JOURNALOFCLINICAL MICROBIOLOGY,June1990, p. 1204-1213 0095-1137/90/061204-10$02.00/0
Copyright ©1990,AmericanSociety for Microbiology
Specific Detection of Mycobacterium tuberculosis Complex Strains
by Polymerase Chain Reaction
PETER W. M. HERMANS,1*ANJA R. J. SCHUITEMA,2 DICK VAN SOOLINGEN,' CEES P. H. J. VERSTYNEN,2 ELISABETH M. BIK,' JELLE E. R. THOLE,2 AREND H. J. KOLK,2AND JAN D. A.VAN EMBDEN' National Institute of Public Health and Environmental Protection, P.O. Box 1, 3720 BA Bilthoven,' and N. H. Swellengrebel Laboratory of Tropical Hygiene, Royal Tropical Institute, 1105AZAmsterdam/ TheNetherlands
Received1December 1989/Accepted 12March 1990
During thescreening ofaMycobacterium tuberculosis lambdagt-11genelibrary with monoclonalantibodies, we detected a recombinant clone, lambda PH7311, which contained a mycobacterial DNA insert that hybridized specifically with DNA ofM.tuberculosiscomplexstrains. Partofthisinsertwassequencedandused for the development ofan M. tuberculosis complex-specific polymerase chain reaction (PCR). Only strains belongingtospeciesof the M. tuberculosis complexgroupcontainedanamplifiablefragment of 158 base pairs (bp). This fragment was absent in all strains tested belonging to 15 other mycobacterial species. After amplification by PCR and dot blot hybridization with a digoxigenin-labeled oligonucleotide, the limit of detection ofpurified genomicM. tuberculosis DNA amountedtoaquantity correspondingto20 bacterial cells. By this techniqueabout i03M. tuberculosisbacteriaweredetectable in sputum.UsingPCR,wewerealso able todetectM. tuberculosis cells in clinical material suchaspleuralfluid, bronchial washings, and biopsies, and theseresultswerecomparable with those obtainedbyclassicalbacterial culture. Of 34M.tuberculosis strains, 5 didnot carry theamplifiable 158-bp fragment, whichoccurs usuallyas asingle copy in the chromosome. Evidence is presented that the 158-bp fragment is locatednear arepeatedsequence inthe chromosome. We presumethatstrainswhich do notcarrythe 158-bp fragment havelostachromosomalsegmentbyagenetic rearrangementinduced by the repetitive DNAelement.
Although a presumptive diagnosis of tuberculosis can be madeonthebasis of patient histories, clinical and radiolog-icalfindings, and the presenceofacid-fastbacilli in patient specimens, the isolation of Mycobacterium tuberculosis, Mycobacterium africanum, or Mycobacterium bovis is re-quired for the definitive diagnosis of tuberculosis. Routine cultures are cumbersome and time-consuming. For that reason,thedevelopmentofamorerapid methodtodiagnose thediseaseis highlydesirable.
Microscopic examination ofsmears of acid-fast bacteria by Ziehl-Neelsen staining is the most rapid method for detection ofmycobacteria, but it is insensitive and nonspe-cific. A major limitation of immunological detection of infections with M. tuberculosis by nonculture methods, such as latex agglutination, radioimmunoassay, and enzyme-linked immunosorbent assay, is their lack of sensitivity and/orspecificity (13, 15, 43). Serological techniquesmaybe useful insomeclinical settings, but this approach is limited, in general, due topoor sensitivity and/or specificity (3, 24, 25). Great progress has been made in reducing the time requiredtodetect growth ofmycobacteria bymeasuring the radioactivity of carbon dioxide, produced as a result of 14C-labeled growth substrate of mycobacteria in a highly selective growth medium(BACTECsystem;Johnston Lab-oratories,Inc., Towson, Md.). However, on average, 10to
12daysarestillneededtodetect mycobacterial growth from clinicalspecimensortocarryoutsusceptibilitytests(12, 23, 32).
Recentadvances in DNAtechniques haveprovidedanew approachtorapiddiagnosis of mycobacterial disease by the useofspecies-specific nucleic acid probes (4, 14, 33, 39). An oligonucleotide probe, based on the 16S rRNA gene
se-quenceofM. tuberculosis, is commercially available
(Gen-* Correspondingauthor.
Probe, San Diego, Calif.). This probe permits the identifica-tion of the species M. tuberculosis, and other similar species-specific probes have been developed for
Mycobac-terium avium andMycobacterium intracellulare (7, 30, 35). The sequenceofpartof the 16S rRNAgeneof Mycobacte-riumlepraewasrecentlypublished (6), permitting the
devel-opmentof similar DNA probes for the diagnosis ofleprosy. Although DNA probes are very specific, the methods still suffer from poorsensitivity, becauseatleast 106organisms are required for a reliable identification. Therefore, these methods are not useful for direct detection ofpathogenic mycobacteria in clinical samples (28).
Therecently developed polymerase chain reaction (PCR) permits the in vitroamplification of DNAsegments(34), and this technique has been shown to increase the level of detection enormously. By extracting DNA from clinical samples, amplifyingapathogen-specific DNAsequence,and detecting the amplified sequencewitha labeled oligonucle-otide probe, it is theoretically possible to detect a single microorganism in clinical samples (17). The PCR has already found wide application, such as the detection of specific DNAsegmentsof humanimmunodeficiencyvirustype1, the causative agent of acquired immunodeficiency syndrome, long before seroconversion (9, 16; W. J. A. Krone, J. Sninsky, and J. Goudsmit, submitted forpublication). The sequenceof the M.leprae36-kilodalton(kDa)genewasused forthe specific recognition of M. leprae by using the PCR (10). Hanceetal. (1,8) used primers basedonthe evolution-arily well-conserved 65-kDa heat shockgenefor the ampli-fication by PCR of a small DNA segment. The amplified product was subsequently identified bythe use of oligonu-cleotideprobes that selectively hybridizedwith DNAfrom M.tuberculosis-M.bovis,M.avium-Mycobacterium
paratu-berculosis, orMycobacterium fortuitum.
During a screening ofa lambdagt-11 gene library ofM.
1204
Vol. 28,No. 6
on April 12, 2020 by guest
http://jcm.asm.org/
TABLE 1. Bacterial strainsusedin this study
Strain(s) Species Relevantproperties Reference or source
1 Mycobacteriumtuberculosis H37Rv RIVMa
2 Mycobacteriumtuberculosis H37Ra RIVM
3-11 Mycobacteriumtuberculosis Clinicalisolates (Ghana) T.v.d. Werfb
12-34 Mycobacteriumtuberculosis Clinical isolates KITc,RIVM
35-38 Mycobacterium africanum Clinical isolates KIT,RIVM
39-42 Mycobacterium bovis Clinical isolates KIT, RIVM
43-45 Mycobacterium bovis BCG RIVM
46 Mycobacterium microti F.Portaelsd
47-51 Mycobacteriumavium KIT, RIVM
52-54 Mycobacteriumkansasài KIT,RIVM
55 Mycobacterium intracellulare KIT
56 Mycobacterium intracellulare ATCC 15895 ATCCe
57 "Mycobacterium lufu" KIT
58-60 Mycobacterium fortuitum KIT, RIVM
61 Mycobacterium gastri KIT
62 Mycobacterium chelonei KIT
63-65 Mycobacteriumscrofulaceum KIT,RIVM
66, 67 Mycobacteriumsmegmatis ATCC 607 andATCC10143, respectively ATCC
68 Mycobacteriumduvalii KIT
69 Mycobacterium vaccae KIT
70-89 Mycobacterium gordonae RIVM
90 Mycobacterium leprae KIT
91 ADMf KIT
M1183 Escherichiacoli POP2136(XcI857) A.Raibaudg
M1494 Escherichia coli M1183containing pEX2 K. Stanley(38)
a RIVM, National Institute of Public Health and Environmental Protection, Bilthoven,TheNetherlands. b Sophia Hospital, Zwolle,TheNetherlands.
