Amplification and analysis of specific DNA and RNA sequences of bovine leukemia virus from infected cows by polymerase chain reaction

(1)

0095-1137/92/010185-07$02.00/0

Amplification

and

Analysis of Specific

DNA and RNA

Sequences

of Bovine Leukemia

Virus from Infected Cows

by Polymerase Chain Reaction

MICHAEL P. SHERMAN,1 GARTHD. EHRLICH,1t JORGE F. FERRER,2 JOHN J. SNINSKY,3 RUBEN ZANDOMENI,2 NANCYL. DOCK,4AND BERNARD J. POIESZ1*

Departments of Medicine and MicrobiologylImmunology, State University of New York Health Science Center atSyracuse, Syracuse, New York 132101; Section of Viral Oncology, University ofPennsylvania,

Philadelphia, Pennsylvania 193482; Cetus Corporation, Emeryville, California

946083;

andAmericanRed Cross Blood Services, Syracuse, New York

13210'

Received 22 May1991/Accepted26September 1991

Bovine leukemia virus (BLV) is theetiologic agent of leukemia in cattle and is believedto causedecreases in milk productivity, fertility, and life span in infected cows. BLV is a type C retrovirus in the Oncovirinae subfamily. It is most closely related to human T-cell lymphoma/leukemia virus type I (HTLV-I) and type II (HTLV-II). Since the polymerase chain reaction (PCR) provides rapid and efficient amplification of DNA sequences, primers were designed to amplify regions of the polymerase(pol)and pX genesspecific for BLV targets. These setsof primers consistently amplified as few as 10 copies of BLV DNA contained in a plasmid inthe background of 1 ,ug of either human or bovine chromosomal DNA. Inaddition,noamplification products

were detected from cell lines infected with HTLV-I,HTLV-H, orhumanimmunodeficiency virustype 1or 2 by the BLV PCR systems.Samplesofperipheralblood mononuclear cells from 18cows,previously determined to beserologically positive or negative, were correctly identified in a blind studyascontaining proviralDNA

byuseofthe BLVprimersandprobes. Cloningandsequencingofamplified products revealed finite sequence variations among a previously cloned BLV isolate, the wild-type virus, and the published genome. Reverse transcriptase-directed PCR with the primers for both BLV pol and BLV pX wasperformedonplasma from a BLV-infected cow and detected in vivo BLV RNAexpression.Insummary, we havedevelopedaspecificand sensitiveassayusingPCR for the detection andidentificationof BLVinfections;thisassay can now beapplied

toclinical and basic researchquestionsinveterinarymedicine.

Bovine leukemia virus (BLV) is the etiologic agent of chronic B-celllymphocytosis andlymphoma incows(4, 8).

BLVis anexogenous, replication-competent, type C

retro-virusandis a memberofthe Oncovirinaesubfamily, which includes human T-cell lymphoma/leukemia virus type I

(HTLV-I) and type II (HTLV-II) and simian T-cell lym-phomavirus (23, 30).Theseviruses haveauniquepXregion which is located between the env gene and the 3' long

terminalrepeatandwhich isresponsible for up-regulationof

the level of expression of viral and possibly cellulargenes

(13,22). This up-regulation is thoughtto be the keyprocess

in theinitiation of cell transformation leadingtomalignancy. The disease induced by BLV is similar to HTLV-I-associated adult T-celllymphomalleukemiainthat thereisa

long latency period and an absence of chronic viremia. Moreover, BLV-induced lymphomas, likeHTLV-I-induced

lymphomas, are generally monoclonal, despite a lack of

proof of specific proviral integration sites (4, 8, 15). These

similaritieshavemade the BLVsystem animportant model

for studying the molecular aspects ofretroviral disease in humans. Furthermore, there is evidencethat BLV infections areassociatedwithdecreased dairyproduction and a shorter

life spanfor cows which, for practical reasons in both the

United States and Europe, are usually culled from a herd

before anyclinically detectable signs of the disease emerge

(3, 18). It is therefore important to further elucidate the

*Correspondingauthor.

tPresent address: Pathology Department, University of Pitts-burgh, PittsPitts-burgh, PA.

molecular mechanisms of BLV replication and disease pathogenesis andtoincreaseourabilitytodetectearlyBLV

infections in seronegative animals.

