotalRNA,isolated from

different cell linesaslisted,werehybridizedfor 16 h with the3'

un-translated anti-senseCK-Bspecific probe. Autoradiographywas

per-formed afterRNAasedigestionand 6%denaturingacrylamide gel electrophoresis.Protectionof threespeciesat 117, 114,and bp

re-sults fromdigestionofafewnucleotidesfrom each end ofa l5-bp regionofhomology.Seeexplanationin text.

InHind III digests, the 9 kb and 7.7 kb hybridizing human bands(Fig. 8 A) were well resolved from homologous mouse sequences but the 9-kb band could not be separated from a

doublet (9.3 and8.8 kb)ofhybridizing hamster sequences. In Pst I digests(Fig. 8 B), all four hybridizing human fragments

wereresolved from hybridizing bands in mouse DNA, but the 5-kb human band was not resolved from a 4.9-kb hybridizing sequencein hamster DNA. The 8.4-kb hybridizing human se-quenceinBam HIdigests(Fig. 8 C) was resolved from homol-ogous rodent bands but the 24-kb human band intensity was low anditwas poorlyseparated from a 22-kb hamster band.

Analysis ofthe panel of hybridcell DNAs reveals that se-quences hybridizingto the CK-B probe were located on two

different human chromosomes (TableI).The 2.4- and 7.7-kb humanHindIII bands and the 0.95- and 1.55-kb human Pst I

bands always segregated concordantly and were detected only

inhybridcells thatcontainedthe8.4-kb Bam HI human band. These CK-B hybridizingsequences, designated CK-Bl, could

belocalized tothespecific humanchromosomal band 14q32.

This localizationwasobtainedbyanalysis of a group of hybrids

that were isolated after

fusing

human fibroblasts containing a well characterized reciprocal chromosome translocation

(Xql3;14q32) with Chinese hamster fibroblasts (27). Two of thesehybrids retained the human 14/Xtranslocation chromo-somebutnohumanCK-Bl sequences(Fig.8 C, lane 2) while theotherthreehybrids retainedtheseCK-BI sequences and the human X/14 translocation chromosome but neither an intact chromosome 14 nor the 14/X reciprocal translocation chro-mosome. Human CK-BBisoenzyme activityand the heavy chain

immunoglobulin locus(IgH)(27) also

cosegregated

with the now

designated CK-Bl

sequencein these hybrids. Theseresults permit

unambiguous assignment of

this CK-Bgene to the same

telom-eric bandonhumanchromosome 14(14q32) previouslyshown tocontain the IgH locus (27). This interpretation isstrengthened

bythefactthatfiveindependent human-mouse hybrids retain

an

incomplete

chromosome 14but donotcontainhuman CK-B 1 sequences or IgH sequences.Thesehybrids, however,all ex-press nucleoside phosphorylase, a long arm marker for this

chromosome(datanotshown).

In a secondgroup of

hybrids,

the 2.7- and 5.0-kb human

Pst Ibands,and the 9-kb human HindIIIbandwereobserved

tosegregate

concordantly

to chromosome 16 (Table

I).

These

sequences have been

designated

asCK-B2. The 24-kb human

Bam HIband alsoappearedtobepresentinthis secondgroup

of

hybrids,

but the weak band

intensity

and poor

separation

from homologous bands prevented

unambiguous

chromosomal

assignment of

this band. One

particular

somatic cell

hybrid

re-tained achromosome 16 witha

deletion

ofmost ofthe

long

arm. Alongarm

marker,

diaphorase-4 (16qI2-q2 1),

isnot

ex-pressed inthishybrid,but a shortarmmarker,phosphoglycolate phosphatase (16pl2-pl3), was detected. This

hybrid

retained

theactive human

metallothionein

gene

complex (28)

and the

CK-B2sequence. Fourother

hybrids

from anotherseries retained humandiaphorase-4, active

metallothionein

genes, and the

CK-B2sequence, butlacked

phosphoglycolate phosphatase activity

(datanotshown).Theseresults localizethe CK-B2 sequenceto

the

region

16pl3-16q21.