C KIT,N.H. Swellengrebel Laboratory ofTropical Hygiene, Royal Tropical Institute, Amsterdam,TheNetherlands.
dPrince Leopold InstituteofTropicalMedicine,Antwerp,Belgium. eATCC, American Type Culture Collection, Rockville, Md.
fADM,Armadillo-derived mycobacterium. gInstitut Pasteur, Paris,France.
tuberculosis with monoclonal antibody species, aparticular recombinant was obtained that carried an M. tuberculosis DNA insert that hybridized virtually specifically to DNA frommycobacterial species belongingtotheM. tuberculosis complex. Inthisstudywe show thatapartof thisparticular insert carries DNA which occurs in many copies in the chromosome. We usedthe sequencefromthenonrepetitive
partof this insertforamplification byPCRand forrapidand sensitivedetection ofmycobacteria from theM.tuberculosis complexgroupinclinical samples.
MATERIALS AND METHODS
Bacterial strains and plasmids. The bacterial strains are listed inTable 1. The M. tuberculosiscomplex strainswere isolated fromDutchpatientsunlessotherwisestated.Media, reagents, and enzymes were used as described previously (41). All mycobacterial strains were cultured in Tween-albumin medium on a rotary shaker at 37°C (protocol: Division of Research and Laboratories, National Jewish Hospital, Denver, Colo.). NZ medium and NZagar supple-mented withappropriate antibiotics were used forgrowing Escherichia coliK-12cells (18).
Preparation of DNA. Mycobacterial cultures of 400 ml were growntoanoptical densityat600nmof 0.6, D-glycine was added to afinal concentration of 1%, and the cultures werereincubated for24h. Cellswere harvested by centrif-ugationandsuspendedin 5mlof50mMTris hydrochloride-5 mM EDTA, pH 8.0. Lysozyme was added to a final concentrationof1mg/ml,and themixturewasincubated for 90 min at 37°C. Proteinase K and sodium dodecyl sulfate were added to final concentrations of0.1 mg/ml and 1%,
respectively,
and theincubation wascontinuedfor 10minat65°C.
The mixturewasphenol
extracted andethanolprecip-itated,
andmycobacterial
DNAwasdissolvedin 0.5 mlof10 mMTrishydrochloride-1
mMEDTA, pH
8.0(18).
Standardprocedures
wereused for theisolation of chromosomalDNA ofE. coli K-12 strain M1183 andplasmid
DNA ofE. coli K-12 strain M1427(18).
Synthetic
oligonucleotides.
On the basis of thepartial
sequence of
pPH7301,
threeoligonucleotides
weresynthe-sized, using
aDNAsynthesizer
(Applied
Biosystems,
Inc., FosterCity,
Calif.).
Oligonucleotides
A(5'GGTCCTGAC
GGTAATGGGGT),
D(5'CGCCCATCCACATCCCGCCC),
and E
(5'GGACATCTCTGTTCCATCCA)
correspond
tobase
pairs (bp)
31 to50,
169 to188,
and 99 to118,
respec-tively, of the M. tuberculosis DNA sequence. Residue 1corresponds
to the firstmycobacterial
base downstream from cro-lacZ' inpPH7301.
Oligonucleotides
A and D arecomplementary to the
plus
and minus strands of the pPH7301 sequence,respectively,
andpositioned
118bp
apart. Two
homologous
regions
within the genesencoding
the65-kDa
antigens
ofM.leprae
(22)
andM.bovis BCG-M. tuberculosis(36, 41)
wereselectedand usedforsynthesizing
the
oligonucleotides
1P and2P,
asdescribedby
Hartskeerletal.
(10).
Oligonucleotides
1P(5'CTCAAGGAGCGCAAG-CACCG)
and2P(5'TTGAAGGCGATCTGCTT) correspond
to residues 1734to 1754 and 1920 to
1937,
respectively,
of the65-kDa heatshockprotein
geneasdescribedby
Tholeetal.
(41)
and arecomplementary
to theplus
and minusstrands,
respectively,
of this gene.Labeling of DNA probes. The
mycobacterial
DNAfrag-ments of
pPH7301
aswellas the158-bp
amplified
fragment
ofpPH7301 were labeled with
[fr-32P]dCTP,
using
aon April 12, 2020 by guest
http://jcm.asm.org/
1206 HERMANS ET AL.
tiprime
DNA-labelingkit(Amersham Internationalplc, Am-ersham, United Kingdom). The oligonucleotide E was la-beled with digoxigenin dUTP (Boehringer GmbH,Mannheim,
FederalRepublic of Germany)according
to the instructions of the manufacturer.Southern blot hybridization. Chromosomal digests and PCR-amplified DNA were electrophoretically separated on 0.8 and 1.5%agarose
gels, respectively, containing
ethidium bromide (500ng/ml).
After denaturation and transfer to aGeneScreen Plus membrane (Dupont,NEN Research Prod-ucts,Boston, Mass.) byvacuumblotting (27, 37) (MilliblotV system;
Millipore Corp., Bedford,
Mass.), the DNA washybridized
as describedby
Noordhoek et al. (26). 32p_ labeledprobes were hybridized and washed at65°C. Mem-braneswereexposed for variable lengths oftime at -70°Cto X-Omat film (Eastman Kodak Co., Rochester, N.Y.).Digoxigenin-labeled
probes were hybridized and washed at37°C according
to the instructions of the manufacturer. Dot blothybridization. Theamplified
DNAwasdiluted five times with10 mM Trishydrochloride-1
mMEDTA(pH 8.0), denatured for5minat100°C,andkeptonice.Samples of100idl
were spotted onto GeneScreen Plus filters, using the Minifoldsystem(Schleicher & Schuell GmbH, Dassel, Fed-eralRepublic of Germany).The blots weretreated with 0.4 MNaOHfor3 min and neutralizedwith1MTris hydrochlo-ride (pH8.0)
for 3 min. Hybridization and washing were done asdescribed above.PCR. The PCR with thermoresistant DNA polymerase from Thermus aquaticus (Taq polymerase; The Perkin-Elmer
Corp.,
Norwalk, Conn.) was done as recommendedby
themanufacturer. OneunitofTaqpolymerasewasadded to 100 ,ul of50 mM NaCl-5 mM MgCl2-10mMTris hydro-chloride-0.01%(wt/vol)
gelatin (pH 9.6)-0.2mMeach of thedeoxynucleotides dGTP,
dATP, dTTP, and dCTP(Pharma-cia, Uppsala, Sweden)
(pH 9.6)and,
unless otherwiseindi-cated,
100ngoftarget DNAand150ngof eachprimer.