Gene amplification by the polymerase chain reaction (PCR) is a technique used to exponentially increase the quantity ofadesiredtargetDNAsequence(24, 25).PCRcan

greatlyincrease the sensitivity of various detection methods and can consistently allow the detection ofas few as 10

copiesofadesiredsequenceinagivensample underoptimal

conditions (1). Reverse transcriptase (RT)-directed PCR (RTPCR) can be used in the amplification and subsequent detection of RNA expressed from a given DNA sequence

(5).Amplification of conserved but specific BLV sequences

in potentially infected animals would allow for the early detection of virus andmight obviate the need for serological analyses, which are still not internationally standardized (12).

Amplification and detection of BLV proviral DNA and

RNAsequenceswould allow foramoredetailedanalysis of the lifecycleandmoleculargenetic studies of the virus under

various in vivo and in vitroconditions, since the expression

of BLV is highly restricted (14, 28). BLV has not been showntobetranscribed in freshlymphocytesor tumorcells invivo(14,15), and onlylow levelsofBLVexpressionhave been detected incellculturesderived from naturally infected bovinelymphocytes(10,27, 29).These lowlevelsof

expres-sionarenot sufficientfor developingasensitiveand

repro-ducible BLV RNAdetectionassay that can be usedforthe

diagnosis ofBLV infectionsin cattle.

In this study, we devised a specific and sensitive PCR 185

on April 12, 2020 by guest

http://jcm.asm.org/

(2)

TABLE 1. Sequences of synthetic oligonucleotide primers and probes and their locations in the BLVgenome

Primerorprobe Strand Sequence(5'to3') Location of_product amplified

orprobe

Primer

SK139 + TTTGTGCATGACCTACGAGCTACA pol(nucleotides 2464 to 2621)

SK140 - AAGCGGTCTTCGACTGGAATCT

ProbeSK141 - TTTGAGATCTAGGCAAATGATATGTGGAGGGTGCGT pol(nucleotides 2586 to 2551)

Primer

SK142 + GTCCAATGATGTCACCATCGAT pX (nucleotides7302 to 7414)

SK143 - TCCAGTTGATACGGTGGGTCT

ProbeSK144 + GAGCGACTCCAATTCGAAACGATCGACACC pX (nucleotides7351 to 7380)

system for the detection of proviral BLV sequences and

demonstratedfor the first time the detection of in vivo viral RNAexpressionfrom an infected cow by use of RTPCR.

MATERIALS AND METHODS

Bovine study population. The BLV-infected cattle

be-longedtothe leukemia (high incidence)study herd (herd BF)

maintained at the University of Pennsylvania (2, 9). They were asymptomatic but repeatedly positive for BLV

anti-bodies, as determined by a radioimmunoassay with the major gag polypeptide, p25 (16), or the major envelope glycoprotein, gpSl (11), ofBLV.Healthy control cattle have been maintained in isolation for at least 5 years and have beenconsistently negative during this time forBLV antibod-ies, asdeterminedby thesame assays.

Amplification of DNA. Each sample subjected to PCR analysis contained either 1 ,ug of bovine DNA or various

amounts of control DNA. Bovine DNA was obtained from peripheral blood mononuclear cells (PBMs) isolated by

centrifugation over Ficoll-Hypaque of10 ml of blood from eachcow.The PBMswerelysed with 500 ,ul ofproteinaseK

bufferovernightat37°C, andDNA wasextractedwith equal volumes of phenol andchloroformand then ethanol

precip-itated, all aspreviously described (1). The positive control DNA was a plasmid (referred to here as pBLV1) which contained an almost complete Sacl-SacI 9.2-kb proviral

DNA fragment from BLV (7). pBLV1 was diluted in the presenceof1 ,ugof humanorbovine chromosomalDNA as

thebackground. Each samplewasamplifiedin afinal volume of100 ,ul for 30 cycles in a DNA thermal cycler (Perkin-ElmerCetus, Norwalk, Conn.) by being heated to 94°C for 40 s, 53°C for 15 s, and finally 68°C for 15 s before being

cycledto 94°C.Allprimers andprobeswere synthesizedon aDNAsynthesizer(Applied Biosystems,FosterCity, Calif.) andpurified by reversed-phase chromatography.Theprimer

sequences used (Table 1) were designed to amplify DNA targets in the pol orpX gene specific for BLV and were based on the full-length published sequence (23). The final reaction mixture contained the DNA sample, 10 pmol of eachprimer, 180

jiM

eachdeoxynucleoside triphosphate, 50

mM KCl, 10 mMTris (pH8.3), 2.5 mMMgCl2, and 2U of Thermus aquaticus (Taq) DNA polymerase (Perkin-Elmer

Cetus). All preamplification setups were done by different peopleand in a roomseparatefromthat inwhich

amplifica-tion and analysis took place to avoid contamination of

amplified products.