Discussion

Over the past 10 yr an

increasingly

central role has been

rec-ognized for creatine kinaseincellular metabolism. As the

cat-alyticenzymeforthe

phosphocreatine shuttle,

CK is considered

117

114

a

CELL LINE:

CM t DCm It Q) _{cf Cc}

M cv) C-4 C\'J CmJ LO

1r CM V t KB

4t

go

_II

4w~~~~

_0

_0

4040 5.4

PROBE:

CK-B Specific

3' UT

_ _

KB

17

13

7.5

5.4

CELL

LINE:

c Ncm cm

LO LO C1) cmJ

Figure 7.(A)Genomic restriction endonuclease analy-sis. 10Agofgenomic DNAweredigested to comple-tion with EcoRI and transferred to nitrocelluloseafter electrophoresisasdescribed in Methods. The DNA sampleswereisolated fromapanel of SCLC and

non-SCLCcell lines. The pCK4 probe,aspreviously de-scribed,encompassesprotein codinghomology

se-quencesand thisfigure, therefore,representsthe fam-ily of CK-relatedgenes.(B) As aboveexceptthat this panel of Eco RI digested DNAwasprobed with the

CK-B specific3'UTsequence.

responsible for themovementofhighenergyphosphatebonds

fromthemitochondriontosites of cellular work (1).Inaddition totheirparticipationas anenergyshuntfor skeletal muscle and

other contractile proteins (29), creatinekinases have also been

implicated in certain tissues with protein and lipid synthesis (30), maintenance of ionic gradients across membranes (31),

phagocytosis (32), mitotic spindle elongation (33), and as a

structural protein (34).

This paperestablishes the primarystructureof the protein coding and3'untranslated region of the humancreatine

kinase-Bgene. The translated protein encompasses 381 residues and demonstrates remarkable evolutionary conservationwithamino acidhomologytothe rabbit CK-B cDNAinexcessof98%.

Al-thoughhomologywiththe rabbit CK-M cDNAsequenceis

con-siderably less,wehaveobserved thatanucleic acid probe sub-clonedfrom the protein coding region will cross-hybridize with human CK-Msequences.Incontrast,aprobe derived from the

3'UTregion is CK-B specific. Using this CK-B specific fragment

inan RNAase protectionassay,thepresentexperiments

dem-onstratethat the elevated CK activity in SCLC isanexpression ofmarkedly increased steady-state levels of the CK transcript. Preliminary analysis of othertumorswithanincreasedamount

ofCKenzymeactivityalso reveal marked differences in

steady-statetranscript levels and raises the question whether such in-creased expression is of metabolicconsequencetothetumor.

Prior investigations haveattemptedtoidentifythefunctional domains ofthisenzymeby combining the datafrom biochemical

experiments with more recent data that compares regions of

interspecies amino acidconservation (2, 8). Our work,

estab-lishing the primarystructureofthehumanCK-B cDNA,

iden-tifiesahighly conserved region of amino acids flankingacysteine

residue at amino acid position283. Thiscysteine residue has beenshowntobeindirectly linkedtotheactive site oftheenzyme

with loss of activity following modification with various thiol

blockingagents(35,36). The specific sites involved in the

phos-phate group transfer or in nucleotide binding have not been determined. Specific modification of chicken CK-MM orBB with proteinaseKandpronaseEcleaves theenzyme - 50 amino

acids from the carboxyl end, generatingtwofiagmentsthatresult inthe loss of 90%enzymeactivity(37). This cleavage has been

determined to occur between alanine residues 328 and 329, which is 45 residues downstream from the conserved cysteine site. Ofinterest, the carboxyl terminal-modified, proteolytically inactivated,enzymeis still abletoestablishproper

subunit-sub-unitinteractions suggesting that the subunit recognition domain isatadistanceupstreamfrom the cleaved residues. This subunit recognition domain is currently undefined, but highly conserved regions (e.g., amino acids 183-223) between both M- and B-genes exist and could be of importance in such subunit in-teractions. The abilityto generatehybrids between the BB

iso-enzymeoftherabbitor oxwith the analogous invertebrate en-zymearginine kinasefromthe seacucumber(Holothuria

for-skalh)

(38) underscores the potential functional importance of thesesubunit interactions.

TheuseofaB-specificsequencehas also allowedustoexplore thecomplex genomicpatternof the CK related family ofgenes.

Wedidnotobserveanyevidence for amplificationor

rearrange-mentof thesegenesin SCLC. We did, however, demonstrate

thatthereareatleasttwoCK-Bhomologoussequencesinhuman

DNAondifferent chromosomes. Prior chromosomal mapping

ofCK-B activity by starch gel electrophoresis of somatic cell hybrid lysates localized thegeneto chromosome 14 (39, 40). Other authors, however, concluded that thepresence ofother

chromosomes, in particular chromosome 17,wererequired in

combination with chromosome 14 for CK-BB expression (41, 42). Although this latter observation was not confirmed (27) provisional assignment ofaCK-Blocus has also beento

chro-mosome17(43). Since thesearefunctionalassays,theseanalyses

A

PROBE:

pCK4

27

17

13

7.5

A

Hind III

4 5 CH M H a M

Pst I

12 3 4 5 M H

CH

-12.3

r

-.7

-5.0

.,l.tiX,.