DNA wasamplified
in aPCRprocessor(Biomed GmbH, Theres, FederalRepublic of Germany), using 35 cycles asfollows: 2-min denaturation at 94°C, 2-minannealing
at 55°C, and 3-minprimer
extensionat72°C.
After 35 cycles ofamplifi-cationthe mixtures were
analyzed by
agarose gelelectro-phoresis,
Southernblotting, and/ordotblotting.Clinical samples. Clinical
specimens
from tuberculosispatients
as well aspatients
who weresuspected
to have tuberculosisweredeterminedby
PCR.Sputum samples
(no.052, 400629,
400676, 400699, 400739,and400777)andalung
tumor
biopsy
(no. 400674) were taken frompatients
withpulmonary tuberculosis,
which had been confirmedby
cul-turing
ofM. tuberculosis.Samples
of different clinicalori-gins
frompatients
whoweresuspected
to havepulmonary
tuberculosis (no. 400695, 400750, and 400781) and from
patients
whoweresuspected
tohaveextrapulmonary
tuber-culosis (no. 400635, 400651, and 400723) were alsoexam-ined. Samples fromthesepatientswithsuspected pulmonary andextrapulmonary tuberculosis wereM. tuberculosis cul-ture
negative.
DNA extraction from clinical samples. In orderto isolate DNAfromM. tuberculosisbacteria in clinical samples, 500
,ul
of 1 M NaOHwasadded toanequalvolume of thesample and themixturewaskeptatroomtemperature
for 10 min. A620-,ul
volumeof1 MNaH2PO4
wasadded,
andthesamples
were
centrifuged
for 10 minat 12,000 x g. Thepelletswere washed and suspended in 400 ,ul of 50 mM Tris hydrochlo-ride-5mMEDTA, pH8.0. Afterthe addition oflysozymeto 1mg/ml,
the samples were incubated at 37°C for 90 min. ProteinaseKandsodiumdodecylsulfatewereaddedtofinalconcentrationsof 1 mg/ml and 1%, respectively, and incu-bationwas continued for 30 minat60°C. In ordertopurify and concentrate the DNA, the mixtures were phenol ex-tracted and the DNAwasprecipitatedwith ethanol(18).The DNA wasfinallydissolved in 50 ,u1 ofdistilledwater.
RESULTS
Identification ofaDNAfragmentcharacteristic for species of the M. tuberculosiscomplex. After the screening of an M. tuberculosis gene library (44) of about 106 lambda gt-11 clones,the lambda PH7311 recombinantwasselectedasthe onlyonewhichexpressedaproteinthat reacted with mono-clonal antibody F116-5(Hermans et al., unpublished data). Lambda PH7311 contained a mycobacterial DNA insert of 2.4 kilobase pairs (kb), and it expressed a ,-galactosidase fusionproteinof about 126 kDa(datanotshown).The 2.4-kb EcoRImycobacterialDNAfragmentof lambda PH7311was
subcloned into expression vector pEX2, resulting in the recombinant plasmid pPH7301. As expected, pPH7301 in-ducibly expressed afusion protein ofthe same sizeas that expressed by lambdaPH7311.
The2.4-kbDNAinsert ofpPH7301wasusedtohybridize with genomicDNAfrom various strains ofM. tuberculosis and 10 othermycobacterial species. Morethan 10 different-size bands of
BstEII-digested
chromosomal DNA of M. tuberculosis reacted with the labeled 2.4-kb probe(Fig.
1). Comparable banding patterns were obtained by Southern blot analysis ofBstEII-digested
chromosomal DNA of six other strains of M. tuberculosis (data not shown). This suggests that the M. tuberculosis chromosome contains repeated sequences which sharehomology with the probe.Consistently, multiple
bands were also observed when M. tuberculosisDNAwascleaved withoneof12other restric-tion enzymes, AvaI, BstEII, ClaI, EcoRI, FokI, MboII, NruI, PstI, PvuI, PvuII, RsaI, and StuI, andsubsequently
hybridized
with the probe (datanotshown).Allnon-M.tuberculosis strainstested
belonging
tospecies
ofthe M. tuberculosis
complex
group, M.africanum,
M. bovis,andMycobacterium microti,showedaBstEIIbanding patterncomparable
to that ofM. tuberculosis(Fig. 1).
In contrast, nohybridization
of the 2.4-kbfragment
wasfound with DNA fromM. avium,M.intracellulare,
M.fortuitum,
Mycobacterium
scrofulaceum,
andMycobacterium
smeg-matis. DNA from the two othermycobacterial species
tested,
Mycobacterium gordonae
andMycobacterium
kan-sasii,
hybridized
with the 2.4-kb EcoRIfragment
of M.tuberculosis
(Fig.
1,lanes 16 and19).
Again, multiple
bands wereobservedontheSouthernblots;
however, thebanding
pattern differed
completely
from that ofBstEII-digested
DNAofM. tuberculosis
complex
strains. Inaddition,
most bandswerelessintense,
indicating
alesserdegree
of homol-ogy with the 2.4-kbprobe.The2.4-kb
fragment
didnothybridize
with thepreviously
described
repetitive
M. tuberculosis sequences present in the recombinantbacteriophages
M13KE37 and M13KE115(5) (data
notshown).
In order to obtain information about the size of the
repetitive
sequence in pPH7301, variousfragments
of the 2.4-kb insert were labeled with 32P and used in Southern blotsofBstEII-digested
M. tuberculosisDNA.Asshown in Fig. 2, hybridizationwith each of thefive subfragments A, B,C,
D, and E(Fig.
3) resulted in the samecharacteristicbanding
pattern. However, certainfragments
hybridized
much more
strongly
withfragment
A thanwithfragment
C andvice versa,indicating
thatin the left arm ofthe 2.4-kbJ. CLIN. MICROBIOL.
on April 12, 2020 by guest
http://jcm.asm.org/
DETECTION OF M. TUBERCULOSIS COMPLEX STRAINS BY PCR
5 J O n19 1l0i. 3)13 4l1 16 17 18 19
r.!_j_*
11-a
wi
---.-,~~~_*
*~~~~~~~~tm *
«Min w-
-m -..
_
- -__ - _
_
_.
.d-oelm
e
FIG. 1. Southernblotanalysis ofBstEII-digestedchromosomalDNAof variousmycobacterialspecies, usingthe2.4-kbEcoRIfragment of pPH7301as aprobe. Lanes: 1,M.tuberculosis8; 2, M.tuberculosis 10; 3,M.tuberculosis 14; 4,M. tuberculosis 15; 5,M. tuberculosis 25; 6, M. tuberculosis22; 7,M. tuberculosis7; 8,M. tuberculosis3; 9,M. tuberculosis11; 10,M.tuberculosis5; 11,M. microti46; 12,M. bovis 41; 13, M. africanum 38; 14,M. avium 50; 15,M.fortuitum 60; 16,M.gordonae 71; 17,M. intracellulare56; 18, M.smegmatis,66; 19,M.kansasii 53. Numbersatleft indicate sizes of standard DNAfragmentsinkilobasepairs.
insertrepeats are presentwhicharepartially different from those in theright arm of this insert. This suggests that the repeatextendsto alarge portion ofthe 2.4-kbinsert.