Purification and amplification of RNA. Total cellular

mRNA from the BLV-producing cell line FLK-BLV (29) wasisolated byuseof the protocol in the Fast Track mRNA

isolation kit of Invitrogen (San Diego, Calif.). RNA was

isolated from pelleted virions obtained by centrifugation of

500,ulofcowplasma inaMicrofuge for45minat 12,000 rpm and4°C.Thepellet waslysed with500

RI

oftheappropriate

buffer containing proteinase K, and nucleic acids were

extracted with an equal volume of phenol-chloroform and

precipitated with 2.5 volumes of 95% ethanol and0.1volume

of 3 M sodium acetate in the presence of15 ,ug of carrier

tRNA.Theprecipitated RNA, along withanycellularDNA, wasresuspended inH20;onealiquotwassubjected directly

to PCR amplification, while the other aliquot was treated withDNase(5). AfterDNase treatment, theRNA was again

phenol-chloroform extracted and ethanol precipitated.Two

aliquots ofthe DNase-treated RNA were made; one was

subjected directly to PCRamplification, and the otherwas

firsttreated withMoloney murine leukemia virusRTin the presence of a negative-strand primer to synthesize cDNA

andthen subjected toPCRamplification. Allreagents were

treated with diethyl pyrocarbonate, and the RNA was

al-ways maintained in the presence of RNasin (Promega,

Madison, Wis.). All amplifications were carried out as de-scribed above (see "AmplificationofDNA").

Analysis of amplified material. Liquid hybridization and endlabelling ofoligonucleotideprobeswerebothperformed

as previously described, except that probes were purified

withSephadex G-50spin columns (1). Inbrief, 30 pLlofthe

total100-,ulPCRproductwascombined withtheappropriate probein thepresenceof 0.15MNaClin afinal volume of40

RI,

boiled for5min, andincubated at55°C for30min. The

entiresamplewaselectrophoresedon an8%polyacrylamide

gel, whichwasautoradiographedovernightwithXAR-2film (Kodak, Rochester, N.Y.). RNA dot blot analysis was

performed in accordance with the GeneScreen Plus (NEN

ResearchProducts, Boston, Mass.)protocolfor formamide denaturation.

Cloningandsequencing.Tofacilitatethesubsequent clon-ing ofamplified products, we synthesized the

oligonucleo-tide sequence CTAGTCGTCGAC(5' to 3'), which contains

an AccI restriction endonuclease digestion site, and the

oligonucleotide sequence CTAGTCGAGCTC (5' to 3'),

whichcontainsanSstIrestriction endonuclease site,onthe 5' endofthepositive- and negative-strand primers,

respec-tively. The quantity ofamplified DNA was increased by

amplifying five 5-,ul aliquots of the PCR product for an

additional30cycles.Thesealiquotswerecombined,

phenol-chloroform extracted, and precipitated with ethanol and

http://jcm.asm.org/

(3)

A

pol

p

PX

A O w

z

-j

_j =

w

I

I I

In C

-00 0 0

1 - _ _

t o

6 0

- z

I.

0 C.

cn) t -I

I

I11 I

w z

-j

.4

I

0* 0

a I

O n

0 0

o. 00

C0 0e 0N

-IN qp

Co a

4 0 0 0;

z

= _ a.t

z Z IL

4j

.4 0

: -I _- a

-4 4~~~~~~4

I- I-I

-J - >

I 0

II1 1li I I

w

0.

I I lI I I I I I I I I I I I I I I I I

FIG. 1. Autoradiograph ofliquid hybridization of amplified DNAs showing the sensitivity and specificity of the primers. A calculated amountof aplasmid containing BLV DNA (pBLV1) (7) was diluted in a background of 1 ,ug of chromosomal DNA,amplified with primers (Table 1) in the pol region (A) or the pX region (B), and hybridized with the appropriate probes. Both sets ofprimersconsistentlyamplified asfew as 10 copies of pBLV1, thereby demonstrating the maximum sensitivity possible by Poisson distribution. Neither set of primers amplified human immunodeficiency virus type 1 or type 2 (HIV-1 or HIV-2, respectively),HTLV-I,or HTLV-II DNAfrom isolates or from cell lines established from infectedpatients, thereby demonstrating specificity. DNAwasobtained from celllines by proteinase Klysis and phenol-chloroform extraction as described in Materials and Methods. One microgram of infected cellular DNA represents approximately 300,000proviral copies of the human retroviruses (data not shown).

