Molecular Markers and Genes Associated with Low Palmitic and Low Linolenic acid Content in N97-3681-11 and N97-3708-13 Soybean Lines.

489  Download (0)

Full text

(1)

ABSTRACT

CAMACHO ROGER, ANA MARIA. Molecular markers and genes associated with low

palmitic and low linolenic acid content in N97-3681-11 and N97-3708-13 soybean lines.

(Under the direction of Andrea Josefina Cardinal and Ralph E. Dewey).

(2)

Linolenic acid (18:3) contains three double bonds and is particularly susceptible to

oxidation. There are at least three major loci responsible for low 18:3 content in soybean

seed oil (fan, fan2 and fan3), and possibly 2 more loci if the fanx

allele and the low 18:3

allele from N78-2245 are also independent loci. By decreasing the 18:3 content of soybean

oil from its typical level to a level of 30 g kg

-1

, it may be possible to eliminate or reduce

the need for hydrogenation of the oil. The FAD3 gene encodes an omega-3 desaturase that

converts 18:2 to 18:3 in the endoplasmic reticulum. It has four highly similar microsomal

isoforms:

GmFAD3A and GmFAD3B (93% DNA identity shared), 2a and

FAD3-2b. A single polymorphism was confirmed for the GmFAD3A gene when cDNA sequences

from 6 soybean parental lines used in our segregating populations were compared. A

random SNP in intron 2 of the

GmFAD3A

gene isoform was discovered in Boggs,

PI123440, and the two low linolenic parental lines in our populations. We have developed

a CAPS marker that distinguishes the

GmFAD3A

allele inherited from PI123440. The

segregation at this locus explained 77.5 to 89.2% of the genotypic variation in linolenic

acid content in two F4 derived populations.

(3)
(4)

MOLECULAR MARKERS AND GENES ASSOCIATED WITH LOW PALMITIC

AND LOW LINOLENIC ACID CONTENT IN N97-3681-11 AND N97-3708-13

SOYBEAN LINES

by

Ana Maria Camacho Roger

A thesis submitted to the Graduate Faculty of

North Carolina State University

in partial fulfillment of the

Requirements for the Degree of

Master of Science

CROP SCIENCE

Raleigh

2006

APPROVED BY:

_____________________________ _____________________________

Dr.Ralph E. Dewey

Dr. Joseph W. Burton

Co-Chair of Advisory Committee

_____________________________

Dr.Andrea J. Cardinal

(5)

ii

DEDICATION

(6)

iii

BIOGRAPHY

(7)

iv

(8)

v

ACKNOWLEDGEMENTS

I would like to sincerely thank Dr. Andrea J. Cardinal, my major advisor, and Dr.

Ralph E. Dewey, my co-advisor, for their guidance and patience. I also extend appreciation

to my committee member, Dr. Joe W. Burton.

I would also like to thank Carol Griffin, Karthik Aghoram, Steve Bowen, Matthew

Keogh and Ping Zhang for their partnership, technical advice and all the sharing moments

(including the birthday’s cakes) at Dr. Dewey’s lab.

I am very grateful to Bill Novitsky for his advice and technical supervision at the

USDA lab with the fatty acid extraction and analysis.

I am very thankful with all the professors that taught me at NCSU, Paul Murphy,

José Alonso, Greg Gibson, Cynthia Hemenway, Philip Awadala, Bill Ashley, Pat Estes,

Pam Arroway, Ron Qu, James Holland, Tom Isleib, Daniel Bowman and David

Danehower.

I also want to thanks Sridevi Azhakanandam, Rebecca Whetten, Jérôme Auclair,

and Eleni Bachlava for their technical advice at Dr. Cardinal lab.

(9)

vi

I am grateful for the unending support, and collaboration provided by my husband,

John. Without your love and encouragement it would be very difficult to keep me sane.

Thanks for being with me in this road of our life.

(10)

vii

TABLE OF CONTENTS

LIST OF TABLES ... ix

LIST OF FIGURES ... xi

INTRODUCTION AND LITERATURE REVIEW

Literature Cited...18

CHAPTER ONE: Cloning and Sequence Analysis of the

GmFAT1b,

GmFAT2a and

GmFAD3A cDNAs. ...26

Introduction...26

Materials and Methods ...30

Results and Discussion ...32

Literature Cited...45

CHAPTER TWO: Molecular analysis of soybean lines with low palmitic acid content

in the seed oil...47

Abstract ...49

Introduction...50

Materials and Methods ...54

Results and Discussion ...60

Literature Cited...73

CHAPTER THREE: Phytotron study to determine if

fap1fap, fap

nc

fap

nc

, and

fanfan

mutations in N97-3681-11 and N97-3708-13 soybean lines have pleitropic effects

in leaves and roots fatty acid composition. ...78

Introduction...78

Materials and Methods ...80

Results and Discussion ...86

Literature Cited...97

(11)

viii

Introduction...100

Materials and Methods ...102

Results and Discussion ...107

Literature Cited...112

APPENDICES ...115

Appendix A...116

Appendix B ...117

Appendix C...119

Appendix D...119

Appendix E ...119

Appendix F ...120

Appendix G...121

Appendix H...216

Appendix I ...217

Appendix J...378

Appendix K...379

Appendix L ...421

Appendix M...422

Appendix N...474

(12)

ix

List of Tables

CHAPTER TWO: Molecular analysis of soybean lines with low palmitic

acid content in the seed oil.

Table 1. Palmitic acid, stearic acid, oleic acid, linoleic acid, and linolenic acid content

means of seed oil of lines homozygous fapncfapnc and of lines heterozygous or

homozygous. ... 72

CHAPTER THREE: Phytotron study to determine if fap1fap, fap

nc

fap

nc

, and fanfan

mutations in N97-3681-11 and N97-3708-13 soybean lines have pleitropic effects in

leaves and roots fatty acid composition.

Table 1. F test results for fatty acid components of leaf tissue from soybean lines 'Brim'

and N97-11/N97-13 from a split-split-plot experiment grown in the NCSU phytotron at

22/18ºC and 26/22ºC in 2001, 2002 and 2004 analyzed with proc mixed. ... 91

Table 2. F test results for fatty acid components of root tissue from soybean lines 'Brim'

and N97-11/N97-13 from a split-split-plot experiment grown in the NCSU phytotron at

22/18ºC and 26/22ºC in 2001, 2002 and 2004 analyzed with proc mixed. ... 92

Table 3. Least Squares Means for fatty acid components of leaf tissue from soybean

lines 'Brim' and N97-11/N97-13 from a split-split-plot experiment grown in the NCSU

phytotron at 22/18ºC and 26/22ºC in 2001, 2002 and 2004. ... 93

Table 4. Difference of Least Square Means for fatty acid components of leaf tissue from

soybean lines 'Brim' and N97-11/N97-13 from a split-split-plot experiment grown in the

NCSU phytotron at 22/18ºC and 26/22ºC in 2001, 2002 and 2004. ... 94

Table 5: Least Squares Means for fatty acid components of root tissue from soybean

lines 'Brim' and N97-11/N97-13 from a split-split-plot experiment grown in the NCSU

phytotron at 22/18ºC and 26/22ºC in 2001, 2002 and 2004.

... 95

Table 6: Difference of Least Square Means for fatty acid components of root tissue from

soybean lines 'Brim' and N97-11/N97-13 from a split-split-plot experiment grown in the

NCSU phytotron at 22/18ºC and 26/22ºC in 2001, 2002 and 2004... 96

(13)

x

Table 1.

Palmitic acid, stearic acid, oleic acid, linoleic acid, and linolenic acid content means of

seed oil of lines homozygous fad3a fad3a or Fad3a Fad3a, and of lines heterozygous

fad3aFad3a for the FAD3a allele, standard deviation of those means, difference between

means and their significance, the R

2

for the difference of those means for two F4-derived

(14)

xi

List of Figures

INTRODUCTION

Figure 1. Biosynthetic pathway of oil: de novo fatty acid biosynthesis...15

Figure 2. Biosynthetic pathway of oil: Triacylglycerol assembly ...16

CHAPTER ONE: Cloning and Sequence Analysis of the GmFAT1b, GmFAT2a and

GmFAD3A cDNAs.

Figure 1. Nucleotide sequence of the soybean in lines Anand, Brim, Boggs, Corsica,

N97-3681-11 and N97-3708-13...34

Figure 2. Nucleotide Sequence of the soybean GmFATB2a cDNA in lines Anand, Brim,

Boggs, Corsica, N97-3681-11 and N97-3708-13. ...38

Figure 3. Nucleotide sequence of the soybean isoform GmFAT3A in lines Anand, Brim,

Boggs, Corsica, N97-3681-11 and N97-3708-13. ...42

CHAPTER TWO: Molecular analysis of soybean lines with low palmitic acid content

in the seed oil.