M. tuberculosis complex-specific DNA amplification by PCR. Part of the 2.4-kb M. tuberculosis DNA insert was sequenced (Fig. 3). On the basis of this sequence two
oligonucleotides,AandD,weresynthesized,with the aimto use them as primers for amplification by PCR of chromo-somal M.tuberculosisDNAcorrespondingtobp 31 to 188 of the cloned 2.4-kb EcoRI fragment (Fig. 3). As expected, a
fragment of approximately158bpwasvisibleby agarose gel electrophoresis after amplification of either chromosomalM. tuberculosis DNAorpPH7301 DNA (Fig. 4A). In orderto confirm the identity of the amplified 158-bp fragment, this DNA washybridized with adigoxigenin-labeled oligonucle-otide, probe E, correspondingto bp99to 118. Indeed, this probe hybridizedwith theamplified fragmentofpPH7301,as well as with the M. tuberculosis amplified fragment (Fig. 4B). Chromosomal DNAs of the three other species ofthe M. tuberculosis complexweresubjected to PCR and South-ern blot analysis, and all were foundto contain the 158-bp amplifiablefragment(Fig.4). No suchfragmentwasfoundin M. avium,M.kansasii, M. intracellulare, M.fortuitum, M.
scrofulaceum,M. smegmatis, M.
leprae,
andM. gordonae. Asapositivecontrol for thesuccessfulDNAamplificationin vitro, the two primersPi
and P2, homologous toconserved regionsin the65-kDa heat shockproteingene(45),werealso added to the reaction mixture. Hartskeerl et al. (10) have shown that theseprimers enable theamplificationofa204-bpDNA fragmentofmycobacteria and also of other bacterial generaand evenofeucaryotic DNA. This 204-bpfragment wasamplified byusing DNA from allmycobacterial strains tested (Fig. 4). This fragment, however, did not hybridize with probe E, confirming that this probe is specific forthe 158-bpsequence inpPH7301.
Atotalof91 mycobacterial strains belongingto 19species
weretestedby PCR and dot blothybridization, using oligo-nucleotide probe E (Fig. 5 and Table 2). None of the 45 strains not belonging to species of the M. tuberculosis complex contained the 158-bp fragment. In contrast, all strains of the species M. africanum, M. bovis, and M. microti and 29 of 34 M. tuberculosis strains tested were
positive by PCR analysis. A negative result in the dot blot assay may be due to the fact that the chromosomal DNA doesnotcontainsequencescomplementarytooneofthetwo
amplimers or toprobe E. In these cases, the chromosomal
DNA may still hybridize to the amplified 158-bp fragment. To investigate this possibility, Southern blots were done with BstEII-digested DNAof the five PCR-negative strains and compared with a number ofPCR-positive M. tubercu-losis complex strains. The blots were hybridized with the 158-bp amplified M. tuberculosis fragment. None of the PCR-negative strains hybridized with the labeled 158-bp fragment, indicatingthat thisfragmentwasmissingin these strains. Conversely, in all
PCR-positive
strains a 1.3-kb BstEIIfragment hybridized with the 158-bpprobe(Fig.
6). The only significant difference between thePCR-positive
and PCR-negative strains was found in the presence or
VOL. 28, 1990 1207
on April 12, 2020 by guest
http://jcm.asm.org/
1208 HERMANS ET AL.
1 2 3 4 5
+.e.
.~~~~~~~~..w
_» e
_M me
FIG. 2. Southern blotanalysis ofBstEII-digestedDNAfrom M. tuberculosis 16, hybridized with the following: lane 1, 450-bp
EcoRI-SmaI fragment A; lane 2, 950-bpSmaI-EcoRIfragment B; lane3,1.0-kbSmaI-SmaIfragment C; lane 4,900-bpEcoRI-BssHII fragmentD; lane 5, 1.5-kbBssHII-EcoRI fragment E. Numbers at left indicate sizes ofstandardDNAfragments inkilobasepairs.
EcoPJ Smel BSHI Smai Xnrr EcoRJ
r
r-ro-LacZ
a
c
b d
e
30 60
EcoRI . pRrimer A
GAATTCCGAGTAACTGACGAGCACGGGCGGGGTCCTGACGGTAATGGGGTTGACGGTGAT GluPheArgValThrAspGluHisGlyArgGlyProAspGlyAsnGlyValAspGlyAsp
90 120
probe E
GGAGCCGACATGGACGGCGGGGTCGAGGCCCAAGTGAATGGATGGAACAGAGATGTCCGG GlyAlaAspMETAspGlyGlyValGluAlaGlnValAsnGlyTrpAsnArgAspValArg
150 180
primer D GATGGCGATCGGGCCGATGCCACCGACCGCGGCGAAGCCGACCGGAATGGGCGGGATGTG AspGlyAspArgAlaAspAlaThrAspArgGlyGluAlaAspArgAsnGlyArgAspVal
210 240
GATGGGCGGCAGCACGGTAATCGGGCCGATCCCGCCGCTGACGTCGGCGCCCACCGCGGG
AspGlyArgGlnHisGlyAsnArgAlaAspProAlaAlaAspValGlyAlaHisArgGly FIG. 3. Physicalmapof pPH7301 andDNAsequenceofpartof the mycobacterial insert in pPH7301. The predicted amino acid sequence and the synthetic oligomers are also depicted. a to e, FragmentsA toE asdefined in the legendtoFig. 2.
absenceof the 1.3-kb band. The two species not belonging to the M. tuberculosis complex group, M. gordonae and M. kansasii, which hybridized with the 2.4-kb insert of pPH7301, did nothybridize with the 158-bpprobe.
Sensitivity of the PCR. The sensitivity of the PCR test to detect M.tuberculosisDNAwasdeterminedby PCR ampli-fication of10-foldserialdilutions of pPH7301 and ofpurified chromosomalM. tuberculosisDNA,usingprimersAand D. AmplifiedDNA wasdenatured andprobed with oligonucle-otide E by dot blot and Southern blot hybridization. One femtogram of pPH7301 DNA was clearly detectable after PCR, corresponding to about 100 plasmid DNA molecules (Fig. 7). The
detection
limitofchromosomalM. tuberculosisDNA was 100fg, a quantitytheoretically corresponding to about 20 bacteria. To investigate the sensitivity of the PCR testwith wholebacteria, 10-fold dilutions of M. tuberculosis cellsweremade ineitherbuffersolution or in sputum from a healthy person. DNAextractions weredone asdescribed in Materials and Methods. After M. tuberculosis complex-specificPCR, samples were analyzed by DNAhybridization with oligonucleotide E. The detection limit amounted to about 200 bacteriafor cells suspended in buffer and 1,000 bacteria for cells suspended in sputum (Fig. 7 and 8).
Detectionof M.tuberculosisinclinical material. In order to investigate the use of the M.
tuberculosis
complex-specific PCR test in clinical samples, DNA was extracted from sputumspecimens, urine specimens, tumor biopsies, pleural fluids, and bronchial washings from patients withdifferent clinical symptoms. All clinical samples which were Ziehl-Neelsenpositive and M. tuberculosis culture positive were alsopositivein thePCRtest(Table 3). We also investigated sputa of a tuberculosis patient during isoniazid-rifampin-pyrazinamide treatment. Theculture-positive sputum of this patient was also positive in the PCR test, and this testwaspositiveupto16weeksaftertreatment,althoughnobacteria couldbeculturedafter4weeks andnobacteriawerevisible after 14 weeks (Table 3). Thisindicates that the mycobac-teria were killed after the onset of the multiple-drug treat-mentand thatnonviablebacteriawerepresentevenafter 16 weeks of treatment.