sodium acetate as described above. The samples were di-gested withAccIandSstI(Bethesda Research Laboratories, Bethesda,Md.),reprecipitatedwithethanol, resuspended in distilledwater,and used forligation. M13mpl8wassimilarly digested,ligated with targetDNA, and transfected in Esch-erichia coli DH5aF' (17). Transfected bacteria were plated andplaquehybridizationwasperformed with Colony/Plaque Screen membranes (NEN Research Products) in accordance with the manufacturer's specifications. Plaques with the correct inserts were detected by hybridization with their

respective 32P-end-labelled positive-strand probe. Transfer membranes were washed two times in 2x SSPE-0.5%

sodium dodecyl sulfate (25a) for 10 mineach time at 55°C andautoradiographed. Sequencingwasdone by the dideoxy

method (26) witha32P-end-labelleduniversal primerand the

SequenaseDNA sequencingkit, version 2.0 (United States Biochemical Corp., Cleveland, Ohio). Atleasttwodifferent clones of each amplified DNA product were sequenced. Direct sequencing of pBLV1 was done by boiling and quickly cooling 2 ,ug of the plasmid DNA and using the

Sequenasekitwithanend-labelled PCRprimer.

RESULTS

Sensitivity and specificity of primers. The primers and probes used for PCR amplification and product detection

(Table 1) were designed on the basis of the only available

full-length published sequence (23)ofBLV. We used these

primers toamplifyacalculated copynumber ofpBLV1 (7)

serially diluted inabackground of1 ,ugof eitherhuman or

bovine chromosomal DNA, with equivalent results. An

autoradiograph (Fig. 1)ofliquid hybridization ofPCR prod-ucts shows the sensitivity of detection to be 10 copies of

pBLV1 forthepol andpX geneprimers andprobes. Figure

1alsoshows thatboththe BLVpol and theBLVpXprimers and probes were specific in that they did not detect DNA fromanyofthefour known human retroviruses; in particu-lar, when 300,000 copies ofthe retroviruses most closely related toBLV, HTLV-I and HTLV-II, wereamplified, no

band was detectedby liquidhybridization.

Detection of BLV proviral DNA in clinical samples. One microgram of DNA obtained from PBMs of infected and uninfectedcows asdescribed in Materials and Methodswas

tested in a blind fashionby PCR analysis with bothsets of primers. Both the pol andthe pX(Fig.2)primers yieldedthe same liquid hybridization results for both the unknown clinical samples and the controls. When the code was

broken, the PCR data correlated completely with BLV

serumantibody titers for the individual animals.

Sequence information. Amplified DNA fragments were

cloned and sequenced to analyze a clinical isolate and to prove that there was no contamination from the BLV

DNA-containing plasmid (pBLV1) or amplified products.

Amplified BLV DNA from one cow (Fig. 2, lane 1) was

cloned, and its sequence was compared with the pBLV1

sequence anda previously published sequence(Fig. 3). All ofthedifferencesnoted between the BLV sequencefoundin the infected cow and the previously published sequence were transitions and were in thepol gene. Only one of the

five changes in the 108 polgenebasesexamined causedan

amino acid substitution. Codon CCT at positions 2592 to 2594 was changed to CTT in both the clinical sample and

pBLV1, resulting in a change from proline to leucine. To ensurethatthe differences seen, at leastforpBLV1 DNA,

were notartifactsof PCRorthecloningprocess, wedirectly sequenced pBLV1 DNA with either end-labelled

http://jcm.asm.org/

(4)

A

i 3 5 7 9 11 13 15

i I I I I I I I I I I I I I

I I I I I I i I I I I I I I I

17 I

I I I

o O o O

xx I x

z

-j--J

I)

z

I)

H

I -I

I

pol

t i) c

43 o o o z

C)

0

uz

U,

-J

0_

uJ

0.