Figure 1. Amino acid sequence alignment of the GmFATB1a, GmFATB1b and

GmFATB2a predicted proteins of soybean. Identical residues are shown on a black

(15)

xii

Figure 2. Genomic region of GmFATB1a and GmFATB1b showing the locations of

gene-specific primer pairs. ...68

(16)

1

INTRODUCTION

(17)

2

110g kg

-1

to 40g kg

-1

) and linolenic acid (from 70 g kg

-1

to <30 g kg

-1

) are desirable to

enhance the soybean oil nutritional quality.

Soybean breeders have been altering the fatty acid composition in soybean seeds by

mutagenesis, recurrent selection, screening of natural mutations, and conventional

hybridization for the last 35 years. Several lines with decreased linolenic acid, increased

oleic acid, decreased palmitic acid, or increased stearic acid contents have been developed.

Concurrently, the understanding of the biosynthesis of fatty acids in plants has improved

tremendously over the last 10 years and most of the genes involved in this pathway have

been cloned and sequenced in several plant species, including soybeans. However, there

have been few studies that relate a particular fatty acid mutant (phenotype) with a specific

gene in the fatty acid biosynthesis pathway in soybeans. Sequence information of

candidate genes from the lipid biosynthesis pathway in soybeans provides a tool to develop

allele-specific markers to investigate their relationship with seed fatty acid quantitative

trait loci (QTL) or specific fatty acid mutants.

(18)

3

(19)

4

LITERATURE REVIEW

Fatty acid biosynthesis in soybean

Seed oils are a carbon source that provides energy and essential precursors in the

biosynthesis of carbohydrates, proteins and lipids throughout the seed germination process.

A predominant portion of the oil is a complex mixture of individual triacylglycerols, which

are one of five fatty acids esterified in the OH positions on the glycerol molecule. Not all

fatty acids within the oil seed are esterified to triglycerides, they are also found in partial

glycerides such as mono- and diglycerols, phospholipids or unesterified fatty acids that

give physicochemical properties to cellular membranes. For example, in the phospholipid

bilayers saturated fatty acids provide rigidity to the cell while unsaturated fatty acids

provide extensibility. Phospholipids and glycolipids are essential structural components of

all cellular membranes, including the chloroplast, mitochondria and other organelles

(Appelqvist, 1989). Importantly, the thylakoid membranes containing the chlorophyll of

the chloroplast is an organelle particularly rich in linolenic acid (Rahman et al., 1998).

Linolenic acid is also present in the roots and all along the axis of the plant (Yoshida and

Kajimoto, 1977).

(20)

5

organelles where the assembly of extraplastidial glycerolopids take place (Ohlrogge and

Jaworski, 1994).

In order to recognize the target genes that control the production of fatty acids in

the plant it is important to understand the fatty acid biosynthetic pathway. Oil biosynthesis

can be considered as two overlapping stages: (1) de novo fatty acid biosynthesis; and, (2)

triacylglycerol assembly.

1) De novo

fatty acid biosynthesis

De novo

fatty acid biosynthesis is mediated by the fatty acid synthetase (FAS) enzyme

complex that catalyses cycles of 2 carbons unit elongation of the acyl chain esterified to

acyl carrier protein (ACP). FAS consists of four soluble enzymes [β-ketoacetyl-ACP

synthase (KAS),

β

-ketoacetyl-ACP reductase,

β

-hydroxyacyl-ACP dehydratase and

enoyl-ACP reductase]. The primary products of FAS are 16:0-enoyl-ACP and 18:0-enoyl-ACP. Two isoforms

of the KAS II enzyme are responsible for the elongation of 16:0 to 18:0 in soybean (figure

1). Subsequently, the enzyme stearoyl-ACP desaturase introduces the first double bond.

The 16:0-ACP, 18:0-ACP and 18:1-ACP are subsequently substrates for

acyl-ACP-thioesterases (Yadav, 1996). These enzymes determine the amount and type of fatty acids

that are exported from the plastids to the cytoplasm, where they are introduced into the

storage triacylglycerol (Pantalone et al., 2004).

(21)

6

which encodes 18:l-ACP thioesterase, and FatB, which encodes thioesterases preferring

acylACPs having saturated acyl groups. In

Cuphea hookeriana

seed, 16:0-ACP

thioesterase cDNA was found in non-seed tissues, while in a transgenic Brassica

napus

this

enzyme led to the production of a 16:0-rich oil.

(22)

7

2) Triacylglycerol assembly

Acyl-CoAs from the cytoplasmic pool are assembled into triacylglycerols (TAG)

by the action of three microsomal acyltransferases. The sequential addition of acyl moeties

to the sn-1 and sn-2 positions of glycerol-3-P (G3P) are catalyzed by glycerol-3-P

acyltransferase (GPAT) and lysophosphatidic acid acyltransferase (LPAAT), respectively,

and results in the synthesis of phosphatidic acid (PA). PA is converted to diacylglycerol

(DAG) by phosphatidic acid phosphatase (PAP). DAG can be also generated directly from

phosphatidyl choline (PC) by a reversible reaction catalyzed by cholinephosphotransferase

(CPT). Finally the sn-3 position of DAG is acylated to form triacylglycerol (TAG), a

reaction catalyzed by diacylglycerol acyltransferase (DAGAT). Lysophosphatidylcholine

acyltransferase (LPCAT) catalyses the reversible acyl exchange between 1:1-CoA and the

acyl group at the sn-2 position of PC (Fretzen, 1993) (Figure 2).

Biosynthesis of 18:2 and 18:3 fatty acid

(23)

8

desaturation are controlled by the

fad2

and

fad3

loci, respectively (Lemieux et al., 1990),

while plastidal oleate and linoleate desaturations are controlled by the

fad6

and

fad7

loci

(Brownse and Somerville, 1991). Both pathways function in the leaf tissue and the ER

pathway predominates during oil biosynthesis in developing seeds and in other non-green

tissues.

Low palmitic acid soybean germplasm

Soybean typically contains 110 g kg

-1

of palmitic acid, but germplasm with

recessive alleles at the

Fap

or

Sop

gene loci exhibit between 44 g kg

-1

to 162 g kg

-1

of this

fatty acid in the oil.

Five recessive alleles conferring low palmitic acid content have been studied:

fap1

(86 g kg

-1

),

fap3

(78 g kg

-1

),

fap*

(71 g kg

-1

),

sop1

(57 g kg

-1

),

fap

nc (64 g kg-1

) (Stojšin et

al., 1998b; Takagi et al., 1995). Of those five alleles, three are at independent loci from

each other (

fap1

,

fap3

and

fap*

) (Kinoshita et al., 1998; Primomo, 2000; Primono et al.,

2002; Schnebly et al., 1994; Stojšin et al., 1998b; Wilcox et al., 1994).

fap

nc is allelic to

fap3

(Primomo, 2000; Primono et al., 2002) and

sop1

is at an independent locus from

fap1

but its allelic relationship to the other loci is unknown (Kinoshita et al., 1998).

(24)

9

2000). The

fap3

allele

was found in soybean line A22 that was developed by mutagenizing

A1937 with N-nitroso N-methyl Urea (NMU) (Fehr et al., 1991 b).

sop1

was observed in

line J3 that was developed from X-radiation of cultivar ‘Bay’ (Rahman et al, 1996).

fap

nc is

the result of a serendipitous natural mutation and it was observed in the soybean line

N79-2077-12 (60 g kg

-1

) (Burton et al., 1983; Burton et al., 1994). The mutation in

fap

nc affects

the normal function of the enzyme 16:0-ACP thioesterase encoded by the gene FATB.

There are several isoforms of the gene in the soybean genome. The

fap

nc mutant has one

copy of a FATB gene deleted from its genome (Wilson et al., 2001a; Wilson et al., 2001b).

Alternatively, breeding programs based on recurrent selection schemes have given

rise to soybean lines N87-2122-4 and N90-2013, with 53 g kg

-1

and 60 g kg

-1

of palmitic

acid, respectively (Burton et al., 1994; Wilcox, 1994). Lines developed from this program

have lower palmitic acid level than the combination of the major low palmitic acid genes,

suggesting that modifiers genes are also involved in the reduced palmitic acid trait (Fehr et

al., 1991a; Rebetzke et al., 1998b).