.e. ,.

s

*:

*..,

....,..^

., _.F

3.2--4.0 2.2'

-3.2

2.9

-2.4

CH

-5.0 -4.9

-3.7

-3.0

-2.7 -2.2

U

. ....

fal _{-t 55-1.5}

-0.95

S.Ai

_4

-0.5

C

Bam

Hi

1 2 CH H

22 j 24

18

-15

-8.4

Figure8.Southernanalysis of genomichuman-rodent cellhybrids and control DNAs.Genomic DNAs(20,g)werecompletely digestedwith theindicated restrictionenzymeand transferredtonylonmembranes afteragaroseelectrophoresis. Hybridizationswereperformedwithboth theCK-Bspecific3'UTsequenceand withthenearfulllengthCK-B

cDNAsequencepCK4,whichgavea moreintensesignalon

autora-diography.Lanes H,M,and CH contain DNA isolated from human placenta,mouseLMTK-cellsorChinese hamstercells, respectively. (A)HindIIIdigests.Lanes1-5 depict representativehuman-mouse hybridswhich exhibit 7.7and 2.4 kb humanbands(lanes2and 5)or a9.0 kb human band(lane 1),both series of bands(lane 3)or no

hy-bridizinghuman bands(lane 4). Only the7.7and9.0 kb human bandsweredetected when membraneswerehybridizedwith the 3' UT

probe. The large (18 and 24kb)bands observed in lane Hwerevery

weakornotdetectedinmostdigests of humanDNA. Thesizes (kb) of hybridizingbandsareindicatedalongthe leftmargin (mouse), right

margin(human),and farright margin (hamster). (B)Pst Idigests.

Hu-man-mouse(lanes 1-3) andhuman-hamster(lanes4and5) hybrids

exhibit 5.0 and2.7kb human bands(lane 2), 1.5 and 0.95 kb human

bands(lane 3),bothsetsof bands(lane 4)or nohuman bands(lane

and5).Onlythe5.0- and 0.95-kb human bandsweredetectedwith

the 3'UTprobe.Size markersareasindicated in(A). (C)Bam HI

di-gests.Human-hamsterhybridsshow thepresence(lane 1)orabsence

(lane 2)of the 8.4 kb human band. Both the 8.4 kb band and the weak24-kb human bandweredetectedwiththe 3' UTprobe.The

sizes(kb)of hamster(left)and human(right)bandsareshown. 1 2 3

B

17-12

-

6.3-4.8-3

2.5-1.7- A

N_''.

-w Aw

Ns 4.6- 40

qmw NY..

11 .1 ...."::.

0

Abbla., A"

a 0

Ask-.w..

0.6-TableI.Segregation

of

CK-BSequences withSpecificHuman Chromosomes

%Discordancy

Human chromosomes CK-BI CK-B2

1 31 47

2 48 53

3 47 50

4 49 57

5 35 30

6 17 43

7 38 45

8 34 27

9 32 43

10 41 50

11 50 34

12 26 35

13 30 30

14 0* 34

15 22 50

16 29 0

17 46 55

18 35 45

19 31 43

20 27 34

21 30 45

22 50 50

X 46 48

The presenceof human sequenceshybridizingwithahumanCK-B

specificcDNAprobeis correlated with the presenceorabsenceof spe-cific human chromosomes in 36 hamster and 38 human-mousehybrid cell lines in column 1or6 human-hamster and 38 hu-man-mousehybrids in column 2.Discordancyrepresents either the presenceof aspecifichumanchromosome in the absenceofhuman CK-Bhybridizingsequencesorthe presenceofthese sequencesdespite

the absenceof the chromosome in thathybrid.The percent discor-dancy represents thesumof these numbersdivided bythe total num-berofhybridsexamined. The chromosomegivingthelowest discor-dancy(i.e., 0%)contains the CK-Bspecificsequence. Column 1 indi-catesdiscordancywith the 2.4- and 7.7-kb humanHind III bands, the 0.95- and 1.55-kb human Pst I bands, and the 8.4 kb human Bam HI band(i.e., CK-Bl sequence). Column 2indicates discordancy withthe 9.0 kb humanHind III and the 2.7 and 5.0 kb human Pst I bands (i.e.,CK-B2).