I

I II I I I I I I

pX

FIG. 2. Autoradiograph of liquid hybridization of amplifiedDNAfromclinicalspecimens. (A) Onemicrogramof DNA extracted from PBMs ofinfectedoruninfectedcows(samples1to18)wastestedinablindfashionthroughamplification ofthepolorpXgeneandsubsequent

hybridization with the appropriate probe. Resultswerelaterconfirmedtohaverevealedhybridization bands only in the lanes containingDNA frominfected cows.(B) Positive and negative controls for each amplification. RCN,1 ,ug ofDNAfrom PBMs isolated fromanormalblood

donorinthesame mannerasbovinechromosomalDNA. BLVplasmid, pBLV1 (7).

Pol gene of BLV from infected cow

T C

(2467) TTGTGCATGACTACAAATGC TTACAAAGCCCATTCCGGCACTCTCTCC

primer SK139 C C

A T T

CGGACCGCCAGAC C1TACCGCrATCCCT_ CCTAGATC

A T probe SK141

xs;g;Z=WS xW (2621)

primer SK140

pX gene of BLV from infected cow

(7302) G G C G ACTCC

primer SK142 A

AATTCGAAAGGATCGCAaUPGCG&GACCCACCCACCGTAA (7414)

probe SK144 primer SK143 C

FIG. 3. Sequence variations that exist among the published sequence, the sequence of a genomic BLV isolate cloned intoaplasmid (pBLV1)(7), and the sequence of a BLV isolateinfecting one of the cows in this study. Letters above the main sequence represent nucleotides in theproviral DNA from the cow which differed from those in the published sequence (24). Letters below the main sequence represent nucleotidechanges inpBLV1,asdetermined by directsequencing of plasmid DNAandasconfirmed bysequencing of clonedamplifiedDNA from theplasmidtarget.

B

i

http://jcm.asm.org/

(5)

strand primer. Except for the positive-strand primer regions themselves, whichcannotbe sequencedthisway,there was no differencein the two sequencing approaches, indicating that the sequencing of cloned PCR products is relatively errorfree.

RNA amplification. Since these BLV primers amplified DNAefficiently,they were used for RTPCR in an attempt to amplify RNA and to allow for thedetection of virus expres-sion. Total cellular mRNA was isolated from the

BLV-producing cell line FLK-BLV (29), serially diluted, and

subjected toPCR amplification either withorwithout prior

RT treatment. Figure4 depicts theresultsfor RTPCR with theBLVpol primers and reveals liquid hybridization bands downto aninput of

i0'

,tgoftotalcellularmRNA,butonly afterRT treatment. Bothsetsof primersandprobes detected

BLV RNA consistently at inputs as low as 10-5 ,ug of cellular mRNA and occasionally at inputs of

10'6

,g of cellular mRNA. Fora comparison ofsensitivity, RNA dot blothybridization was performed (data not shown), and only

inputs down to lo- ,ug of total cellular mRNA could be

detected. Since this PCR system efficiently amplified BLV

RNA, RTPCR was attempted on plasma from an infected

cowandanuninfectedcow(Fig. 5). Nucleic acid extracted from pelleted material from the plasma ofan infected cow contained viral DNAsequences which could beamplifiedby

PCR. When this materialwastreated withDNase,theliquid hybridization signalwas abolished.Reversetranscription of theDNase-treated sample and subsequent detection of am-plified PCR products demonstrated the presence of BLV

jig of TOTAL rnRNA from BLV infected cell line

(+)RT (-) RT

I---w---I-I _ ___

z tD In to eu 0 e * Ko o

0

$o

o b o b

b

b b 'o

b

-I I I I I I I I I I

._l

a:

a-I~

RNA inthe plasma of aninfected cow. As a negative control fornonspecificamplification, plasma fromanuninfectedcow was similarly amplified with both sets of primers, and no PCR products were detected.

DISCUSSION

BLV, the etiologic agent of chronic B-cell leukosis in cattle, is transmitted transplacentally and horizontally among animals (8, 20, 21). BLV is an important virus to study because of the impact that it has on the health of infected animals andon the economics of the cattle and dairy industries. BLV infects about one-third of the adult dairy cattle in the United States and is amajor cause of the loss of export markets for breeding cattle, bovine semen, and

bovine embryos.Moreover, BLV is animportantmodel for human research because of itsgenetic andpathogenic simi-larities to HTLV-I.

PCR (24, 25) is one ofthe most widely used molecular tools today because it enables the detection of very low

levels ofDNA and RNA (1, 5). We have developed two

sensitiveand specific setsofprimers for PCR amplification

that have allowed us to amplify BLV DNA. In addition,

when DNA from PBMs of infected and uninfected cows were analyzed with these primers in a blind fashion, all

animals were correctly diagnosed by liquid hybridization results, which werein accordance with serumantibodytest

results. Moreover, we report here, for the first time, the

detection ofinvivoBLV RNAexpression froman infected

cow.