Low linolenic acid germplasm

(25)

10

mutagenesis of cultivar ‘Century’. Genetic studies suggest that the recessive

fan

allele

controls the linolenic acid content in C1640 (Wilcox and Cavins, 1985 and 1987). Other

low linolenic acid lines developed by EMS mutagenesis, selection of natural mutations, or

x-ray irradiation (A5, PI361088B, PI123440, RG10, M-5, IL-8) each have a major gene

that is allelic to the

fan

gene in C1640 (Rahman et al., 1996; Rennie and Tanner, 1989 and

1991; Rennie et al., 1988; Stojšin et al., 1998a). Independent loci for reduced linolenic acid

content,

fan2

and

fan3,

were observed in A23 (60 g kg

-1

18:3) and in a line developed from

EMS treatment of A89-144003 (Fehr and Hammond, 1998; Fehr et al., 1992). In addition,

soybean lines KL-8 and M-24 each have an allele for low linolenic acid content that is an

independent locus from

fan

but allelic to

each other and they were designated

fanx

and

fanx

a

, respectively (Rahman and Takagi, 1997; Rahman et al., 1998). The allelic

relationships between

fanx

and

fan2

or

fan3

are unknown. In summary, there are at least

three major loci responsible for low linolenic acid content in soybean seed oil (

fan

and

fan2

and

fan3

). However, there could be up to 5 loci involved in conferring the low

linolenic acid seed trait if

fanx

and the

gene from N78-2245 are distinct loci.

In addition to the major genes, modifier genes for low linolenic acid content have

been observed in several studies (Fehr et al., 1992; Ross et al., 2000; Wilcox and Cavins,

1985). Therefore to obtain lines with 10 g kg

-1

linolenic acid content it is important to

select both on the three major loci and on additional minor genes (Ross et al., 2000).

(26)

11

Fad3 gene encodes this omega-3 desaturase. The reduced linolenic acid content in A5 was

caused by a partial or full deletion of this gene. Cosegregation studies between the absence

of a Fad3 RFLP fragment and linolenic acid content in a segregating population explained

67% of the variation observed for that trait (Byrum et al., 1997). Four microsomal FAD3

isoforms, FAD3-1a (FAD3B), FAD3-1b (FAD3A), FAD3-2a (FAD3C), and FAD3-2b

have been isolated in soybeans (Anai et al., 2005; Bilyeu et al., 2003). Following Bilyeu et

al. (2003) nomenclature, FAD3A and FAD3B have a 93% similarity at the cDNA level

and they have a ~77% similarity at the cDNA level with FADC. Also, FAD3-2a and

FAD3-2b are extremely similar to each other (Anai et al., 2005). The

fan

allele (

Fan

locus)

corresponds to the FAD3A isoform and different lines (J18, M5, A5) carrying different

alleles at that locus have mutations in different parts of the gene (Bilyeu et al., 2003; Anai

et al., 2005). In addition, the

Fanx

(M24) locus was demonstrated to correspond to the

FAD3B isoform (Anai et al, 2005).

(27)

12

lines Soyola, Satelite, and N97-3363-4 was about half of the amount observed in normal

soybean lines. This provides the likely molecular explanation of the low linolenic

phenotype of these lines (R.E. Dewey, personal communication 2002). The reduced

accumulation of FAD3A transcript could be caused by mutations in the promoter or

intragenic regulatory regions with no change in amino acid sequence; or by mutations in a

separate gene that regulates FAD3A expression. Should a high correlation between

individuals homozygous for the FAD3A gene and the low linolenic trait be observed, then

mutations in the regulatory region of the FAD3A gene represent the likely molecular basis

of the

fan

allele and these allele-specific primers could serve as effective marker-assisted

selection tools.

Correlated responses in agronomic traits

(28)

13

progenies that inherited the major

fap

nc from N87-2122-4, a low palmitic acid unadapted

homozygous line, when it was crossed to two high yielding normal palmitic acid lines

(Rebetzke et al., 1998b; Rebetzke et al., 2001) However, no differences in linoleic acid and

protein content were observed between progenies that inherited the major

fap

nc allele and

those that inherited the normal allele (Rebetzke et al., 1998a). Modifier genes detected in

these studies were negatively correlated with 18:1 content and positively correlated with

18:3 content but were not correlated with yield (Rebetzke et al., 1998a).

(29)

14

(30)

15

(31)

16

OBJECTIVES

(32)

17

OBJECTIVES

1)

Identify the specific

FATB

gene that is deleted in low palmitic acid soybean lines

homozygous for the

fap

nc mutation.

2)

Develop allele specific PCR markers corresponding to the

fap

nc gene.

3)

Estimate the amount of phenotypic variation in the 16:0, 18:0, 18:1, 18:2 and 18:3

composition that is explained by this locus in two adapted F4-derived populations

grown in replicated trials.

4)

Determine the root and leaf fatty acid composition of lines carrying

fap

nc,

fap

1, and

fan

mutations to test if these mutations have pleiotropic effects in other tissues.

5)

Generate allele specific markers for candidate genes causing the low linolenic acid

seed content phenotype in two lines carrying the

fan

(PI123440) locus.

(33)

18

REFERENCES

Anai, T., T. Yamada, T. Kinoshita, S.M. Rahman, and Y. Takagi. 2005. Identification of

corresponding genes for three low-α-linolenic acid mutants and elucidation of their

contribution to fatty acid biosynthesis in soybean seed. Plant Sci. 168:1615-1623.

Appelqvist, L.A. 1989. The chemical nature of vegetable oils, p. 22-37, In G. Röbbelen, et

al., eds. oil crops of the world: their breeding and utilization. McGraw-Hil, New

York, N.Y., 553p.

Beare-Rogers, J. 1995. Are saturated fatty acids essential in the diet? Nutr. Rev.

53:269-270.

Bilyeu, K.D., L. Palavalli, D.A. Sleper, and P.R. Beuselinck. 2003. Three microsomal

omega-3 fatty-acid desaturase genes contribute to soybean linolenic acid levels.

Crop Sci. 43:1833-1838.

Bilyeu, K.D., L. Palavalli, D.A. Sleper, and P.R. Beuselinck. 2005. Mutations in Soybean

Microsomal omega-3 fatty acid desaturase genes reduce linolenic acid

concentration in soybean seeds. Crop Sci. 45:1830-1836.

Bonaventure, G., J.J. Salas, M.R. Pollard, and J.B. Ohlrogge. 2003. Disruption of the

FATB gene in arabidopsis demonstrates an essential role of saturated fatty acids in

plant growth. Plant Cell. 15:1020–1033.

Browse, J., and C. Somerville. 1991. Glycerolipid synthesis: biochemistry and regulation.

Annu Rev Plant Physiol Plant Mol Biol. 42:467-506.

(34)

19

Burton, J.W., R.F. Wilson, and C.A. Brim. 1994. Registration of N79-2077-12 and

N87-2122-4, two soybean germplasm lines with reduced palmitic acid in seed oil. Crop

Sci. 34:313.

Byrum, J.R., A.J. Kinney, K.L. Stecca, D.J. Grace, and B.W. Diers. 1997. Alteration of the

omega-3 fatty-acid desaturase gene is associated with reduced linolenic acid in the

A5 soybean genotype. Theor. Appl. Genet. 94:356–359.

Cherrak, C.M., V.R. Pantalone, E.J. Meyer, D.L. Ellis, S.L. Melton, D.R. West, and J.R.

Mount. 2003. Low-palmitic, low-linolenic soybean development. J. Am. Oil Chem.

Soc. 80: 539-543.

Dormann, P.T., and J.B. Ohlrogge. 2000. Accumulation of palmitate in Arabidopsis

mediated by the acyl-acyl carrier protein thioesterase fatb1. Plant Physiol.

123:637-643.

Erickson, E.A., W. J. R., and J.F. Cavins. 1988. Inheritance of altered palmitic acid

percentage in two soybean mutants. J. Hered. 79:465-468.

Fehr, W.R., and E.G. Hammond. 1998. Reduced linolenic acid production in soybeans.

U.S. Patent # 5,850,030.

(35)

20

Fehr, W.R., G.A. Welke, E.G. Hammond, D.N. Duvick, and S.R. Cianzio. 1991b.

Inheritance of elevated palmitic acid content in soybean seed oil. Crop Sci.

31:1522-1524.

Fehr, W.R., G.A. Welke, E.G. Hammond, D.N. Duvick, and S.R. Cianzio. 1992.

Inheritance of Reduced Linolenic Acid Content In Soybean Genotype-A16 and

genotype-A17. Crop Sci. 32:903-906.

