Senior_Honors_Thesis_-_Final.docx

23 

Full text

(1)

Effects of Intermittent Preventive Therapy in pregnancy (IPTp) with Sulfadoxine-Pyrimethamine on the Maternal Carriage of Group B Streptococcus and Enterococcus faecalis

By

Sydney Puerto-Meredith

Senior Honors Thesis Department of Biology

University of North Carolina at Chapel Hill

04/03/2020

Approved:

______________________________ Dr. Meshnick, Thesis Advisor

Dr. Wolfgang Bergmeier, Reader

(2)

Abstract

Malaria is a parasitic infectious disease transmitted by the bite of infected mosquitoes

that is endemic to many parts of sub-Saharan Africa, including Malawi. Malaria infections during pregnancy can be harmful to the health outcomes of pregnant women and their fetuses, leading to low birth weights, maternal anemia, or stillbirth. To prevent and treat malaria infection during pregnancy and avert these poor health outcomes, the accepted course of treatment has been Intermittent Preventive Therapy in pregnancy (IPTp) with Sulfadoxine-Pyrimethamine (SP) from early in the second trimester until delivery. In recent years, the malaria parasite has grown resistant to SP and a new alternative drug, dihydroartemisinin-piperaquine (DP), has been introduced as an alternative. Paradoxically, although the malaria parasite has demonstrated increased resistance to SP in recent years, women who take SP during pregnancy and their babies continue to be protected against poor pregnancy and birth outcomes. Since SP is absorbed through the gut, this study examines if the protective effects of SP acts on the gut by reducing pathogen carriage and improving nutrient uptake. We focused on the effects of SP on two pathogens in particular, Streptococcus agalactiae (Group B Streptococcus, GBS) and

Enterococcus faecalis. Using extracted DNA from stool samples from women in Malawi (n=89), we investigated the presence of each pathogen using qPCR. We did not find a clear association between either drug and E. faecalis or GBS. Women at their second pregnancy (secundigravidae) had an increased likelihood of E. faecalis infection at baseline (pre-drug) compared to

(3)

Introduction

Improving poor maternal and infant health outcomes such as maternal anemia, low birthweight, preterm birth and stillbirth, is a global health priority [1]. The often complex etiology of these outcomes, however, makes them difficult to mitigate. Malaria infection during pregnancy has been recognized as a leading cause of these poor outcomes [2]. Malaria is a parasitic infectious disease transmitted by the bite of infected female Anopheles mosquitoes and is endemic to many parts of sub-Saharan Africa, including Malawi [3, 4].

(4)

To combat the parasite’s increased resistance to SP, dihydroartemisinin-piperaquine (DP) has been proposed as an alternative for IPTp however, unlike SP, DP has no known antibacterial properties. Despite widespread SP resistance, women who take IPTp-SP are associated with decreased risk of maternal anemia and low birth weight [8]. This protection is also seen in areas where malaria prevalence and SP resistance are low [9]. These observations suggest that there may be a malaria-independent beneficial route for IPTp-SP. Because SP is actively absorbed through the gut [6], it is possible that these protective mechanisms take place in the gut, by changing the gut microbiome and/or clearing enteric pathogens, which in turn may lead to better maternal nutrient uptake and fetal growth. Our group hypothesized that IPTp-SP changes the gut microbiome of pregnant Malawian women and decreases the carriage of enteric pathogens.

(5)

Despite increasing resistance in malaria against SP, the beneficial effect may function by clearing these two bacteria which would mitigate the commonly associated adverse health outcomes of malaria and account for the paradox between DP and SP. If we see a reduced prevalence of GBS and E. faecalis after SP treatment, then there would be a clinical implication for continuing use of SP as IPTp despite increased in resistance to malaria.