When sequencing was performed on amplified DNA tar-getsfroman individualanimal, achangefromthepublished

sequence(23)wasdetectedinthe BLVpolgene;thischange

caused the substitution ofa leucine for a proline. A

previ-4

--J

N--1

a

z

Z +

l i

4c

-J

0.

10a

aza a

+ Z++ 0L

I i I I I

FIG. 4. RTPCR ofmRNAfromaBLV-infected cell line. Shown is an autoradiograph of liquid hybridization of RTPCR-amplified dilution series of totalcellularpolyadenylatedmRNAisolated from

theinfected cell line FLK-BLV(30) by use of theprotocol in the Fast Track mRNA isolation kit (Invitrogen). Each dilution series

was amplified for 30 cycles with the BLV pol primers after RT treatment[(+) RT]orwithoutRTtreatment[(-) RT] in thepresence

of the negative-strand primer. An amplified DNA product was

detecteduponliquidhybridization onlyaftertreatmentwithRT and subsequent PCR. Theassay wassensitive downtoadilution of io'

,ug of cellular polyadenylated mRNA. Negative controls are as

indicated. RCN, 1 ,ug ofDNAfrom PBMs isolatedfromanormal

donorinthesame manner asthe bovine chromosomal DNA.

FIG. 5. Liquid hybridization of RTPCR-amplified mRNA iso-lated from theplasma ofaBLV-infectedcow or anuninfectedcow. Particle-associatedRNA wasisolatedasdescribed in Materials and Methodsfromtheplasma ofaseropositivecowandaseronegative

cow. The nucleic acid (NA)was subjected directlyto30cycles of PCRwith thepolprimersortreatedwith DNase (+DNase)orwith DNase andthenRT(+RT)priortoamplification. Apositive signal in the NA row forthe seropositive cow indicates that DNA was

copurifiedwithRNA; thisDNAwasremovedbyDNase treatment butthepositive signalreturned afterreversetranscription, providing evidence forthe presenceofRNAinvivo. Plasma froma seroneg-ativecowwastested in thesame mannerandwasnegative

through-out. The primer-only lane wasnegative aswell. Results were the

sameforboth setsofprimers.

http://jcm.asm.org/

(6)

ously cloned BLV isolate (pBLV1) (7) also had a similar change. Since proline contains a hydrophilic aliphatic side chain and is cyclic innature, it isoften found in thebends of folded proteins and dramatically alters protein conforma-tion. Leucine hasanaliphatic side chain which is

hydropho-bic and would significantly change the shapeofaprotein if

substituted for proline. Since this substitutionexisted in both pBLV1 and the BLV isolate from an infected cow in this study, it ispossible thatthepublished sequenceis incorrect.

Results of further analyses of BLV sequence divergence

with these and other PCR primers developed against

con-servedornonconservedregions of BLV could be correlated with the manifestation and progression ofdisease in BLV-infected animals.

Persistent antibody responses to BLV proteins are a

feature ofnatural BLV infections (8). The official reference

test of the Office International des Epizooties and the

EuropeanEconomicCommunity is the agargel

immunodif-fusiontestwithaBLVglycoprotein antigen for the detection

ofantibodies inindividual blood samples (12). More sensi-tive enzyme-linked immunosorbent assays have recently

beendeveloped forusein detecting the BLV p24 antigen in

pooled milk samples (6). Recently, a call forinternational

standardization was published in a report in which many serological methodswerecompared (12). In thefuture, PCR

could be used, as in humans (19, 31), to determine

true-positives and-negativestovalidatethe sensitivity and spec-ificity of the serological assays being evaluated. Moreover,

now that specific and sensitive PCR primers have been

developed,gene amplification of individualor pooled blood or milk samples might be considered an alternative or an

adjunctto serologicalassays.

Uptonow,BLVexpression ininfected cattle hasnotbeen demonstrated, and onlylowlevels of BLV RNA have been detectedininfectedbovine lymphocyte cultures. Since BLV infections produce a persistentantibody response, it is not

surprisingthat thehighly sensitive technique of RTPCRcan be usedtodetect the in vivo expression of viral RNA. This RNA detection will allow us to address many questions regarding BLV infections. For example, the rate of BLV

transcription postinfectioncould bedetermined,ascould the

pattern of RNAexpression. Ultimately, the course of

dis-easeinBLV-infectedanimals couldbe monitored by

correl-ative RNA studies, providing a powerful tool for studying

thepathogenesis of BLVincowsand providing amodel for humanHTLV-Iinfection.