Frankel, E.N. 1980. Soybean oil flavor stability. Handbook of soy oil processing and

utilization American soybean association and American oil chemists society, St.

Louis.

Fretzen, M. 1993. Acyltransferase and triacylglycerols., p. 195-230, In T. S. Moore, ed.

Lipid Metabolism in Plants. CRC Press, Boca Raton.

Henderson, M.M. 1991. Correlations between fatty acid intake and cancer incidence, In G.

J. Nelson, ed. Health effects of dietary fatty acids. Am. Oil Chem. Soc.,

Champaign, IL.

Horejsi, T.F., W.R. Fehr, G.A. Welke, D.N. Duvick, E.G. Hammond, and S.R. Cianzio.

1994. Genetic control of reduced palmitate content in soybean. Crop

Sci.34:331-334.

(36)

21

Jones, A., H.M. Davies, and T.A. Voelker. 1995. Palmitoyl-Acyl carrier protein (ACP)

thioesterase and the evolutionary origin of plant acyl-ACP thioesterases. Plant Cell

7:359-371.

Kinoshita, T., S.M. Rahman, T. Anai, and Y. Takagi. 1998. Inter-locus relationship

between genes controlling palmitic acid contents in soybean mutants. Breeding

Sci. 48:377-381.

Lemieux, B.M.M., C. Somerville, and J. Browse. 1990. Mutants of Arabidopsis with

alternations in seed lipid fatty acid composition. Theor. Appl. Genet. 80:234-240.

Mounts, T., Warner K., List G.R., Kleiman R., Fehr W.R., Hammond E.G., and J.R.

Wilcox. 1988. Effect of altered fatty-acid composition on soybean oil stability. J.

Am. Oil Chem. Soc. 65:624-628.

Ndzana, X., W.R. Fehr, G.A. Welke, E.G. Hammond, D.N. Duvick, and S.R. Cianzio.

1994. Influence of reduced palmitate content on agronomic and seed traits of

soybean. Crop Sci. 34:646-649.

Nickell, A.D., J.R. Wilcox, and J.F. Cavins. 1991. Genetic relationships between loci

controlling palmitic and linolenic acids in soybean. Crop Sci. 31:1169-1171.

Ohlrogge, J.B., and J.G. Jaworski. 1994. Regulation of fatty acid synthesis. Annu Rev

Plant Physiol Plant Mol Biol. 48:109-136.

(37)

22

Primono, V. 2000. Inheritance and stability of palmitic acid alleles in soybeans (Glycine

max L Merr.). Masters Thesis, Department of Plant Agriculture, University of

Guelph, Guelph, Ontario, Canada.

Primono, V.S., D.E. Falk, G.R. Ablett, J.W. Tanner, and I. Rajcan. 2002. Inheritance and

interaction of low palmitic and low linolenic soybean. Crop Sci. 42:31-36.

Rahman, S.M., T. Kinoshita, T. Anai, and Y. Takagi. 1996. Genetic analysis of palmitic

acid content using two soybean mutants. Breeding Sci. 46:343-347.

Rahman, S.M., and Y. Takagi. 1997. Inheritance of reduced linolenic acid content in

soybean seed oil. Theor. Appl. Genet. 94:299-302.

Rahman, S.M., T. Kinoshita, T. Anai, S. Arima, and Y. Takagi. 1998. Genetic

relationships of soybean mutants for different linolenic acid contents. Crop Sci.

38:702–706.

Rebetzke, G.J., J.W. Burton, T.E. Carter, and R.F. Wilson. 1998a. Changes in agronomic

and seed characteristics with selection for reduced palmitic acid content in soybean.

Crop Sci. 38:297-302.

Rebetzke, G.J., J.W. Burton, T.E.J. Carter, and R.F. Wilson. 1998b. Genetic Variation for

Modifiers Controlling Reduced Saturated Fatty Acid content in Soybean. Crop Sci.

38:303-308.

(38)

23

Rennie, B.D., and J.W. Tanner. 1989. Genetic analysis of low linolenic acid levels in the

line PI 123440. Soybean Genet. Newsl. 16:25–26.

Rennie, B.D., and J.W. Tanner. 1991. New allele at the fan locus in the soybean line A5.

Crop Sci. 31:297–301.

Rennie, B.D., J. Zilka, M.M. Cramer, and R.I. Buzzell. 1988. Genetic analysis of low

linolenic acid levels in the soybean line PI 361088B. Crop Sci. 28:655–657.

Ross, A.J., W.R. Fehr, G.A. Welke, and S.R. Cianzio. 2000. Agronomic and seed traits of

1%-linolenate soybean genotypes. Crop Sci 40:383-386.

Röbbelen, G. 1982. Improvement of oil-seed and industrial crops by induced mutations:

proceedings of an advisory group meeting on the use of induced mutations for the

improvement of oil-seed and other industrial crops / organized by the joint

FAO/IAEA division of isotope and radiation applications of atomic energy for food

and agricultural development, Vienna, Austria. 17 to 21 November 1980.

International atomic energy agency; UNIPUB, New York, N.Y. 353p.

Schnebly, S.R., W.R. Fehr, G.A. Welke, E.G. Hammond, and D.N. Duvick. 1994.

Inheritance of reduced and elevated palmitate in mutant lines of soybean. Crop Sci.

34:829-833.

(39)

24

Stojšin, D., G.R. Ablett, B.M. Luzzi, and J.W. Tanner. 1998a. Use of gene substitution

values to quantify partial dominance in low palmitic acid soybean. Crop Sci.

38:1437–1441.

Stojšin, D., B.M. Luzzi, G.R. Ablett, and J.W. Tanner. 1998b. Inheritance of low linolenic

acid level in the soybean line RG10. Crop Sci 38:1441-1444.

Stoltzfus, D.L., F. W.R., and G.A. Welke. 2000. Relationship of elevated palmitate to

soybean seed traits. Crop Sci. 40:52-54.

Takagi, Y., S.M. Rahman, H. Joo, and T. Kawakita. 1995. Induction of genetic variation

irradiation. Biosci. Biotech. Biochem. 59:1778–1779.

Walker, J.B., W.R. Fehr, G.A. Welke, E.G. Hammond, D.N. Duvick, and S.R. Cianzio.

1998. Reduced-linolenate content associations with agronomic and seed traits of

soybean. Crop Sci. 38:352-355.

White, P.J., and L.A. Miller. 1988. Oxidative stabilities of low-linolenate, high-stearate

and common soybean oils. J. Am. Oil Chem. Soc. 65:1334-1338.

Wilcox, J.R., A.D. Nickell, and J.F. Cavins. 1993. Relationships between the fan gene and

agronomic traits in osybean. Crop. Sci. 33:87-89.

Wilcox, J.R., and J.F. Cavins. 1985. Inheritance of low linolenic acid content of the seed

oil of a mutant in Glycine max. Theor. Appl. Genet. 71:74-78.

Wilcox, J.R., and J.F. Cavins. 1987. Gene symbol assigned for linoleic acid mutant in

soybean. J. Hered. 78:410.

(40)

25

Wilson, R.F. 1981. Root lipid composition and metabolism in genetic male-sterile

soybeans. Crop Sci. 21:69-73.

Wilson, R.F., T.C. Marquardt, W.P. Novitzky, J.W. Burton, J.R. Wilcox, and R.E. Dewey.

2001a. Effect of alleles governing 16:0 concentration on glycerolipid composition

in developing soybeans. J. Am. Oil Chem. Soc. 78:329-334.

Wilson, R.F., T.C. Marquardt, W.P. Novitzky, J.W. Burton, J.R. Wilcox, A.J. Kinney, and

R.E. Dewey. 2001b. Metabolic mechanism associates with alleles governing the

16:0 concentration of soybean oil. J. Am. Oil Chem. Soc. 78:335-340.

Wilson, R.F., J.W. Burton, W.P. Novitzky, and R.E. Dewey. 2001c. Current and future

innovations in soybean (Glycine max L. Merr.) oil composition. J. Oleo Sci. 50:

353-358.

Yadav, N.S. 1996. Genetic Modification of soybean quality, In D.P.S. Verma and R.C.

Shoemaker, eds. Soybean: genetics, molecular biology and biotechnology. CAB

International, Wallingford, UK; Tucson, AZ. 270p.

(41)

26

CHAPTER ONE:

Cloning and Sequence Analysis of the

GmFAT1b

,

GmFAT2a

and

GmFAD3A

cDNAs.