DISCUSSION
The 2.4-kb mycobacterial DNA fragment of pPH7301 hybridized specifically with genomic DNA of all species belonging to the M. tuberculosis complex and hybridized weaklywithtwospecies,M. gordonae and M. kansasii, not belonging to this complex. No hybridization was detected with genomic DNA of M. avium, M. intracellulare, M. fortuitum,M. scrofulaceum, andM. smegmatis. Because of thespecificityofpPH7301, this clonewasusedtodevelopan M. tuberculosis complex-specific PCR. Partofthe 5'-prox-imal M. tuberculosis DNA insert of pPH7301 was se-quenced, and this sequence was used to develop a PCR-based test to detectM. tuberculosisinbacterial cultures. Of 46strainsbelongingtothe M. tuberculosis
complex,
includ-ingM.tuberculosis,
M.bovis,M. bovisBCG,M.africanum, and M. microti,41werepositivein thePCR test. Noneof45 non-M.tuberculosis
complex strains of14 different specieswerereactive in the PCR test,indicatingthe greatspecificity of thetest.
Wedeterminedthesensitivity of detectionofM. tubercu-losis by PCR in sputum, which was about 1,000 bacteria. This sensitivity compares favorably with the sensitivity of examination ofsmearsby Ziehl-Neelsen staining. The find-ing that sputum samples froma treated patient becameM.
tuberculosis
Ziehl-Neelsennegativebutremainedpositivein the PCR indicates the degree of sensitivity of this test. J. CLIN. MICROBIOL.on April 12, 2020 by guest
http://jcm.asm.org/
A 1.33.
9. )8
J
. 8
)3. b
-) 3
iX
B
i 4 5 b 7 8 9 1:... 12a_ 1sI45 16 1. 1 3 a. ' - bQ
Il i 5 l'
15n bp
FIG. 4. Agarose gel electrophoresis (A) and Southern blot analysis (B) of amplified DNAs of different mycobacterial strains. The oligonucleotide amplimer pairsA-Dand1P-2Pwereused in thePCR.Lanes: 1, pPH7301; 2, M.tuberculosis 1; 3, M. tuberculosis 16;4, M. tuberculosis 15; 5, M.tuberculosis8; 6, M. bovis 41; 7, M. bovisBCG45; 8, M. africanum 38;9, M. microti 46; 10, M. avium50; 11, M. kansasii53; 12,M.intracellulare56; 13, M.fortuitum60; 14, M.scrofulaceum64; 15, M. smegmatis 66; 16, M.gordonae71; 17, M.leprae
90.Oligonucleotide Ewasusedas aprobe forhybridization. Numbersatleft indicate sizes of standard DNA fragments in kilobasepairs.
Because the sensitivity of the PCR test was much greater
when purified chromosomal DNA was used, we conclude that our procedure to extract DNA from mycobacteria in clinical material isnot yet optimal. Nevertheless, the PCR
testperformed quite well when clinical samples of various origins were analyzed for the presence of mycobacterial amplifiable DNA.
1 2 3 4 5 6 7 8 9 10 11 12
B cD
D
-
H-FIG. 5. Dot blot analysis of PCR-amplified DNAs of several mycobacterial strains (Table 1) and hybridized with oligonucleotide
E. The various wells contained DNA from the following strains: A-1,distilledwater;A2, 12; A3, 1; A4, 3;A5, 4; A6, 13; A7, 14; A8, 15; A9, 16; A10,5; Ail, 17; A12, 6; Bi, 18; B2, 7; B3, 8; B4, 9; B5, 10; B6,11; B7, 32; B8, 19; B9, 20; B10, 21; B11, 22; B12, 23; Cl, 24; C2,25;C3, 26; C4, 27; C5, 28; C6, 29; C7, 30; C8, 31; C9, 33; C10, 34; Cil, 2; C12, 35; Dl, 36; D2, 37; D3, 38; D4, 39; D5, 40; D6, 41; D7, 42; D8, 43; D9, 44; D10, 45; Dli, 46; D12, 48; El, 49; E2, 53; E3, 54; E4, 56;E5,57;E6,59; E7, 60; E8, 61; E9, 62; E10, 64; E1, 66; E12, 68; Fl, 69; F2, 71; F3, 90; F4, pPH7301.
We think that the PCR test described here will be more sensitive than the PCR test describedbyHance etal. (1,8), because in the latter case the oligonucleotides used for priming the PCR amplify DNA ofthe evolutionarily
well-TABLE 2. Detection ofthe158-bpamplifiable fragment amongMycobacterium species
No.of No. ofstrains
Species strains tested carryingthe
158-bpfragment
M.tuberculosis 34 29
M.africanum 4 4
M.bovis 4 4
M. bovis BCG 3 3
M.microti 1 1
M. avium 5 0
M. kansasii 3 0
M. intracellulare 2 0
"M. lufu" 1 o
M.fortuitum 3 0
M.gastri 1 0
M. chelonei 1 o
M. scrofulaceum 3 0
M. smegmatis 2 0
M. duvalii 1 o
M. vaccae 1 o
M.gordonae 20 0
M. Ieprae 1 o
ADMb 1 0
aSpecific amplification ofthe158-bpfragmentbyamplimersAand Dwas
determinedbyusing probeEin the dotblothybridizationassay. Asapositive
control,amplimers1Pand 2Pwerealso addedtothePCR mixture. The204-bp
fragmentof the 65-kDaproteingene was visibly amplified, asdetectedby
agarosegelelectrophoresis.
bADM, Armadillo-derivedmycobacterium. ic
on April 12, 2020 by guest
http://jcm.asm.org/
1210 HERMANS ET AL.
i', .1 1-- 1 i l
--1
.. 1 1
.14 -.4 1-l' i .q 1'-il
i
-, 1 . -.1 ii-) L
_ u_
FIG. 6. Southern blot ofBstEII-digested DNAof mycobacterial strains, probed with the 158-bp PCR-amplified fragment ofpPH7301. Lanes:1, M. tuberculosis8; 2, M. tuberculosis 10; 3, M.tuberculosis 14; 4, M.tuberculosis15; 5, M.tuberculosis 25; 6, M. tuberculosis 22; 7,M.tuberculosis7; 8, M.tuberculosis3; 9,M. tuberculosis 11; 10,M.tuberculosis5; 11,M.microti46; 12, M. bovis 41; 13,M.africanum 38; 14,M.avium50; 15, M.fortuitum 60; 16,M.gordonae 71; 17,M.intracellulare 56; 18,M.smegmatis, 66; 29,M.kansasii 53. Numbers atleft indicate sizesof standard DNAfragments in kilobasepairs.