*Therewerenodiscordancies between hybrid cells retaining chromo-someband14q32andCK-B1 hybridizingsequences, but there were 10discordancies (14%) involving portions of chromosome 14 not

con-tainingthis band (see text).

maybesubjecttoinfluencesof outside regulatory forces at the

transcriptional

or posttranscriptional level. In addition, such analyses would not detect genes that were not functional in the

hybrid environment.Our studiesestablish the mapping of a CK-Bgene to chromosome 14q32, andhave also found evidence

forasecondCK-B gene or gene-related sequence on chromosome 16.B-subunit:B-subunitmixingexperiments (44) and high res-olutiontwo-dimensionalgelelectrophoresis(45) have suggested the presence oftwo functionalCK-B genesin certain species. Inadditionthereisrecent evidence for sequence heterogeneity

amongchickenCK-BcDNA clonesin their 3' untranslated and

coding regions again suggestingeither thepresenceoftwo distinct

genes ortheoccurrenceofalternative processing(46).

Since it is known that theCK-Bgene onchromosome 14,

which wecallCK-B1, is functional in rodent-human hybrids,

the precise role and functional activity of the CK-B gene on

chromosome16(here designated

CK-B2)

needs to be established. While it isconceivablyonlyaCK-B-relatedgeneor

pseudogene,

it is also possiblethat it represents aCK-B enzymeactivated

duringontogenyinaregulatedfashion,distinct from activation of CK-B1. We have recently cloned the CK-Bl locuson

chro-mosome 14and have observed the appropriate organization of

anactivegene.It will be of interest tousethis clone and the two

independent, high frequencyEco RIpolymorphism sites that wehave identifiedtoexplore allelic distribution and activation ofthis locus in neuroendocrine tumors.

Acknowledgments

Wethank Dr. Philip Lederfor the human placentalgenomic library, Jane Trepelfor providing HL-60 cell cultures, and Marion Nau and MarkLevittfor some of the DNA and RNA samples used in this study. Wethank Dr. John D. Minna foradvice, encouragement, and critical review of the manuscript.

References

1.Bessman, S. P. 1985.Thecreatine-creatinephosphate energy shut-tle. Annu. Rev.Biochem.54:831-862.

2.Pickering,L., H. Pang, K.Biemann, H. Munro, and P. Schimmel. 1985. Twotissue-specific isozymes ofcreatine kinase have closely matched amino acid sequences. Proc. Natl. Acad. Sci. USA. 82:2310-2314.

3. Roman, D., J.Billadello, J. Gordon, A. Grace, B. Sobel, and A. Strauss. 1985.Complete nucleotide sequenceofdogheart creatine kinase mRNA:Conservation of amino acid sequence within and among species. Proc.Natl.Acad. Sci. USA. 82:8394-8398.

4. Rosenberg, U. B., G. Kunz, A. Frischauf, H. Lehrach, R. Mahr, H. M. Eppenberger, and J. Perriard. 1982. Molecular cloning and

expressionduringmyogenesisof sequences coding for M-creatine kinase.

Proc.Nat!. Acad. Sci. USA. 79:6589-6592.

5.Schweinfest,C. W., R. W.Kwiatkowski,and R. P.Dottin. 1982. Molecularcloningof a DNA sequence complementary to creatine kinase MmRNAfrom chickens. Proc. Nat!.Acad. Sci. USA.79:4997-5000.

6. West, B. L., P. C. Babbitt, B. Mendez, and J. D. Baxter. 1984. Creatinekinaseprotein sequence encoded by a cDNA made from

Tor-pedo Californica electric organ mRNA. Proc.Nat!. Acad. Sci. USA. 81:

7007-7011.

7.Benfield, P. A., R. A. Ziven, L. S. Miller, R. Sowder, G. W. Smy-thers,L. Henderson, S. Oroszian, and M. L. Pearson. 1984. Isolation and sequence analysis of cDNA clones coding for rat skeletal muscle creatinekinase.J.Bio!.Chem. 259:14979-14984.

8.Ordahl,C. P., G. L. Evans, T. A. Cooper, G. Kunz, and J.Perriard.

1984.CompletecDNA-derivedaminoacid sequence of chick muscle creatinekinase. J.Biol. Chem. 259:15224-15227.