INTRODUCTION

Several steps in the biosynthetic pathway of fatty acids in soybeans plants could

affect the palmitic and linolenic acid concentration in triacylglycerols (TAG). In the case

of low palmitic acid mutants, changes in activity or substrate specificity in the enzymes

3-ketoacyl-ACP synthetase II (KAS II), 16:0-ACP thioesterase, lysophosphatidic acid

acyltransferase, glycerol-3-phosphate acyltransferase and diacylglycerol acyl transferase

could be responsible for their phenotype. Nevertheless a biochemical study comparing

C1726 (

fap

1

fap

1),

N79-2077-12 (

fap

nc

fap

nc

) and Dare found no evidence that glycerolipid

acyltransferase activity and the biosynthetic steps after the formation of acyl-CoA were

altered in these lines. Instead, their TAG composition was related to the amount of 16:0

produced in the plastids (Wilson et al., 2001a; Wilson et al., 2001b). Northern analysis

revealed that

fap

nc

fap

nc

genotypes have reduced accumulation of transcripts corresponding

to a 16:0-ACP thioesterase (FATB) gene but no differences were defected in transcript

accumulation for genes encoding 18:1-ACP thioesterase (FATA), and 18:0-ACP

desaturase (Wilson et al., 2001b). No differences in transcript accumulation for

fap

1

fap

1

(42)

27

thioesterase gene are present in the soybean genome, one of which is deleted in

fap

nc

fap

nc

genotypes (Wilson et al., 2001c).

The soybean genome is believed to have been duplicated on two different

occasions during its evolution, creating the possibility to have two, three or four different

forms called isoforms of a particular gene. The second duplication event is predicted to be

very recent in evolutionary terms (Shoemaker et al., 1996). This could explain why

isoforms of soybean genes found in its genome tend to be highly identical at their sequence

level. For instance there are four FATB1 isoforms in soybean:

GmFATB1a

,

GmFATB1b

,

GmFATB2a,

and

GmFATB2b

.

GmFATB1a

is deleted in lines carrying the

fap

nc

mutation

,

such as N97-3681-11 and N97-3708-13, and specific markers were developed for use in a

marker-assisted breeding program. The nucleotide sequence of the genomic isoforms a and

b of the FATB1 gene (

GmFATB1a

and

GmFATB1b)

shares over 96% sequence identity

between them; also approximately 73% nucleotide sequence identity is shared between

either

GmFATB1a

or

GmFATB1b

and the

GmFATB2a

sequence. The partial sequences

information for

GmFATB2b

suggests that this sequence is approximately 95% identical to

GmFATB2a

(Cardinal et al., 2006). According to the model of soybean genome evolution,

our hypothesis is that the initial duplication event gave rise to the

GmFATB1

and

GmFATB2

genes, with the later duplication being responsible of the

GmFATB1a

vs.

GmFATB1b

and

GmFATB2a

vs.

GmFATB2b

isoforms.

(43)

GmFAD3-28

(44)

29

regulatory region of the FAD3A gene represent the likely molecular basis of the

fan

allele

and allele-specific primers could serve as effective marker-assisted selection tools.

Due to the high homology observed between the

GmFATB1a

versus

GmFATB1b

cDNAs and the

GmFAD3A

versus

GmFAD3B

cDNAs, care must be taken to recognize

those few polymorphic regions characteristic for each isoform and to develop primers to

specifically amplify the isoform of interest. Once such specific primers are developed it is

possible to compare if there are any polymorphisms in the sequences amplified among

parental lines in mapping populations segregating for a particular low palmitic or low

linolenic phenotype. Should a polymorphism be found in the same isoform in different

parental lines, this information could be used to develop a molecular marker to enable

association and analysis with a particular fatty acid phenotype. For example, if a

polymorphism leads to the alteration of a restriction endonuclease cleavage site, a CAPS

(Cleaved Amplified Polymorphic Sequences) marker could be developed to genotype

individuals in a segregating population.

The main objective of the research reported here was to determine the nucleotide

sequence of the

GmFATB1b

,

GmFATB2a

and

GmFAD3A

cDNAs from six parental lines

that were used to develop populations to map the

fap

1

,

fap

nc

and

fan

loci. Polymorphisms

(45)

30

MATERIALS AND METHODS

Soybean lines

The lines used in this study were four high yielding normal lines: Brim, Corsica,

Anand and Boggs, and lines N97-3708-13, N97-3681-11 (Burton et al., 1994; Anand et al.,

2001; Brown et al., 2000; Kentworthy, 1996). N97-3681-11, N97-3708-13 and the cultivar

‘Satelite’ are sister lines that were derived from different F3 plant selections from the cross

‘Soyola’ x {‘Brim’(2) x [N88-431(2) x (N90-2013 x C1726)]}. Line N88-431 was selected

from the cross N88-1299 x N82-2037. N84-1299 was a selection from the first cycle of a

high protein recurrent selection population (Holbrook et al, 1989). N82-2037 had Gasoy17

as its maternal parent and N77-940 as the paternal parent. C1726 is a reduced palmitic acid

selection from EMS treated ‘Century ’ and is homozygous for the

fap

1

mutation (Wilcox

and Cavins, 1990). N90-2013 is a reduced palmitic acid selection from the cross PI123,440

x N79-2077-12 (Burton et al., 1994). ‘Soyola’ is a low linolenic acid line (Burton et al.,

2004). N97-3681-11 and N97-3708-13 are F4-derived lines and are assumed homozygous

for the low palmitic

fap

nc

mutant allele from N79-2077-12, the low palmitic

fap

1

mutant

(46)

31

Amplification and sequence analysis of full length cDNAs

Total RNA was isolated from the leaves of the lines in the 3

rd

trifoliate stage. The

extraction was perform with TRIzol

®

Reagent following the manufacter’s protocol

(Invitrogen, Carlsbad, CA). After this extraction the RNA was quantified in a

spectophotometer, diluted and run in an agarose gel with phenol and ethidium bromide.

Poly A-RNA was recovered using an oligo-dt(12-18) primer along with a Superscript II

Reverse Transcriptase™ (Invitrogen™, Carlsbad, CA) to synthesize the first strand of the

full-length cDNA. Primers specific for

GmFAT1b

,

GmFAT2a

and

GmFAD3A

were

designed and used to amplify each isoform, from the 1

st

strand cDNA. The primer

sequences used where: 5’-taccctacaagctgccgtag-3’ and 5’-cccccttacccaccaaagta-3’

(

GmFATB1b

); 5’-gtaaggcgtagggggttgtt-3’ and 5’-acaccaagcagctgcataac-3’ (

GmFATB2a

),

and 5’-gcaaggttaaagacacaaag-3’ and 5’-cattaaactcatcgatcgatcttagg-3’ (

GmFAD3A

).

The amplification was carried out using standard reaction conditions with Expand

High Fidelity Taq polymerase (Roche Applied Science, Indianapolis, IN) in a thermal

(47)

32

purified PCR product was run in a 0.8% agarose gel in 1%TAE. The purified PCR product

was ligated to a TA or TOPO TA cloning

®

vector pCR2.1 (Invitrogen

, Carlsbad, CA),

and transformed into a INVaF’ or TOP10 cell per manufacturer’s instructions using 10 uL

of the ligation reaction. Transformed cells were plated on LB agar with ampicilin and

X-gal. Four white colonies were selected for each cloning event and the DNA was recovered

with a miniprep kit (Qiagen

, Valencia, CA). Miniprep DNA with a confirmed insert was

sequenced at the Iowa State Facility using primers R1 and U (http://www.dna.iastate.edu/).

The nucleic acid sequences were analyzed and aligned using Vector NTI Advance

10.1

software (Invitrogen

, Carlsbad, CA).

RESULTS AND DISCUSSION

(48)

33

nucleic acid and therefore would not alter the enzyme activity. Because this polymorphism

does not alter a restriction site, it could not be used to generate a facile molecular marker.

A polymorphism in a nearby intron, however, was subsequently found by Dr. Dewey’s lab

that was useful to develop a CAPS marker and used for association mapping (see chapter

four).

Another interesting mutation was located at the cDNA level at position 625,

where there is an A in Anand, Corsica, Boggs, and Brim, and a gap for

N97-3681-11/N97-3708-13. If repeatable, this single base pair deletion would alter the reading frame and thus

render the gene non functional. Although this polymorphism was typically not found in

cDNA sequencing runs in the

GmFAD3A

gene from Satelite or Soyola, in one case an

identical polymorphisms was observed from a FAD3A Satelite gene (R. Dewey personal

communication). Therefore, re-examination of this potential polymorphism in

N97-3681-11 and N97-3708-13 is warranted.