conserved sequence ofthe65-k] of any mycobacterial species a
(45). Thus, other non-M. tubers clinical samples might compete tuberculosisDNAduring the PC
A
1 i
FIG. 7. Sensitivityof DNA detect PCRamplification of highly purified obtainedby the short DNA extraction (CandD). Tenfold serial dilutions(1 to A10) and 10-fold serial dilution purifiedM. tuberculosis DNA(Bi ti
andsamplesweresubjectedtodot bl
was isolated from 10-fold serial dilt
(2.106to2.10-3)in 100 mM Tris hyc 8.0)(CltoC10) and from 10-foldser
cells(1.107to1.10-2) insputumfront Samples wereamplified by PCRanc
withprobe E. M. tuberculosis 12w2
Daheat shockprotein gene Of the 34M.tuberculosisstrainstested,5werenegative in Lnd other bacterial species the PCR test, and these 5 strains all lacked a 1.3-kb BstEII -ulosis cells also present in DNAfragment which was present in the 29 other strains and for amplification with M. which hybridized with the M. tuberculosis DNA insert of
,R. pPH7301. Although this fragment seems to be unique for
strains within the M. tuberculosis complex, monoclonal antibody F116-5,which recognizes the 126-kDa fusion pro-teinexpressed bypPH7301, isreactive witha24-kDaantigen present in allM. tuberculosisstrains,including the five PCR test-negative strains that lack the 1.3-kb BstEII fragment (datanotshown). Anexplanationfor thesefindings mightbe that monoclonal antibody F116-5 recognizes an epitope of the fusion protein expressed by pPH7301, created by the fusion of
P-galactosidase
and a mycobacterial polypeptide which is unrelated to the 24-kDa mycobacterial antigen. Similarly, Thole et al. (42) described the selection of a lambda gt-11 recombinant reactive with a monoclonal anti-ction bydot blot analysis after..DNA(Aand B) andof DNA body
recognizing
the M.leprae
36-kDaantigen.
Detailed
nprocedurefor clinicalsamplesanalysis
ofthis
recombinant
showed that the antibody rec-.ngto 0.001fg)ofpPH7301(Ai
ognized an epitope at thejunction of the cro-lacZ fusion s (10 ng to 0.01 fg) of highly which,by chance, sharedhomology with the naturalepitopeoB10) wereamplified by PCR, of the36-kDa M. leprae antigen (42).
lotanalysiswithprobeE.DNA Themultiple banding patterns observed in Southern
blots
utions of M. tuberculosis cells of
chromosomal
M.tuberculosis
DNAprobed
with the drochloride-10 mM EDTA(pH 2kchrosof
M. indicateDNA
pthe
rial dilutions of M. tuberculosis 2-4-kb insert ofpPH73O1 indicate that thisinsert contains aaahealthycontrol(DltoD10). repetitive sequence which is present in more than 10 copies
d subjectedto dotblotanalysis perchromosome. The banding patterns observed with sub-as used to extract DNA. fragments of the 2.4-kb insert indicate that the
repetitive
J. CLIN.MICROBIOL.
,,
on April 12, 2020 by guest
http://jcm.asm.org/
DETECTION OF M. TUBERCULOSIS COMPLEX STRAINS BY PCR
i 2 3 4 5 6 7 à 9 10
XH 12 13 14 15 1b 17 15 19 L0
l 2 3 4
``
5 e 7:;"X
8 k 1Oe; ..rA a, `, .,X 3E
.'i .xt
*_$#injj
.::
.' "
*
uu
.",uu,`;m'A-eA
l 12 3 14 15 16 ;7 18 19 20
FIG. 8. Sensitivityof detection of M. tuberculosis 12 after
am-plification by PCR. Agarose gel electrophoresis (A) and Southern blotanalysis(B)ofDNAisolatedfrom 10-fold serial dilutions ofM.
tuberculosis cells in either buffer (100 mM Tris hydrochloride-10 mM EDTA, pH 8.0) (lanes 1 to 10) or sputum from a healthy individual(lanes11to20). Lanes 1to10and 11to20correspondto
10-fold dilutions beginning with an equivalent of 2.105 bacteria.
DNAwashybridized with probeE.Numbersatleft indicatesizes of standard DNAfragments in kilobase pairs.
DNA isnotonlypresentin thecentral 1-kb SmaI fragment butextends to bothflanking regions.
The repetitive DNA described in this study differs from theM. tuberculosisrepeats identified by Eisenachetal. (5), as the 2.4-kb fragment did not hybridize to this repetitive DNA. Zainuddin and Dale (46) described a repetitive
se-quencethatwasdiscovered inM.tuberculosis because of its homology with a plasmid of M. fortuitum. This 1.3-kb element has recently been sequenced (40; R. A. McAdam, P. W. M. Hermans, D. van Soolingen, Z. F. Zainuddin, D. Catty, J. D. A. vanEmbden, and J. W. Dale, submitted forpublication), anditwasfoundtobeamember of theIS3 family of insertion elements occurring in gram-negative bacteria.Allof these repetitive genetic elementsare specific for species ofthe M. tuberculosis complex, and Southern blots demonstrated restriction fragment-length polymor-phisms which would be consistent with a putative role of these genetic elements in genetic rearrangements (11, 46; P. W. M. Hermans, D. vanSoolingen, J. W. Dale, A.R. J. Schuitema, R. A. McAdam, D. Catty, and J. D. A. van
Embden, submitted forpublication).
Ourobservation that 5 ofthe 34M. tuberculosis isolates lackeda1.3-kb BstEIInonrepetitive chromosomal segment,
whichflanked the repetitiveDNA, stronglysupportstheidea ofa role of suchrepeats ingenetic rearrangements. Other mycobacterium species-specific repetitive DNA has been identified in M. leprae (2) and in M.paratuberculosis (19).
Onlyin thelatterspecies has thepresenceofrepetitiveDNA
TABLE 3. Detection ofM. tuberculosisinclinical material by PCR
Detection of mycobacteriaby: Patient Sourceofclinical
(wk)' specimen Ziehl-Neelsen d
sannb Culture' PCRd
staining
400629 Sputum 3+ + +
400635 Urine ND -
-400651 Urine ND
400674 Tumorbiopsy 1+ + +
400676 Sputum 5+ + +
400695 Pleuralfluid
-400699 Sputum 3+ + +
400723 Urine ND
400739 Sputum 2+ + +
400750 Bronchial wash ND
400777 Sputum 1+ + +
400781 Bronchialwash
-052(0) Sputum 2+ + +
052(4) Sputum 1+ - +
052(6) Sputum 1+ - +
052(14) Sputum - - +
052(16) Sputum - - +
aWeeks afterstartof treatment.
b1+,105bacilliperml;2+,5.105bacilliperml;3+,10'bacilliperml;5+,
107bacilli per ml;-, noacid-fast bacillidetectable in 1-mlclinical sample, ND,Notdone.
CInallculture-positive samplesM. tuberculosiswasidentified.
dClinicalsampleswereanalyzed byPCR, using amplimersAandD. To verifytheamplificationof the158-bpfragment,oligonucleotideE wasusedin the dotblothybridizationassay.
been found to be associated with a particular phenotype: repeat-carrying strains differed from non-repeat-containing
onesin theirrequirementofmycobactin for growth, presum-ably because of insertional gene inactivation (19). Many insertion sequences occur in multiple copies, and a great number of these have been characterized in detail. Except for their ability to transpose and cause other genetic rear-rangements, they usually are not known to be associated with particularphenotypes of the hosts. Recently described repetitive DNA insertion elements have been identified in pathogens such as Bordetella pertussis (20, 21, 29) and Corynebacterium diphtheriae(31).Deletion ofDNAflanking
aninsertion element isonetypeofrearrangementmediated by insertionelements.Therefore, the absence in five strains ofa nonrepetitive 1.3-kb BstEII fragment flanking the M.
tuberculosis repeat stronglysuggests a role of the repeated DNA element in deletion of this adjacent chromosomal DNA.