Methods

Study population

(6)

Stool Samples

Patients were scheduled for a minimum of three visits, over approximately 30 days apart. SP or DP were administered at enrollment, and in up to 4 more study visits (for a maximum of 5 study visits in total, depending on the gestational age at enrollment). Stool samples provided at enrollment were produced ≤24h prior to first drug dose administration and represent our pre-drug baseline samples; stools brought by our participants to follow-up antenatal visit were produced ≤24h before the second or third drug dose was administered. Some women did not bring stool samples at each visit, but all women received the drug as scheduled. The final visit stool sample for each participant was defined as the stool sample closest in timing to delivery and which was produced after a minimum of 3 drug doses. This cut-off was chosen because the greatest

protection against low birthweight associated with SP prophylaxis was observed after ≥3 doses and the WHO recommends this ≥3 dose regime be achieved during pregnancy in malaria-endemic countries [4].

DNA extraction

(7)

samples was performed with the Qubit dsDNA Broad Range kit (Cat # Q32853) and the Qubit 3.0 Fluorometer (Cat # Q33216).

E. faecalis and Group B Streptococcus (Streptococcus agalactiae) detection by quantitative polymerase chain reaction (qPCR)

Of the 105 women enrolled, we used stool samples from 89 women (43 women in the SP group, 45 women in the DP group), by excluding those who did not provide a baseline (pre-drug) sample [SI 1]. Our total number of stool samples used for downstream analyses was 309. The presence of E. faecalis and Group B Streptococcus (GBS, Streptococcus agalactiae) was

confirmed with quantitative polymerase chain reaction (qPCR) on an Applied Biosystems Viia 7 real-time PCR machine.

Table 1. Oligonucleotide primer and probe sequences for PCR

Target Organism Primer Sequence (5’-3’) Reference

Enterococcus Faecalis FaecalF CGCTTCTTTCCTCCCGAGT

15

FaecalR GCCATGCGGCATAAACTG

FaecalP 6FAM-CAATTGGAAA

GAGGAGTGGCGGACG-TAMRA

Group B Streptococcus StrepB-sipF ATCCTGAGACAACACTGACA 16

StrepB-sipR TTGCTGGTGTTTCTATTTTCA

StrepB-sip-probe 6FAM-ATCAGAAGAGTCATACTGCCACTTC-BHQ1

The primer and probes detailed in Table 1 were used with the following cycling

(8)

contained 6μl Bio-Rad iQ Multiplex Powermix, 0.55μl of water, and 4μl of DNA sample, 0.6 μl of each FaecalF and FaecalR primer at a final concentration of 0.5 μm, and 0.25 μl of FaecalP probe at a final concentration of 0.2 μm.

Precision and Limit of Detection for qPCR

Serial dilutions were made for both assays to determine the accuracy and precision of detection. In brief, serial dilutions of positive controls (known pure E. faecalis DNA donated by Prof. from Jonathan Hansen at UNC at Chapel Hill, and known pure Streptococcus agalactiae strain MNZ933from BEI Resources, catalog number NR-43896) were prepared. For GBS, our serial dilution ranged from 1 ng/μl to 0.0001 ng/μl. For E. faecalis, 7 serial dilutions were prepared ranging from 0.02 ng/μl to 2.0e-08 ng/μl from a 0.2 ng/μl positive control sample. The lowest concentration of our positive control for both pathogens (0.0001 ng/ul) was detected at a cycle of < 36 and thus we set our positive/detection cut-off at 35.99. Values with Cts >35.99 were not considered in the final analysis.

Definitions

We defined gravidity as the number of pregnancies our mothers have had, including the one in consideration in this study. Primigravidae are mothers at their first pregnancy (i.e. the pregnancy in the current study), secundigravidae are at their second pregnancy and multigravidae are at their third or more pregnancy.