(49)

34

Figure 1 Nucleotide sequence of the soybean Fatb1b cDNA in lines Anand, Brim, Boggs,

Corsica, N97-3681-11 and N97-3708-13.

(50)

35

(51)

36

Figure 1 continue

(52)

37

Figure 1 continue

1201 1300 ANAND Fatb1b TGAGGGGCAGGACTGAGTGGAGGCCCAAACCTATGAACAACATTGGTGTTGTGAACCAGGTTCCAGCAGAAAGCACCTAAGATTTTGAAATGGTTAACGG BRIM Fatb1b TGAGGGGCAGGACTGAGTGGAGGCCCAAACCTATGAACAACATTGGTGTTGTGAACCAGGTTCCAGCAGAAAGCACCTAAGATTTTGAAATGGTTAACGG BOGGS Fatb1b TGAGGGGCAGGACTGAGTGGAGGCCCAAACCTATGAACAACATTGGTGTTGTGAACCAGGTTCCAGCAGAAAGCACCTAAGATTTTGAAATGGTTAACGG CORSICA Fatb1b TGAGGGGCAGGACTGAGTGGAGGCCCAAACCTATGAACAACATTGGTGTTGTGAACCAGGTTCCAGCAGAAAGCACCTAAGATTTTGAAATGGTTAACGG N97-11 Fatb1b TGAGGGGCAGGACTGAGTGGAGGCCCAAACCTATGAACAACATTGGTGTTGTGAACCAGGTTCCAGCAGAAAGCACCTAAGATTTTGAAATGGTTAACGG N97-13 Fatb1b TGAGGGGCAGGACTGAGTGGAGGCCCAAACCTATGAACAACATTGGTGTTGTGAACCAGGTTCCAGCAGAAAGCACCTAAGATTTTGAAATGGTTAACGG 1301 1400 ANAND Fatb1b TTGGAGTTGCATCAGTCTCCTTGCTATGTTTAGACTTATTCTGGCCCCTGGGGAGAGTTTTGCTTGTGTCTGTCCAATCAATCTACATATCTTTATATCC BRIM Fatb1b TTGGAGTTGCATCAGTCTCCTTGCTATGTTTAGACTTATTCTGGCCCCTGGGGAGAGTTTTGCTTGTGTCTGTCCAATCAATCTACATATCTTTATATCC BOGGS Fatb1b TTGGAGTTGCATCAGTCTCCTTGCTATGTTTAGACTTATTCTGGCCCCTGGGGAGAGTTTTGCTTGTGTCTGTCCAATCAATCTACATATCTTTATATCC CORSICA Fatb1b TTGGAGTTGCATCAGTCTCCTTGCTATGTTTAGACTTATTCTGGCCCCTGGGGAGAGTTTTGCTTGTGTCTGTCCAATCAATCTACATATCTTTATATCC N97-11 Fatb1b TTGGAGTTGCATCAGTCTCCTTGCTATGTTTAGACTTATTCTGGCCCCTGGGGAGAGTTTTGCTTGTGTCTGTCCAATCAATCTACATATCTTTATATCC N97-13 Fatb1b TTGGAGTTGCATCAGTCTCCTTGCTATGTTTAGACTTATTCTGGCCCCTGGGGAGAGTTTTGCTTGTGTCTGTCCAATCAATCTACATATCTTTATATCC 1401 1433

(53)

38

Figure 2. Nucleotide Sequence of the soybean

GmFATB2a

cDNA in lines Anand, Brim,

Boggs, Corsica,

N97-3681-11 and N97-3708-13.

(54)

39

(55)

40

Figure 2. continue

(56)

41

Figure 2. continue

(57)

42

Figure 3. Nucleotide sequence of the soybean isoform

GmFAT3A

in lines Anand, Brim,

Boggs, Corsica, N97-3681-11 and N97-3708-13.

(58)

43

(59)

44

Figure 3. continue

601 700 ANAND FAD3A TTCCCACCCAGTGAGAGAAAGGGAATAGCAATATCAACACTGTGTTGGGTTACCATGTTTTCTATGCTTATCTATCTCTCCTTCATAACTAGTCCAGTTC BRIM FAD3A TTCCCACCCAGTGAGAGAAAGGGAATAGCAATATCAACACTGTGTTGGGTTACCATGTTTTCTATGCTTATCTATCTCTCCTTCATAACTAGTCCAGTTC BOGGS FAD3A TTCCCACCCAGTGAGAGAAAGGGAATAGCAATATCAACACTGTGTTGGGTTACCATGTTTTCTATGCTTATCTATCTCTCCTTCATAACTAGTCCAGTTC CORSICA FAD3A TTCCCACCCAGTGAGAGAAAGGGAATAGCAATATCAACACTGTGTTGGGTTACCATGTTTTCTATGCTTATCTATCTCTCCTTCATAACTAGTCCAGTTC N97-11 FAD3A TTCCCACCCAGTGAGAGAAAGGGA-TAGCAATATCAACACTGTGTTGGGTTACCATGTTTTCTATGCTTATCTATCTCTCCTTCATAACTAGTCCAGTTC N97-13 FAD3A TTCCCACCCAGTGAGAGAAAGGGA-TAGCAATATCAACACTGTGTTGGGTTACCATGTTTTCTATGCTTATCTATCTCTCCTTCATAACTAGTCCAGTTC 701 800 ANAND FAD3A TATTGCTCAAGCTCTATGGAATTCCATATTGGATATTTGTTATGTGGCTGGACTTTGTCACATACTTGCATCACCATGGTCATCATCAGAAACTGCCTTG BRIM FAD3A TATTGCTCAAGCTCTATGGAATTCCATATTGGATATTTGTTATGTGGCTGGACTTTGTCACATACTTGCATCACCATGGTCATCATCAGAAACTGCCTTG BOGGS FAD3A TATTGCTCAAGCTCTATGGAATTCCATATTGGATATTTGTTATGTGGCTGGACTTTGTCACATACTTGCATCACCATGGTCATCATCAGAAACTGCCTTG CORSICA FAD3A TATTGCTCAAGCTCTATGGAATTCCATATTGGATATTTGTTATGTGGCTGGACTTTGTCACATACTTGCATCACCATGGTCATCATCAGAAACTGCCTTG N97-11 FAD3A TATTGCTCAAGCTCTATGGAATTCCATATTGGATATTTGTTATGTGGCTGGACTTTGTCACATACTTGCATCACCATGGTCATCATCAGAAACTGCCTTG N97-13 FAD3A TATTGCTCAAGCTCTATGGAATTCCATATTGGATATTTGTTATGTGGCTGGACTTTGTCACATACTTGCATCACCATGGTCATCATCAGAAACTGCCTTG 801 900 ANAND FAD3A GTATCGCGGCAAGGAATGGAGTTATTTAAGAGGTGGTCTCACAACTGTGGATCGTGACTATGGTTGGATCAATAACATTCACCATGACATTGGCACCCAT BRIM FAD3A GTATCGCGGCAAGGAATGGAGTTATTTAAGAGGTGGTCTCACAACTGTGGATCGTGACTATGGTTGGATCAATAACATTCACCATGACATTGGCACCCAT BOGGS FAD3A GTATCGCGGCAAGGAATGGAGTTATTTAAGAGGTGGTCTCACAACTGTGGATCGTGACTATGGTTGGATCAATAACATTCACCATGACATTGGCACCCAT CORSICA FAD3A GTATCGCGGCAAGGAATGGAGTTATTTAAGAGGTGGTCTCACAACTGTGGATCGTGACTATGGTTGGATCAATAACATTCACCATGACATTGGCACCCAT N97-11 FAD3A GTATCGCGGCAAGGAATGGAGTTATTTAAGAGGTGGTCTCACAACTGTGGATCGTGACTATGGTTGGATCAATAACATTCACCATGACATTGGCACCCAT N97-13 FAD3A GTATCGCGGCAAGGAATGGAGTTATTTAAGAGGTGGTCTCACAACTGTGGATCGTGACTATGGTTGGATCAATAACATTCACCATGACATTGGCACCCAT 901 1000 ANAND FAD3A GTTATTCACCATCTTTTCCCTCAAATTCCTCATTATCACCTCGTTGAAGCGACACAAGCAGCAAAATCAGTTCTTGGAGAGTATTACCGTGAGCCAGAAA BRIM FAD3A GTTATTCACCATCTTTTCCCTCAAATTCCTCATTATCACCTCGTTGAAGCGACACAAGCAGCAAAATCAGTTCTTGGAGAGTATTACCGTGAGCCAGAAA BOGGS FAD3A GTTATTCACCATCTTTTCCCTCAAATTCCTCATTATCACCTCGTTGAAGCGACACAAGCAGCAAAATCAGTTCTTGGAGAGTATTACCGTGAGCCAGAAA CORSICA FAD3A GTTATTCACCATCTTTTCCCTCAAATTCCTCATTATCACCTCGTTGAAGCGACACAAGCAGCAAAATCAGTTCTTGGAGAGTATTACCGTGAGCCAGAAA N97-11 FAD3A GTTATTCACCATCTTTTCCCTCAAATTCCTCATTATCACCTCGTTGAAGCGACACAAGCAGCAAAATCAGTTCTTGGAGAGTATTACCGTGAGCCAGAAA N97-13 FAD3A GTTATTCACCATCTTTTCCCTCAAATTCCTCATTATCACCTCGTTGAAGCGACACAAGCAGCAAAATCAGTTCTTGGAGAGTATTACCGTGAGCCAGAAA 1001 1100 ANAND FAD3A GATCTGCACCATTACCATTTCATCTAATAAAGTATTTAATTCAGAGTATGAGACAAGACCACTTCGTAAGTGACACTGGAGATGTGGTTTATTATCAGAC BRIM FAD3A GATCTGCACCATTACCATTTCATCTAATAAAGTATTTAATTCAGAGTATGAGACAAGACCACTTCGTAAGTGACACTGGAGATGTGGTTTATTATCAGAC BOGGS FAD3A GATCTGCACCATTACCATTTCATCTAATAAAGTATTTAATTCAGAGTATGAGACAAGACCACTTCGTAAGTGACACTGGAGATGTGGTTTATTATCAGAC CORSICA FAD3A GATCTGCACCATTACCATTTCATCTAATAAAGTATTTAATTCAGAGTATGAGACAAGACCACTTCGTAAGTGACACTGGAGATGTGGTTTATTATCAGAC N97-11 FAD3A GATCTGCACCATTACCATTTCATCTAATAAAGTATTTAATTCAGAGTATGAGACAAGACCACTTCGTAAGTGACACTGGAGATGTGGTTTATTATCAGAC N97-13 FAD3A GATCTGCACCATTACCATTTCATCTAATAAAGTATTTAATTCAGAGTATGAGACAAGACCACTTCGTAAGTGACACTGGAGATGTGGTTTATTATCAGAC 1101 1179