Since fiveoftheM. tuberculosiscomplexstrains did carry a significant chromosomal deletion, one might speculate whether this deletion is phenotypically detectable. All five strains have been tested for biochemical properties and antimicrobial susceptibilities. However, no special deviant phenotypewasfound. Thefourinitially investigated strains weremissing the 1.3-kbBstEII chromosomal fragment, and all
originated
fromindividuals in West Africa. As the prev-alenceofhumanimmunodeficiency virusis veryhighinthis area, we speculated on the possibility that these strains mightlackcertainfunctionswhichareessentialfor survival of the bacterium in immunocompetent individuals. There-fore,twoof these strainswereinoculated inguineapigs,but no decreased virulencefor these animals wasobserved(D.vanSoolingen, unpublishedobservations). Thispreliminary resultcertainly does notexclude adecreasedpathogenicity of these strains. The other isolate lacking the 1.3-kb
frag-ment(M.
tuberculosis
25)wasfrom a DutchpatientwhohadA
0.
12 90.
12
O.
2
-1B
15c»
ba
158
b-nà
1211
VOL.28, 1990
on April 12, 2020 by guest
http://jcm.asm.org/
1212 HERMANS ET AL.
no clinical symptoms of acquired immunodeficiency syn-drome. No data are available about anti-human immunode-ficiency virus antibodies of this patient.
Inorder not tomiss1.3-kb BstEII fragment-lacking strains of M. tuberculosis, one probably could successfully use
primers derived from sequences solelywithin the repetitive DNA. We are in the progress ofsequencing the complete repeated DNA element,part ofwhich is present in recom-binant plasmid pPH7301. The presence of repeated se-quences in M. gordonae and M. kansasii which hybridize with thatidentified in M. tuberculosis, asmentionedinthis study, will probably not affect the design of M. tuberculosis complex-specific primersfor such aPCR, as the repeats of theformertwospeciesareonlypartiallyhomologous to that of M. tuberculosis.
Whatever the function might be ofrepetitive DNA ele-mentsfound in M.tuberculosis, they may be of great use for therapid detectionand identification of thispathogen whose characterizationbyclassicalmicrobiological techniquesisso
time-consuming because of its extremely slow growth.
ACKNOWLEDGMENTS
We thankE. Veringa (Leiden, The Netherlands), R. van Ketel (Amsterdam, The Netherlands), andL.G. Berwald(Bilthoven, The Netherlands) for providing us with clinical samples, F. Portaels (Antwerp, Belgium) andT. vander Werf(Zwolle, The Netherlands) forprovidinguswithmycobacterial strains,and A.Vilasi forperfect secretarial assistance.
Thisstudywasfinanciallysupported bythe WorldHealth Organ-isation Programme for Vaccine Development and the RoyalDutch
Organisation AgainstTuberculosis.
LITERATURE CITED
1. Brisson-Noël, A., D. Lecossier,X. Nassif,B. Gicquel, V. Levy-Frebault,andA.J.Hance. 1989.Rapid diagnosisoftuberculosis by amplification of mycobacterial DNA in clinical samples.
Lancetii:1069-1071.
2. Clark-Curtiss, J. E., and M. A. Docherty. 1989. A species specific repetitivesequenceinMycobacteriumleprae.J.Infect. Dis. 159:7-15.
3. Daniel, T.M.,andS. M. Debanne. 1987.Theserodiagnosisof tuberculosis and other mycobacterial diseases by enzyme-linked immunosorbentassay. Am.Rev. Respir.Dis. 135:1137-1151.
4. Drake, T. A., J. A. Hindler, O. G. W. Berlin, and D. A. Bruckner. 1987. Rapid identification ofMycobacterium avium
complex in culture using DNA probes. J. Clin. Microbiol. 25:1442-1445.
5. Eisenach, K. D., J. T. Crawford, and J. H. Bates. 1988. RepetitiveDNAsequencesasprobesforMycobacterium tuber-culosis.J. Clin. Microbiol. 26:2240-2245.
6. Estrada-G.,I. C.E.,F.I.Lamb,M.J. Colston,andR. A. Cox. 1988. Partial nucleotide sequenceof 16S ribosomal RNA iso-lated from armadillo-grown Mycobacterium leprae. J. Gen. Microbiol. 134:1449-1453.
7. Gonzalez, R.,andB.A. Hanna. 1987. Evaluation ofGen-Probe DNAhybridization systems for the identificationof Mycobac-terium tuberculosis and Mycobacterium avium-intracellulare. Diagn. Microbiol. Infect. Dis. 8:69-77.
8. Hance,A.J.,B.Grandchamp,V.Levy-Frebault,D.Lecossier, J. Rauzier,D.Bocart,and B.Gicquel. 1989.Detection and identi-fication of mycobacteria by amplification of mycobacterial DNA.Mol. Microbiol. 3:843-849.
9. Hart, C.,G.Schochetman,T.Spira,A.Lifson,J. Moore,andJ. Galphin. 1988. Direct detection of HIV RNA in seropositive subjects. Lancetii:596-599.
10. Hartskeerl,R. A., M. Y. L. de Wit, and P. R. Klatser. 1989.
Polymerasechainreactionforthedetection ofMycobacterium leprae.J. Gen. Microbiol. 135:2357-2364.
11. Higgins, C. F., G. Ferro-Luzzi Ames, W. M. Barnes, J. M.
Clement,and M. Hofnung. 1982.Anovel intercistronic regula-tory element of prokaryotic operons. Nature (London) 298: 760-762.
12. Hoffner, S. E. 1988. Improved detection of Mycobacterium avium complex with BACTEC radiometric system. Diagn. Microbiol. Infect.Dis. 10:1-6.
13. Kadival,G.V.,T. B.M. S.Mazarelo,and S. D.Chaparas.1986.
Sensitivity and specificity of enzyme-linked immunosorbent assay in the detection of antigen in tuberculous meningitis cerebrospinalfluids.J. Clin. Microbiol. 23:901-904.
14. Kiehn, T. E., and F. F. Edwards. 1987. Rapid identification usingaspecificDNAprobeofMycobacteriumaviumcomplex from patients with acquired immunodeficiency syndrome. J. Clin. Microbiol. 25:1551-1552.
15. Krambovitis, E., M. B. McIllmurray, P. E. Lock, W. Hen-drickse, and H. Holzel. 1984. Rapid diagnosis of tuberculous
meningitis bylatexparticle agglutination. Lancetii:1229-1231. 16. Laure, F.,C.Rouzioux,F.Veber,C.Jacomet,V.Courgnaud,S.
Blanche,M.Burgard,C.Griscelli,andC.Brechot.1988. Detec-tion of HIV-1 DNA in infants and children by means of polymerasechainreaction. Lancet ii:538-541.
17. Li, H.,U. B.Gyllensten,X.Cui,R.K.Saiki,H. A.Erlich,and N. Arnheim. 1988. Amplification and analysis of DNA
se-quencesinsinglehumanspermanddiploidcells. Nature (Lon-don)335:414-417.
18. Maniatis, T.,E. F.Fritsch, andJ. Sambrook. 1982. Molecular cloning:alaboratorymanual.ColdSpringHarborLaboratory, ColdSpring Harbor,N.Y.