(9)

Pathogen analyses were performed with STATA16. Differences in participant

characteristics at baseline by drug group were assessed using Chi-square (χ2) or Fisher’s exact tests. We evaluated associations between infections, drug and gravidity at each study visit independently with univariable or multivariable logistic regression, as appropriate. To determine the overall effect of drug and number of drug doses on enteric infections, we considered all the samples for each participant and used log binomial regression with generalized estimating equations by fitting an interaction term between the drug group and the number of drug doses received and gravidity. We investigated the relationship between pathogens and gravidity using univariable and multivariable linear regressions, at each study visit independently. To determine the overall effect of drug, number of received doses and infection on gravidity, we considered all the samples for each participant and used log binomial regression with generalized estimating equations by fitting an interaction term between the drug group, number of drug doses, and gravidity. We visualized the models with interaction terms by computing and plotting their predictive margins (probabilities).

Results

GBS and E. faecalis Prevalence at Baseline (Pre-drug)

(10)

group, 22 samples (51.2%) were positive for E. faecalis and 11 (24.4%) of DP women were positive for E. faecalis (p = 0.010) (Fig.1.)

Figure 1. Baseline prevalence of GBS and E. faecalis at baselineby drug group. At baseline, only 1 sample (2.2% prevalence) was positive for GBS in the SP group and 7 (15.6% prevalence) were positive in the DP group. The difference in GBS prevalence between drug groups at

baseline was statistically significant (p = 0.034). For E. faecalis, at baseline, 22 samples (51.2% prevalence) were positive for the pathogen in the SP group and 11 (24.4% prevalence) were positive in the DP group. The prevalence of E. faecalis between drug groups at baseline was significant (p = 0.010). All significant p-values are labeled with an asterisk * (p < 0.05).

Effect of SP on GBS and E. faecalis

(11)
(12)
(13)

pathogen. There were no statistically significant differences between drug group and pathogen over time. Dose 1 shown in red, dose 2 shown in blue, and doses 3+ shown in green.

(B) Univariable logistic regression was performed for each visit independently with SP as the reference group (i.e. odds ratios are DP vs. SP). GBS carriage is shown in blue and E. faecalis carriage is shown in yellow. An odds ratio of 1 means no difference between drug groups. Significant differences in infection risk of either pathogen were not found with respect to drug and number of doses. However, women in the SP group at baseline (pre-drug) were more likely to be E. faecalis positive, after which we observed a decreasing trend in of E. faecalis risk for SP women, albeit not statistically significant. All significant values are labeled with an asterisk * (p < 0.05).

Association Between Gravidity and Infection

Despite not discovering a clear relationship between drug and infection, we decided to investigate how drug and pathogen carriage interacts with gravidity. At baseline, we found that there was a relationship between gravidity, drug and E. faecalis infection (p = 0.003 )(Fig 3A). We investigated how this relationship changed with respect to drug and number of doses by comparing primigravidae and secundigravidae only, using log binomial regression with

generalized estimating equations and fitting an interaction term between the drug group and the number of drug doses received and gravidity (Fig 3B). The statistically significant correlation seen at baseline was not observed at subsequent study visits after drug administration,

irrespective of the number of doses (p = 0.656) (Fig 3B). Overall, there was a trend for women at their second pregnancy to have a higher likelihood of being infected with E. faecalis when compared to women at their first pregnancy. With respect to drug, primigravidae receiving SP had the lowest risk of E. faecalis infection after 3 or more doses (Fig 3B), but was not

(14)

Figure 3. Margins plot exploring interaction of gravidity, drug, and dosage for E. faecalis A. Baseline relationship between gravidity and drug group assignment. Women at their first

pregnancy (primigravidae) are denoted in orange, women at their second pregnancy (secundigravida) are shown in green, and women at their third or more pregnancies are shown in black. Logistic regression analysis with interaction terms was performed and a margin plot was generated for women in their first, second and/or more pregnancies at (A) baseline and (B) across the trial. Baseline analysis (A) shows that women at their second pregnancy had a higher probability of being infected with E. faecalis in both drug group assignments, before any drug was given (p = 0.003). In addition, women in the SP group overall have a higher likelihood of infection at baseline.