ACKNOWLEDGMENTS

We thank Chris Kane,Jayne Love,Mary Rubert, and Barbara Jonesfortechnical assistance and LoriTillis fortypingthe

manu-script.

This workwassupported by PHScontractN01HB67021 andby grant5-243-94from the R. J. andH. C. KlebergFoundation.

REFERENCES

1. Abbott, M., B. Poiesz, B. Byrne, S. Kwok, J. Sninsky,and G. Ehrlich. 1988. Enzymatic gene amplification: qualitative and

quantitative methods for detecting proviral DNAamplified in

vitro. J. Infect. Dis. 158:1158-1169.

2. Abt, D.A., R.R.Marshak, J. F.Ferrer,C. E.Piper,and D. M. Bhatt. 1976. Studiesonthe development ofpersistent

lympho-cytosis and infection with the bovine C-type leukemia virus (BLV)in cattle. Vet. Microbiol. 1:287-300.

3. Brenner, J., M.Van-Haam, D. Savir, and Z. Trainin. 1989. The implication ofBLV infection in the productivity, reproductive capacity and survival rate of a dairy cow. Vet. Immunol.

Immunopathol.22:299-305.

4. Burny, A., Y.Cleuter, R.Kettman,M.Mammerickx,G.

Mar-baix, D. Portetelie, A. Van der Broeke, L. Willems, and R. Thomas. 1990. Bovine leukemia;facts andhypothesisderived from thestudyofaninfectious cancer, p. 9-32.InR.Gallo and F. Wong-Staal (ed.), Retrovirus biology and human disease. MarcelDekker,NewYork.

5. Byrne, B. C., J. J. Li, J. J. Sninsky,and B. J. Poiesz. 1988. Detection of HIV-1 RNA sequencesbyin vitro DNA

amplifi-cation. Nucleic Acids Res. 16:4165.

6. DeBoer, G. F.,H. Boerrigter, J.Akkermans,andJ. Brenner. 1989. Useof milk samplesandmonoclonal antibodies directed againstBLV-p24toidentifycattle infected withbovine leuke-mia virus(BLV).Vet. Immunol.Immunopathol.22:283-292. 7. Deschamps,J.,R.Kettmann,and A.Burny.1981.Experiments

with cloned complete tumor-derived bovine leukemia virus information prove that the virus istotallyexogenoustoits target animal species.J. Virol. 40:605-609.

8. Ferrer, J. F. 1980. Bovine lymphosarcoma. Adv. Vet. Sci. Comp.Med. 24:1-68.

9. Ferrer, J. F.,D. A.Abt,D. M.Bhatt,andR. R. Marshak.1974. Studies on the relationship between infection with bovine C-typevirus, leukemia andpersistentlymphocytosisin cattle. CancerRes.34:893-900.

10. Ferrer,J. F., N. D. Stock, and P. S. Lin. 1971. Detection of replicating C-typeviruses incontinuous cell cultures established fromcowswith leukemia: effect of the culture medium. J. Natl. Cancer Inst. 47:613-621.

11. Gupta, P., and J. F. Ferrer. 1981. Comparison of various

serologicaland direct methods for thediagnosisof BLV infec-tion in cattle. Int. J. Cancer 20:179-184.

12. Hoff-Jorgensen, R. 1989. An international comparison of dif-ferent laboratory tests for the diagnosis ofbovine leukosis: suggestions for international standardization. Vet. Immunol. Immunopathol.22:293-297.

13. Kettmann, R., Y. Cleuter, D. Gregoire, and A. Burny. 1985. Roleof the 3'longopenreadingframeregionof bovine leukemia virus in the maintenance of cell transformation. J. Virol. 54:899-901.

14. Kettmann, R., J. Deschamps, Y.Cleuter, D.Couez,A.Burny,

and G. Marbaix. 1982. Leukemogenesis by bovine leukemia virus:proviralDNAintegrationandlack of RNAexpressionof virallongterminal repeat and 3'proximatecellular sequences. Proc.Natl. Acad. Sci. USA 79:2465-2469.