9.Gazdar,A.F., M. H.Zweig, D. N. Carney, A. C. Van Steirteghen, S.B.Baylin, and J. D. Minna. 1981. Levels of creatine kinase and its BBisoenzyme in lung cancer specimens and cultures. Cancer Res. 41: 2773-2777.

10. Carney, D. N., A. F. Gazdar, G. Bepler, J. G. Guccion, P. J. Marangos, T. W. Moody, M. H. Zweig, and J. D. Minna. 1985. Estab-lishment and identification of small cell lung cancer cell lineshaving classic and variant features. Cancer Res. 45:2913-2923.

Disease. K. L. Becker, and A. F. Gazdar, editors. W. B. Saunders and Co.,Philadelphia.501-508.

12.Sausville, E. A., A. M. Lebacq-Verheyden, E. R. Spindel, F.

Cut-titta, A.F.Gazdar, and J. F. Battey. 1986. Expression of the gastrin-releasing peptide gene in human small cell lung cancer. Evidence for alternative processing resulting in threedistinctmRNAs. J.Biol. Chem. 261:2451-2457.

13. Cooper, T. A., and C. P. Ordahl. 1985.Asingle cardiac troponin T gene generates embryonic and adult isoforms via developmentally regulated alternate splicing. J.Biol. Chem.260:11140-11148.

14.Sanger, F., S. Nicklen,andA.R. Coulson. 1977. DNA sequencing withchain-terminatinginhibitors. Proc. Nat!. Acad. Sci. USA. 74:5463-5467.

15.Messing, J. 1983. New M 13vectorsfor cloning.Methods Enzymol.

101:20-78.

16. Davis, L. G., M. D.Dibner,and J. F. Battey. 1986. Preparation

of insert forM13cloning by successiveBAL31 exonucleasedeletion. InBasicMethods in MolecularBiology.L.G.Davis,M.D.Dibner,and J.F. Battey, editors. Elsevier/NorthHolland,Amsterdam.244-248.

17. Polsky, F., M. H. Edgell, J. G.Seidman, and P. Leder. 1978. High capacity gel preparativeelectrophoresis for purificationoffragments

ofgenomicDNA.Anal.Biochem. 87:397-410.

18.Chirgwin,J., A.Przybyla, R.MacDonald,and W. Rutter. 1979.

Isolation of biologicallyactiveribonucleicacid fromsourcesenriched in

ribonucleases. Biochemistry. 18:5294-5299.

19.Aviv,H., and P. Leder. 1972.Purificationofbiologically active globinmessenger RNAby chromatographyonoligothymidylic

acid-cel-lulose. Proc. Nat!.Acad.Sci. USA.69:1408-1413.

20. Southern, E. M. 1975. Detection ofspecificsequences among DNAfragments separated by gel electrophoresis.J.Mol. Biol. 98:503-517.

21. Lehrach, H., D. Diamond,J. M. Wozney, and H. Boedtker. 1977. RNA molecularweightdeterminationby gel electrophoresisunder

denaturing conditions,acriticalreexamination.Biochemistry. 16:4743-4751.

22.Rigby,P. W.J.,M.Dieckmann,C.Rhodes,and P.Berg.1977.

Labellingdeoxyribonucleicacidtohigh specific activityin vitrobynick

translation withDNApolymeraseI.J.Mol. Biol.113:237-251. 23.Melton,D. A., P. A.Krieg,M. R.Rebagliati, T. Maniatis,K.

Zinn,and M. R. Green. 1984.Efficientin vitro

synthesis

of

biologically

activeRNAand RNAhybridizationprobesfromplasmids containinga

bacteriophage SP6promoter. Nucleic Acids Res. 12:7035-7056. 24. Myers, R. M., Z. Larin,and T. Maniatis. 1985. Detection of

singlebase

substitutiohs

by ribonuclease cleavageatmismatches in RNA: DNAduplexes.Science(Wash.DC). 230:1242-1246.

25.Winter,E., F. Yamamoto, C.Almoguera,and M.Perucho.1985. Amethodtodetect andcharacterizepointmutationsintranscribedgenes:

Amplificationandover

expression

ofthemutantc-Ki-ras allele in human tumorcells.Proc.Nat!.Acad.Sci. USA.82:7575-7579.

26.McBride,0.W., P.A.Hieter,G. F.Hollis,D.Swan,M.C.Otey,

and P.Leder. 1982.Chromosomallocationofhumankappaand lambda

immunoglobulin lightchainconstantregiongenes.J. Exp. Med. 155: 1480-1490.