B. Relationship between gravidity, drug and number of doses. A log binomial logistic regression for repeated measures with generalized estimating equations was performed and compared primigravidae and secundigravidae only. We did not find a clear

relationship between gravidity and drug, irrespective of the number of doses, but there was a trend for the SP primigravidae to have a lower risk of infection.

(15)
(16)

Figure 4. Individual GBS and E. faecalis infection dynamics Heat maps show infection of (A) GBS and (B) E. faecalis from the baseline study visit until the final study visit (1-35 days before delivery, after 3 or more doses of drug). Uninfected samples are shown in yellow, samples positive for infection shown in purple, and no data (i.e. no stool sample provided) shown in gray.

Discussion

(17)

the SP group (p = 0.034). The percentage of GBS positive women in the SP group appeared to increase over time with an increasing number of doses, while in the DP group, the prevalence of GBS remained somewhat constant. There were no statistically significant differences in

prevalence of GBS between the two drug groups in any of the follow-up visits (p-value above 0.05 for each follow up visit), but we may have been severely underpowered to study an effect by SP on GBS, with only 31/309 stools positive for GBS overall. Such a small sample size presents challenges for analysis and is a major limitation of our current study.

Even though there was no definitive trend in GBS prevalence throughout the trial or between drug groups, the main health threat of GBS is presence at delivery when the pathogen could be transferred to the vaginal canal and infect the neonate by vertical transmission [18]. Women who are shown to be colonized with GBS in late pregnancy have high predictive values for colonization at delivery [18]. Thus, in our study, samples closes to delivery (after 3 or more doses) are the most relevant for inferring such delivery outcomes, as they were collected 1-35 days before delivery. During this time interval, overall GBS prevalence was 12.5%, which is lower than with previously published studies from sub-Saharan Africa with prevalence around 21.0% [19]. We conclude that the lack of effect of SP on GBS does not explain the paradoxical beneficial effect of SP.

(18)

At baseline (pre-drug), we observed a 37.5% prevalence, with more E. faecalis colonization in women from the SP group than from the DP group (p = 0.011). There were no statistically significant differences in prevalence of E. faecalis between the two drug groups in any of the follow-up visits [p-value above 0.05 for each follow up visit]. However, the odds ratio plot reveals an interesting decreasing trend, suggesting SP may be affecting carriage of E. faecalis. Initially, at baseline (pre-drug), women in the SP group are more likely (p = 0.011) to have E. faecalis infection than in the DP group. After drug administration, we did not observe any

differences in prevalence, hinting that there may be a trend of decreasing E .faecalis in SP women and perhaps instead of SP acting to clear current infection in the mother, it functions by preventing the risk of new infection. However, due to our limited sample size, our data do not definitively show evidence for this function.

To better understand how SP affects E. faecalis infection, we decided to look at the effect of gravidity on carriage of the pathogen. Analyses at baseline reveal that women in their second pregnancy or greater have an increased probability of carrying E. faecalis than women in their first pregnancy. Across both drug groups (before any drug is administered), this trend remains the same suggesting women who are in their first pregnancy are more protected against E. faecalis infections. Investigation of this relationship over time, with respect to drug and number

(19)

resulting in an immune modulation which may in fact make the mother more susceptible to some infections with increasing gravidity [21, 22]. Our findings warrant further investigation in larger longitudinal studies with women of different gravidities.

Our study had limitations: small sample size, potential imbalances at baseline despite randomization, and the decreasing total sample size for each follow up visit. However, despite these challenges the results indicate that neither drug group has a clear effect on clearing the presence of Group B Streptococcus or E. faecalis. Thus, it is unlikely that any effect of SP on either of these two pathogens explains the paradoxical benefit of SP during pregnancy. The E. faecalis findings with respect to gravidity are interesting and pose ongoing questions regarding immune tolerance during pregnancy, which should be followed-up in larger observational studies.