15. Kettmann, R.,G.Marbaix,Y.Cleuter,D.Portetello,M. Mam-merickx, and A. Burny. 1980. Genetic integration of bovine leukemiaprovirusand lackof viral RNAexpressionin thetarget cellsof cattle with different responses to BLVinfection. Leu-kemia Res. 4:509-515.

16. McDonald, H. C., andJ. F.Ferrer. 1976. Detection,

quantita-tion andcharacterization of themajorinternal virionantigenof the bovine leukemia virusbyradioimmunoassay. J.Natl.

Can-cerInst.57:875-882.

17. Messing, J.,andJ.Vieira. 1982. Anewpairof M13 vectorsfor selecting either DNA strand ofdouble-digest restriction frag-ments.Gene 19:269-276.

18. Ming-CheWu, R.,D.Shanks,andH.A. Lewin. 1989.Milk and fatproductionindairycattleinfluencedbyadvanced subclinical bovine leukemia virus infection. Proc. Natl. Acad. Sci. USA 86:993-996.

19. Montagna,R.A.,L.Papsidero, and B.J.Poiesz. 1991. Evalua-tion ofasolid-phase immunoassayfor thesimultaneous detec-tion of antibodies tohuman immunodeficiencyvirustype1and human T-cell lymphotropic virus type I. J. Clin. Microbiol. 29:897-900.

20. Piper, C.E., J.F.Ferrer,D. A.Abt,and R. R. Marshek. 1975.

Seroepidemiological evidence for horizontal transmission of bovineC-typevirus. Cancer Res. 35:2714-2716.

21. Piper,C.E.,J.F.Ferrer,D. A. Abt,and R. R. Marshek. 1979. Postnatal and prenatal transmission of the bovine leukemia virus under natural conditions.J.Natl. CancerInst.62:165-168. 22. Rosen,C., J. Sodroski, L.Willems, R.Ketmann, K.Campbell,

R. Zaya, A. Burny, and W. Haseltine. 1986. The 3' region of bovine leukemia virus genome encodes a trans-activator

http://jcm.asm.org/

(7)

tein. EMBOJ. 5:2585-2589.

23. Sagata, N.,T. Yasunaga, J. Tsuzuku-Kawamura, K. Ohishi, Y. Ogawa, and Y. Ikawa. 1985. Complete nucleotide sequenceof

thegenomeof bovine leukemia virus: its evolutionary relation-shiptoother retroviruses. Proc. Natl. Acad. Sci. USA 82:677-681.

24. Saiki, R.,D.Gelfand, S. Stoffel, S. Scharf, R. Higuchi, G.Horn,

K. Mullis, and H. Erlich. 1987. Primer-directed enzymatic amplification of DNA with athermostable DNA polymerase.

Science 239:487-491.

25. Saiki, R., S.Scharf, F. Faloona, K. Mullis, G. Horn, H. Erlich, and N. Arnheim. 1985. Enzymatic amplification of 3-globin genomicsequencesand restriction siteanalysis fordiagnosis of sickle cell anemia. Science 230:1350-1354.

25a.Sambrook, J., E. F. Fritsch, and T. Maniatis (ed.). 1989. Molecularcloning: alaboratory manual, p. B.13. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y.

26. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA

sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.

USA 74:5463-5467.

27. Stock, N. D., and J. F. Ferrer. 1972. Replicating C-type virus in phytohemagglutinin-treated buffycoatcultures of bovineorigin. J. Natl. Cancer Inst. 48:985-996.

28. Van den Broeke, A., Y. Cleuter, G. Chen, D. Portetelle, M. Mammerickx, D.Zagury, M. Fouchard, L. Coulombel, R.

Kett-mann, and A. Burny. 1989. Even transcriptionally competent

proviruses are silent in bovine leukemia virus induced tumor

cells. Haematol. Bluttransfus.32:428-432.

29. Van der Maaten, M. J., and J. M. Miller. 1975. Replication of bovine leukemia virus inmonolayer cell cultures. Bibl. Haema-tol. 43:360-362.

30. Weiss, R., H. Varmus, and J. Coffin (ed.). 1984. RNAtumor

viruses. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

31. Williams, A. E., C. Y.Fang, D. J. Slamon, B. J. Poiesz, S. G. Sandler, W. F. Darr, and G. Shulman. 1988. Seroprevalence and epidemiological correlates of HTLV-I infection in American blooddonors. Science 240:643-646.

http://jcm.asm.org/