19. McFadden, J. J.,P.D.Butcher, J. Thompson,R.Chiodini,and J. Hermon-Taylor. 1987. The use ofDNA probes identifying restrictionfragment length polymorphism toexamine the My-cobacteriumaviumcomplex. Mol.Microbiol. 1:283-291. 20. McLafferty, M. A., D. R. Harcus, and E. L. Hewlett. 1988.
Nucleotidesequenceandcharacterization ofarepetitiveDNA elementfrom the genome of Bordetellapertussis with charac-teristics of an insertion sequence. J. Gen. Microbiol. 134: 2297-2306.
21. McPheat, W. L., J.H. Hanson, I. Livey, andJ.S. Robertson. 1989. Analysisof separate isolates of Bordetellapertussis
re-peatedDNAsequences.J.Gen. Microbiol. 135:1515-1520. 22. Mehra, V., D. Sweetser, and R. A. Young. 1986. Efficient
mapping ofprotein antigenic determinants. Proc. Natl. Acad. Sci. USA83:7013-7017.
23. Morgan, M.A.,C. D. Horstmeier, D. R.DeYoung,andG. D. Roberts.1983.Comparisonofaradiometric method(BACTEC) and conventional culture media forrecovery ofmycobacteria fromsmear-negative specimens.J.Clin.Microbiol. 18:364-388. 24. Narayanan, R.P., G. S. Acharyulu, P. V. Krishnamurthy, A. Ravoof, andS. P. Tripathi. 1983. Evaluation of ELISA as a diagnostic test in pulmonary tuberculosis. Indian J. Tuberc. 30:29-34.
25. Nassau, E., E. R. Parson, and G. D. Johnson. 1976. The detection of antibodies toMycobacterium tuberculosis by mi-croplateELISA. Tubercle57:67-71.
26. Noordhoek, G. T., P. W. M. Hermans, A. N. Paul, L. M.
Schouls, J. J. van derSluis, andJ. D. A.van Embden. 1989. Treponema pallidum subspecies pallidum (Nichols) and Treponemapallidum subspeciespertenuedifferinatleastone
nucleotide: comparison oftwo homologous antigens. Microb. Pathog.6:29-42.
27. Olsewska, E., and K. Jones. 1988. Vacuum blottingenhances nucleic acid transfer. Trends Genet.4:92-94.
28. Pao, C.C., S.-S. Lin, S.-Y.Wu,and W.-M.Juang. 1988. The detection ofmycobacterialDNAsequencesinuncultured clin-ical specimens with clonedMycobacterium tuberculosis DNA
asprobes.Tubercle 69:27-36.
29. Park, I.,W.Saurin,and A.Ullmann.1988. Ahighlyconserved 530 base-pair repeated DNA sequence specific forBordetella pertussis. FEMS Microbiol. Lett. 52:19-24.
30. Peterson,E.M.,R.Lu,C.Floyd,A.Nakasone,G.Friedly,and
L.M. delaMaza.1989. Directidentification ofMycobacterium tuberculosis, Mycobacteriumavium,andMycobacterium intra-cellulare from amplified primary cultures in BACTEC media J. CLIN. MICROBIOL.
on April 12, 2020 by guest
http://jcm.asm.org/
using DNAprobes. J. Clin. Microbiol. 27:1543-1547.
31. Rappuoli, R.,M. Perugini, and G. Ratti. 1987. DNA elementof Corynebacterium diphtheriae with properties of an insertion sequence andusefulness for epidemiological studies. J. Bacte-nol. 169:308-312.
32. Roberts, G. D.,N. L. Goodman, L. Heifets, H. W. Larsh, T. H. Lindner, J. K. McClatchy,M. R.McGinnis, S. H. Siddiqi, and P. Wright. 1983. Evaluation of theBACTEC radiometricmethod for recovery of mycobacteria and drug susceptibility testing of Mycobacterium tuberculosis from acid-fast smear-positive specimens. J. Clin. Microbiol. 18:689-696.
33. Roberts, M. C., C. McMillan, and M. B. Coyole. 1987. Whole chromosomalDNAprobes for rapid identification of Mycobac-terium tuberculosis and Mycobacterium avium complex. J. Clin.Microbiol. 25:1239-1243.
34. Saiki,R.K., D. H.Gelfaiid,S.Stoffel,S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNApolymerase. Science 239:487-491.
35. Sherman, I., N. Harrington,A.Rothrock, andH. George. 1989. Use of acutoff rangeinidentifying mycobacteria by Gen-Probe rapid diagnostic system. J. Clin. Microbiol. 27:241-244. 36. Shinnick, T. M., D. Sweetser, J. Thole, J. van Embden, and
R. A. Young. 1987. The etiologic agents ofleprosy and tuber-culosis share an immunoreactive proteinantigen with the vac-cine strain Mycobacterium bovis BCG. Infect. Immun. 55: 1932-1935.
37. Southern, E. M. 1975. Detection of specific sequences among DNAfragments separated by gelelectrophoresis. J. Mol. Biol. 98:503-517.
38. Stanley, K. K., andJ. P. Luzio. 1984. Construction ofanew family of highefficiency bacterial expression vectors: identifi-cation ofcDNAclonescoding for human liver proteins.EMBO
J.6:1429-1434.
39. Tenover, F. C. 1988. Diagnostic deoxyribonucleicacid probes forinfectious diseases. Clin. Microbiol.Rev. 1:82-101. 40. Thierry,D., M. D. Cave, K. D.Eisenach,J. T. Crawford,J. H.
Bates, B. Gicquel, andJ. L. Guesdon. 1990. IS6110,anIS-like element ofMycobacterium tuberculosiscomplex. Nucleic Ac-ids Res. 18:188.
41. Thole, J. E. R., W.J. Keulen, A. H. J. Kolk, D. G.Groothuis, L.G. Berwald, R. H. Tiesjema, and J. D. A. van Embden.1987. Characterization, sequencedetermination,andimmunogenicity of a 64-kilodalton protein of Mycobacterium bovis BCG
ex-pressed inEscherichia coli K-12. Infect. Immun.55:1466-1475. 42. Thole, J. E. R., L. F. E. M. Stabel, M. E. G. Suykerbuyk, M. Y. L. de Wit, P. R. Klatser, A. H. J. Kolk, and R. A. Hartskeerl. 1990. A major immunogenic 36,000-molecular-weight antigen fromMycobacteriumleprae containsan immu-noreactive region of proline-rich repeats. Infect. Immun. 58: 80-87.
43. Yanez, M. A., M. P. Coppola, D. A. Russo, E. Delaha, S. D. Chaparas,andH.Yeager, Jr. 1986. Determination of mycobac-terial antigens in sputum by enzyme immunoassay. J. Clin. Microbiol. 23:822-825.
44. Young, R. A., B. R.Bloom, C. M. Grosskinsky, J. Ivanyi, D. Thomas, and R. W. Davis. 1985. Dissection of M. tuberculosis antigensusingrecombinant DNA. Proc. Natl. Acad. Sci.USA 82:2583-2587.
45. Young, D. B., J. Ivanyi, J. H. Cox, and J. R. Lamb. 1987.The 65 kD antigenofmycobacteria-a commonbacterial protein? Immunol. Today8:215-219.
46. Zainuddin,Z.F.,andJ.W.Dale. 1989. Polymorphic repetitive DNAsequencesinMycobacterium tuberculosis detectedwith a geneprobe fromaMycobacterium fortuitum plasmid. J. Gen. Microbiol. 135:2347-2355.