Acknowledgments

I would like to thank every member of the Juliano and Meshnick laboratories in the UNC Gillings School of Public Health for making the laboratory an exciting place to conduct science and always being supportive of any and all of my research endeavors. I want to thank Dr. Meshnick for allowing me to join his lab, giving me so many opportunities to learn and grow, and for providing me the exposure to figure out what I want to do in life. Finally, I wish to express my deepest gratitude to Andreea Waltmann for her invaluable training, patient guidance, and unwavering encouragement throughout my research experience, for providing feedback on my thesis, and for more than two years of mentorship and friendship.

(20)
(21)

References

1. Defo BK. The importance for the MDG4 and MDG5 of addressing reproductive health issues during the second decade of life: review and analysis from time series data of 51 African countries. Afr J Reprod Health. 2011;15(2):9-30. Epub 2012/05/18. PubMed PMID: 22590890. 2. Cates JE, Westreich D, Unger HW, Bauserman M, Adair L, Cole SR, et al. Intermittent Preventive Therapy in Pregnancy and Incidence of Low Birth Weight in Malaria-Endemic Countries. Am J Public Health. 2018;108(3):399-406. Epub 2018/01/19. doi:

10.2105/AJPH.2017.304251. PubMed PMID: 29346002; PubMed Central PMCID: PMCPMC5803815.

3. Desai M, ter Kuile FO, Nosten F, McGready R, Asamoa K, Brabin B, et al.

Epidemiology and burden of malaria in pregnancy. Lancet Infect Dis. 2007;7(2):93-104. Epub 2007/01/26. doi: 10.1016/S1473-3099(07)70021-X. PubMed PMID: 17251080.

4. WHO. WHO policy brief for the implementation of intermittent preventive treatment in malaria in pregnancy using sulfadoxine-pyrimethamine (IPTp-SP) Geneva: World Health Organization: 2014 January 2014. Report No.

5. McClure EM, Goldenberg RL, Dent AE, Meshnick SR. A systematic review of the impact of malaria prevention in pregnancy on low birth weight and maternal anemia. Int J Gynaecol Obstet. 2013;121(2):103-9. Epub 2013/03/16. doi: 10.1016/j.ijgo.2012.12.014. PubMed PMID: 23490427.

6. Heinberg A, Kirkman L. The molecular basis of antifolate resistance in Plasmodium falciparum: looking beyond point mutations. Ann N Y Acad Sci. 2015;1342:10-8. Epub 2015/02/20. doi: 10.1111/nyas.12662. PubMed PMID: 25694157; PubMed Central PMCID: PMCPMC4405445.

7. Desai M, Gutman J, Taylor SM, Wiegand RE, Khairallah C, Kayenta Ok, et al. Impact of Sulfadoxine-Pyrimethamine Resistance on Effectiveness of Intermittent Preventive Therapy for Malaria in Pregnancy at Clearing Infections and Preventing Low Birth Weight. Clin Infect Dis. 2016;62(3):323-33. Epub 2015/10/22. doi: 10.1093/cid/civ881. PubMed PMID: 26486699; PubMed Central PMCID: PMCPMC4762476.

8. van Eijk AM, Larsen DA, Kayentao K, Koshy G, Slaughter DEC, Roper C, et al. Effect of Plasmodium falciparum sulfadoxine-pyrimethamine resistance on the effectiveness of

intermittent preventive therapy for malaria in pregnancy in Africa: a systematic review and meta-analysis. Lancet Infect Dis. 2019;19(5):546-56. Epub 2019/03/30. doi:

10.1016/S1473-3099(18)30732-1. PubMed PMID: 30922818.

9. Unger HW, Ome-Kaius M, Wangnapi RA, Umbers AJ, Hanieh S, Suen CS, et al. Sulphadoxine-pyrimethamine plus azithromycin for the prevention of low birthweight in Papua New Guinea: a randomised controlled trial. BMC Med. 2015;13:9. Epub 2015/01/17. doi: 10.1186/s12916-014-0258-3. PubMed PMID: 25591391; PubMed Central PMCID: PMCPMC4305224.