(60)

45

REFERENCES

Anai, T., T. Yamada, T. Kinoshita, S.M. Rahman, and Y. Takagi. 2005. Identification of

corresponding genes for three low-α-linolenic acid mutants and elucidation of their

contribution to fatty acid biosynthesis in soybean seed. Plant Sci. 168:1615-1623.

Anand, S.C, T. Newman, J. Fisher. 2001. Anand soybean. Crop Sci. 41(3):919.

Bilyeu, K.D., L. Palavalli, D.A. Sleper, and P.R. Beuselinck. 2003. Three microsomal

omega-3 fatty-acid desaturase genes contribute to soybean linolenic acid levels.

Crop Sci. 43:1833-1838.

Bilyeu, K.D., L. Palavalli, D.A. Sleper, and P.R. Beuselinck. 2005. Mutations in soybean

microsomal omega-3 fatty acid desaturase genes reduce linolenic acid

concentration in soybean seeds. Crop Sci. 45:1830-1836.

Brown, H.R., R.S. Hussey, D.V. Phillips, E.D. Wood, G.B. Rowan, S.I. Finnerty. 2000.

Boggs soybean. Crop Sci. 40(1):295.

Burton, J.W., T.E. Carter, Jr., E.B. Huie. 1994. Brim soybean. Crop Sci. 34(1):301.

Cardinal, A.J., J.W. Burton, A.M. Camacho, J.H. Yang, R.F. Wilson, and R.E. Dewey.

2006. Molecular analysis of soybean lines with low palmitic acid content in the oil.

Submitted to Crop Sci.

Kenworthy, W.J. 1996. Corsica soybean. Crop Sci. 36(4):1078.

(61)

46

Wilson, R.F., T.C. Marquardt, W.P. Novitzky, J.W. Burton, J.R. Wilcox, and R.E. Dewey.

2001a. Effect of alleles governing 16:0 concentration on glycerolipid composition

in developing soybeans. J. Am. Oil Chem. Soc. 78:329-334.

Wilson, R.F., T.C. Marquardt, W.P. Novitzky, J.W. Burton, J.R. Wilcox, A.J. Kinney, and

R.E. Dewey. 2001b. Metabolic Mechanism Associates with alleles governing the

16:0 Concentration of soybean oil. J. Am. Oil Chem. Soc. 78:335-340.

(62)

47

CHAPTER TWO:

Molecular analysis of soybean lines with low palmitic acid content in the seed oil.

Andrea J. Cardinal, Joe Burton, Ana Maria Camacho, Ji Hyung Yang, R.F. Wilson, and

Ralph Dewey

1

(In the format appropriate for submission to Crop Science)

(63)

48

Molecular analysis of soybean lines with low palmitic acid content in the seed oil.

Andrea J. Cardinal*

1

, Joe Burton

2

, Ana Maria Camacho

1

, Ji Hyung Yang

1

, R.F. Wilson

2

,

and Ralph Dewey

1

1

Department of Crop Science, North Carolina State University, Raleigh. NC 27695

2

USDA-ARS, 3127 Ligon St, Plant Sci. Res., Raleigh, NC 27607

This project was funded by the United Soybean Board.

Received ___________. *Corresponding author (

andrea_cardinal@ncsu.edu

).

Abbreviations: TAGs, triacylglycerols; KAS II, 3-ketoacyl-ACP synthetase II; FATB,

16:0-ACP thioesterase gene; FATA, 18:1-ACP thioesterase gene; 16:0, palmitic acid;

18:0, stearic acid; 18:1, oleic acid; 18:2, linoleic acid; 18:3, linolenic acid; BLUP , best

linear unbiased predictor.

keywords: low palmitic acid, FATB gene, soybean, allele specific primers, molecular

(64)

49

ABSTRACT

Palmitic acid is the major saturated fatty acid found in soybean oil, accounting for

approximately 11% of the seed oil content. Reducing the palmitic acid levels of the oil is

desirable because of the negative health effects specifically associated with this fatty

acid. One of the genetic loci known to reduce the seed palmitate content in soybean is

fap

nc

. Previous studies indicated that

fap

nc

is associated with a deletion in a gene

(designated

FATB) encoding 16:0-ACP thioesterase activity. In this report, we isolated

full length cDNAs of three of the four unique

FATB genes expressed in soybean and

show that the isoform designated GmFATB1a represents the specific gene deleted in lines

possessing the

fap

nc

locus. Allele specific primers corresponding to

GmFATB1a were

used to genotype plants from two F4-derived populations that were segregating for fap

nc

.

The

GmFATB1a-specific markers were effective in accounting for 62 to 70% of the

genotypic variation in palmitate content in the two populations studied. Because the

markers developed in this study are 100% linked to the locus of interest, they should be

particularly useful in marker-assisted selection programs designed to lower the palmitic

(65)

50

INTRODUCTION

Soybean (Glycine max (L.) Merr) is an important crop that provides 57.7% of the

world’s oilseed production (US Department of Agriculture statistics, 2003). Soybean oil

is mostly composed of triacylglycerols (TAGs). The relative composition of saturated and

unsaturated fatty acids in the seed TAGs determines the quality of an oil. Palmitic acid

(16:0) is the predominant saturated fatty acid in soybean oil. Oil from typical soybean

cultivars contains 110 to 120 g kg

-1

palmitic acid (Burton et al., 1994; USDA-ARS,

National Genetics Resources Program). Consumption of oils with reduced palmitic acid

content is desirable to reduce the health risks of coronary diseases and breast, colon, and

prostate cancer properties associated with this fatty acid (Hu et al., 1997; Henderson,

1991).

Soybean oil quality can be improved through genetic alteration of the plants.