27.McBride,0.W., J. Battey, G. F.Hollis,D. C.Swan,U.Siebenlist,

and P.Leder.1982.Localizationof human variableanuconstantregion

immunoglobulinheavy chain genesonsubtelomericbandq32of chro-mosome 14.Nucleic AcidsRes. 10:8155-8170.

28.Schmidt,C. J., D. H.Hamer,and 0. W. McBride. 1984.

Chro-mosomal location of human metallothionein genes: Implications for Menkes' disease. Science (Wash. DC).224:1104-1106.

29. Tombes, R. M., and B. M. Shapiro. 1985. Metabolic channeling: Aphosphoryl creatine shuttle to mediate high energy phosphate transport between spermmitochondrion and tail. Cell. 41:325-334.

30. Carpenter, C. L., C. Mohan, and S. P. Bessman. 1983. Inhibition of protein and lipid synthesis in muscle by 2,4-dinitrofluorobenzene, an inhibitor of creatine phosphokinase. Biochem. Biophys. Res. Commun.

111:884-889.

31. Levitsky, D.O., T. S. Levchenko, V. A. Saks, V. G. Sharov, and V.I. Smirnov. 1978. The role of creatine phosphokinase in supplying energy forthecalcium pump system of heart sarcoplasmic reticulum.

Membr. Biochem.2:81-86.

32. Loike, J. D., V. F. Kozler, and S. C. Silverstein. 1979. Increased ATP and creatine phosphate turnover in phagocytosing mouse peritoneal macrophage. J.Biol. Chem. 254:9558-9564.

33.Cande, W. Z. 1983. Creatine kinase role in anaphase chromosome movement. Nature(Lond.).304:557-558.

34.Ottaway, J. H. 1967. Evidence for binding of cytoplasmic creatine kinase to structural elements in heart muscle. Nature (Lond.). 215:521-522.

35.Mahowald, T. A., E. A. Noltmann, and S. A. Kuby. 1962. Studies on adenosinetriphosphatetransphosphorylases III. Inhibition studies. J.Biol. Chein.237:1555.

36. Smith,D.J., and G. L. Kenyon. 1974. Non-essentiality of the

active sulphydrylgroup ofrabbitmusclecreatinekinase. J. Biol.Chem.

249:3317.

37. Lebherz, H. G., T. Burke, J. E. Shackelford,J.E.Strickler, and K.J.Wilson. 1986.Specific proteolyticmodification of creatine kinase

isoenzymes. Implicationofc-terminalinvolvement in enzymeactivity

butnotinsubunit-subunit recognition. Biochem.J.233:51-56. 38. Watts, D. C., B. Focant, B. Moreland, and R. L. Watts. 1972.

Formationofahybridenzyme betweenechinoderm arginine kinase and mammaliancreatinekinase. Nat. New Biol. 237:51.

39.Chern,C. J., P. Tan, and H. Park. 1980. Chromosomalmapping

of human creatine kinase(braintype)usinghuman-rodentsomatic cell

hybrids.Cytogenet.CellGenet.27:232-237.

40. Weil,D., N. VanCong, M.Gross, C. Foubert, and J. Frezel. 1980.Localisationdu gene de lacreatinekinase BBsurle chromosome

14 parl'analyse deshybrideshomme-rongeur. Ann. Genet. 23:150-154. 41.Povey,S., M. Inwood, A. Tanyar, and M. Bobrow. 1979. The

expressionofcreatine kinase isozymes in human cultured cells. Ann. Hum.Genet.(Lond.).43:15-25.

42.Donald, L. J., H. S. Wang, and J. L. Hamerton. 1982. Are there additional CKBB loci?Cytogenet. CellGenet.32:267-268.

43.McKusick,V. 1986. The human gene map.Clin. Genetics. 29: 554.

44.Eppenberger, M. E., H. M. Eppenberger, and N. 0. Kaplan. 1967.Evolution of creatinekinase.Nature(Lond.).214:239.

45.Rosenberg, U. B., H. M. Eppenberger, andJ.-C.Perriard. 1981. Occurrence ofheterogeneousforms ofthesubunitsofcreatinekinase in various muscle and nonmuscle tissues andtheir behaviour during

myo-genesis.Eur.J.Biochem. 116:87-92.

46.Hossle, J. P., U. B. Rosenberg,B.Schafer,H. M.Eppenberger,

and J.-C. Perriard. 1986. Theprimarystructureof chicken B-creatine kinase andevidence forheterogeneityof itsmRNA.NucleicAcidsRes.