(22)

sulphadoxine-pyrimethamine, mefloquine, and azithromycin. Malar J. 2010;9:303. Epub 2010/10/30. doi: 10.1186/1475-2875-9-303. PubMed PMID: 21029476; PubMed Central PMCID: PMCPMC2984572.

11. Faro S. Group B beta-hemolytic streptococci and puerperal infections. Am J Obstet Gynecol. 1981;139(6):686-9. Epub 1981/03/15. doi: 10.1016/0002-9378(81)90486-5. PubMed PMID: 7011033.

12. Winn HN. Group B streptococcus infection in pregnancy. Clin Perinatol. 2007;34(3):387-92. Epub 2007/09/04. doi: 10.1016/j.clp.2007.03.012. PubMed PMID: 17765489.

13. Tan Q, Xu H, Xu F, Aguilar ZP, Yang Y, Dong S, et al. Survival, distribution, and translocation of Enterococcus faecalis and implications for pregnant mice. FEMS Microbiol Lett. 2013;349(1):32-9. Epub 2013/10/18. doi: 10.1111/1574-6968.12280. PubMed PMID: 24131236. 14. Carroll IM, Ringel-Kulka T, Keku TO, Chang YH, Packey CD, Sartor RB, et al.

Molecular analysis of the luminal- and mucosal-associated intestinal microbiota in diarrhea-predominant irritable bowel syndrome. Am J Physiol Gastrointest Liver Physiol.

2011;301(5):G799-807. Epub 2011/07/09. doi: 10.1152/ajpgi.00154.2011. PubMed PMID: 21737778; PubMed Central PMCID: PMCPMC3220325.

15. Ryu H, Henson M, Elk M, Toledo-Hernandez C, Griffith J, Blackwood D, et al.

Development of quantitative PCR assays targeting the 16S rRNA genes of Enterococcus spp. and their application to the identification of enterococcus species in environmental samples. Appl Environ Microbiol. 2013;79(1):196-204. Epub 2012/10/23. doi: 10.1128/AEM.02802-12. PubMed PMID: 23087032; PubMed Central PMCID: PMCPMC3536114.

16. Bergseng H, Bevanger L, Rygg M, Bergh K. Real-time PCR targeting the sip gene for detection of group B Streptococcus colonization in pregnant women at delivery. J Med

Microbiol. 2007;56(Pt 2):223-8. Epub 2007/01/25. doi: 10.1099/jmm.0.46731-0. PubMed PMID: 17244804.

17. Capan-Melser M, Mombo Ngoma G, Akerey-Diop D, Basra A, Würbel H, Groger M, et al. Evaluation of intermittent preventive treatment of malaria against group B Streptococcus colonization in pregnant women: a nested analysis of a randomized controlled clinical trial of sulfadoxine/pyrimethamine versus mefloquine. J Antimicrob Chemother. 2015;70(6):1898-902. doi: 10.1093/jac/dkv041. Epub 2015 Feb 25.

18. Valkenburg-van Den Berg, A.,W., Houtman-roelofsen, R., Oostvogel, P. M., Dekker, F. W., Dörr, P. J., & Sprij, A. J. (2010). Timing of group B streptococcus screening in pregnancy: A systematic review. Gynecologic and Obstetric Investigation, 69(3), 174-83.

doi:10.1159/000265942

19. Gray KJ, Kafulafula G, Matemba M, et al. Group B Streptococcus and HIV Infection in Pregnant Women, Malawi, 2008–2010. Emerging Infectious Diseases. 2011;17(10):1932-1935. doi:10.3201/eid1710.102008.

(23)

21. Natri H, Garcia AR, Buetow KH, Trumble BC, Wilson MA. The Pregnancy Pickle: Evolved Immune Compensation Due to Pregnancy Underlies Sex Differences in Human Diseases. J Trends Genet. 2019 Jul;35(7):478-488. doi: 10.1016/j.tig.2019.04.008.

Figure

Updating...

References

Updating...

Related subjects :