Several lines with reduced palmitic acid concentration have been developed by

mutagenesis. C1726 (85.4 g kg

-1

16:0) and ELLP2 (71.4 g kg

-1

16:0) were developed by

ethyl-methyl sulfonate (EMS) mutagenesis of the cultivars ‘Century’ and ‘Elgin87’,

respectively. A22 (78.4 g kg

-1

16:0) was developed by N-nitroso-N-methyl urea

mutagenesis of A1937, and J3 (57.4 g kg

-1

16:0) was developed from X-radiation of

cultivar ‘Bay’ (Fehr et al., 1991; Stoj

š

in et al, 1998; Wilcox and Cavins, 1990; Rahman et

al, 1996). In addition, one natural mutation was discovered in line N79-2077 (64 g kg

-1

16:0) and its derived line N79-2077-12 from the fifth cycle of recurrent selection for high

(66)

51

palmitic acid in these lines were given different names: fap1 (in C1726),

fap3 (in A22)

,

fap

nc

(in N79-2077), fap

*

or

fapx (in ELLP2),

and

sop1 (in J3) (Schnebly et al., 1994;

Stoj

š

in et al, 1998; Wilcox and Cavins, 1990; Kinoshita et al. 1998; Primono et al.,

2002). Of those five alleles, three are at independent loci from each other (fap1, fap3, and

fap*) (Schnebly et al., 1994; Stoj

š

in et al, 1998; Wilcox et al, 1994; Kinoshita et al. 1998;

Primomo, 2000; Primono et al., 2002). fap

nc

is allelic to

fap3 (Primomo, 2000; Primono

et al., 2002) and sop1 is independent of the

fap1 locus but its allelic relationship to the

other loci is unknown (Kinoshita et al., 1998).

In addition to the major genes mentioned above, minor/modifier genes influence

the low palmitic acid content in soybean oil (Stoj

š

in et al, 1998, Rebetzke et al., 2001, Li

et al., 2002; Horejsi et al, 1994; Rebetzke et al., 1998b). Rebetzke et al. (1998b) observed

heritability estimates for 16:0 content on a plot basis between 0.37 and 0.73 and on an

entry-mean basis between 0.83 and 0.96. They concluded that selection based on

evaluations in a few environments for both major and minor genes would be successful.

Correlated changes in the other saturated and unsaturated fatty acids in the

soybean oil have been observed in low palmitic acid lines that carry the major and minor

genes described above. For example, when lines homozygous for the fap

1

and

fap

3

alleles

(< 41.5 g kg

-1

16:0) were compared to normal lines (> 100 g kg

-1

16:0) derived from the

same population, the low palmitic acid lines tended to have reduced stearic acid (18:0),

and increased oleic acid (18:1), linoleic acid (18:2), and linolenic acid (18:3) contents

(67)

52

cross of N87-2122-4 to two high yielding normal palmitate lines had a 6 to 15%

reduction in stearic acid (Rebetzke et al., 1998b; Rebetzke et al., 2001) and a 4 to 10%

increase in oleic acid content in both crosses (Rebetzke et al., 1998a; Rebetzke et al.,

2001), and an increase in linolenic acid content in one cross (Rebetzke et al., 1998a). No

differences in linoleic acid were observed between progenies that inherited the major

fap

nc

allele and those that inherited the normal allele (Rebetzke et al., 1998a). However,

there was significant genetic variation within each major

fap

nc

group due to the

segregation of minor genes. Within these groups, there was a significant negative genetic

correlation between palmitate and oleate and a significant positive correlation between

palmitate and linolenate (Rebetzke et al., 1998a). Palmitate content in soybean oil was

negatively correlated with linoleate content and positively correlated with oleate content

in a population that was segregating for the fap

1

and fan loci (Nickell et al., 1991).

Several steps in the TAG biosynthetic pathway could affect the palmitate

concentration. In the case of low palmitic acid mutants changes in activity or substrate

specificity in 3-ketoacyl-ACP synthetase II (KAS II), 16:0-ACP thioesterase,

lysophosphatidic acid acyltransferase, glycerol-3-phosphate acyltransferase, or

diacylglycerol acyl transferase enzymes could be responsible for their phenotype. A

biochemical study comparing C1726 (fap1fap1),

N79-2077-12 (fap

nc

fap

nc

) and Dare

found no evidence that glycerolipid acyltransferase activity or the biosynthetic steps after

the formation of acyl-CoA were altered in these lines. The TAG composition of these

(68)

53

2001c). Northern analysis revealed that fap

nc

fap

nc

genotypes have reduced accumulation

of transcripts corresponding to a 16:0-ACP thioesterase (FATB) gene and no difference

in transcript accumulation for genes encoding 18:1-ACP thioesterase (FATA) or

18:0-ACP desaturase activities (Wilson et al., 2001b). No differences in transcript

accumulation for fap1fap1 genotypes were observed for any of the genes assayed (Wilson

et al., 2001b). Southern analysis using the FATB cDNA as a probe revealed that multiple

copies of the 16:0-ACP thioesterase gene are present in the soybean genome and that the

fap

nc

fap

nc

genotype has a deletion in one of those copies (Wilson et al., 2001a). It is not

known which of the FATB gene copies is deleted in the fap

nc

fap

nc

genotype, where in the

soybean genome these FATB genes are located and how much of the palmitate

phenotypic variation each isoform accounts for.

The objectives of this study are to: 1) identify the specific

FATB gene that is

deleted in low palmitic acid soybean lines homozygous for the fap

nc

mutation; 2) develop

allele specific PCR markers corresponding to this gene; and 3) estimate the amount of

phenotypic variation in the 16:0, 18:0, 18:1, 18:2 and 18:3 composition that is explained

Figure

Figure 1. Biosynthetic pathway of oil: de novo fatty acid biosynthesis. (Yadav 1996 and Ohlrogge and Jaworski1994)

Figure 1.

Biosynthetic pathway of oil: de novo fatty acid biosynthesis. (Yadav 1996 and Ohlrogge and Jaworski1994) p.30
Figure 2: Biosynthetic pathway of oil: Triacylglycerol assembly. (Yadav, 1996)

Figure 2:

Biosynthetic pathway of oil: Triacylglycerol assembly. (Yadav, 1996) p.31
Figure 3. continue

Figure 3.

continue p.59
Figure 1. Amino acid sequence alignment of the GmFATB1a, GmFATB1b and GmFATB2a predicted proteins of soybean

Figure 1.

Amino acid sequence alignment of the GmFATB1a, GmFATB1b and GmFATB2a predicted proteins of soybean p.82
Table 2: F test results for fatty acid components of root tissue from soybean lines 'Brim' and N97-11/N97-13 from a split-split-plot experiment grown in the NCSU phytotron at 22/18ºC and 26/22ºC in 2001, 2002 and 2004 analyzed with Proc Mixed

Table 2:

F test results for fatty acid components of root tissue from soybean lines 'Brim' and N97-11/N97-13 from a split-split-plot experiment grown in the NCSU phytotron at 22/18ºC and 26/22ºC in 2001, 2002 and 2004 analyzed with Proc Mixed p.107
Table 3: Least Squares Means for fatty acid concentrations in leaf tissue from soybean lines 'Brim' and N97-11/N97-13 from a split-split-plot experiment grown in the NCSU phytotron at 22/18ºC and 26/22ºC in 2001, 2002 and 2004

Table 3:

Least Squares Means for fatty acid concentrations in leaf tissue from soybean lines 'Brim' and N97-11/N97-13 from a split-split-plot experiment grown in the NCSU phytotron at 22/18ºC and 26/22ºC in 2001, 2002 and 2004 p.108
Table 5: Least Squares Means for fatty acid concentrations in root tissue from soybean lines 'Brim' and N97-11/N97-13 from a split-split-plot experiment grown in the NCSU phytotron at 22/18ºC and 26/22ºC in 2001, 2002 and 2004

Table 5:

Least Squares Means for fatty acid concentrations in root tissue from soybean lines 'Brim' and N97-11/N97-13 from a split-split-plot experiment grown in the NCSU phytotron at 22/18ºC and 26/22ºC in 2001, 2002 and 2004 p.109
Table 6: Difference of Least Square Means for fatty acid concentrations in root tissue from soybean lines 'Brim' and N97-11/N97-13 from a split-split-plot experiment grown in the NCSU phytotron at 22/18ºC and 26/22ºC in 2001, 2002 and 2004

Table 6:

Difference of Least Square Means for fatty acid concentrations in root tissue from soybean lines 'Brim' and N97-11/N97-13 from a split-split-plot experiment grown in the NCSU phytotron at 22/18ºC and 26/22ºC in 2001, 2002 and 2004 p.110
Table 1: Palmitic acid, stearic acid, oleic acid, linoleic acid, and linolenic acid content means of seed oil of lines homozygous fad3a fad3a  or  Fad3a Fad3a, and of lines heterozygous fad3aFad3a for the FAD3a allele, standard deviation of those means, di

Table 1:

Palmitic acid, stearic acid, oleic acid, linoleic acid, and linolenic acid content means of seed oil of lines homozygous fad3a fad3a or Fad3a Fad3a, and of lines heterozygous fad3aFad3a for the FAD3a allele, standard deviation of those means, di p.125

References

Updating...