Test 1 2007
1. Which of the following statements is correct?
1 0.004 a) a reaction is said to be spontaneous when it can proceed in either the forward or reverse direction.
0 0.000 b) a spontaneous process always happens very quickly.
243 0.957 c) a nonspontaneous reaction will proceed spontaneously in the reverse direction.## 3 0.012 d) a spontaneous process can occur only if there is a large decrease in entropy. 7 0.028 e) none of the rest.
c
2. Consider a reaction with delta H = 30 KJ and delta S = 100 J/K, the reaction is spontaneous at
0 0.000 a) 10 degree C 2 0.008 b) 15 degree C 0 0.000 c) 20 degree C 1 0.004 d) 25 degree C 251 0.988 e) 30 degree C##
use Joules, use Kelvin
dG= dH - TdS
spontaneous means dG is negative dG = (30 000) - (273 + x)(100)
using 30 degrees, dG = -300 therefore spontaneous
3. The volume of a solution of 0.5 M HCl that must be added to adjust the pH from 9 to 4 in 20 mL of a 100 mM solution of phosphoric acid is:
2 0.008 a) 1 mL 27 0.106 b) 2 mL 4 0.016 c) 3 mL 219 0.862 d) 4 mL## 2 0.008 e) 5 mL
use c=n/v
when pH = 9, all phosphoric acid in form HPO4 (2-) since pKa is higher than 6.82 (for H2P04-) but lower than pKa for HPO4 (12.38)
.02 L of 0.1 M phosphoric acid, n = 0.1*.02 = 0.002 mol phosphoric acid for HCl: v = n/c = 0.002/.5 = 0.004 L = 4 mL
2 0.008 a) I & IV 5 0.020 b) II & III 18 0.071 c) III & IV 3 0.012 d) II & V 226 0.890 e) III & VI##
don't lose H's until in basic range
5. Indicate the ionic species that predominate at pH 8 I: Succinate(-2) II: Succinate(-1) III: Succinic acid IV: H2CO3 V: HCO3(-) VI: CO3(-2) 16 0.063 a) I & IV
3 0.012 b) II & III 7 0.028 c) III & V 225 0.886 d) I & V## 3 0.012 e) III & VI
refer to pK values
6. What is the effective buffering range of HEPES? 10 0.039 a) 6.2-8.2
238 0.937 b) 6.5-8.5## 1 0.004 c) 1.5-3.5 5 0.020 d) 7.1-9.1 0 0.000 e) 3.5-11.5
HEPES pK = 7.5, so buffer range is 7.5-1 and 7.5+1
7. The pH of a 1L solution containing 1 mL of 10 mM SHS, 1 mL of 10 mM MOPS and 20ml of 5M HCL is (MOPS:pK=7.2; SHS:pK=5.5):
238 0.937 a) 1## 4 0.016 b) 1.5 3 0.012 c) 2.0 7 0.028 d) 2.5 2 0.008 e) 3.0
how do we do this? calculate #mol of HCl, and do pH=-log(H+) which means -log(0.1) = 1? do we not take buffers into account because the #mol of H+ does not lie within that buffer range?
8. Which of the following statements is correct regarding buffer strength at pH = 6.4 (MOPS:pK=7.2; SHS:pK=5.5)?
9 0.035 a) MOPS is more effective against acid and SHS is more effective against base 238 0.937 b) MOPS is more effective against base and SHS is more effective against acid## 4 0.016 c) MOPS is more effective against both acid and base
b is obvious, MOPS = 6.2-8.2 (basic) whereas SHS is 4.5-6.5 (acidic, has lower pK)
9. Which of the following lists is the best choice of buffers for pH 3.8, 6.1 and 8.1 respectively 0 0.000 a) Tris, Succinic and Ammonia
249 0.980 b) Formic, MES, Tris## 0 0.000 c) Succinic, Tris and HEPES 4 0.016 d) Succinic, HEPES and Ammonia
1 0.004 e) HEPES, Phosphoric acid and Ammonia
need list to tell, match up pH to pK values
10. Absorption of food in the stomach and intestine depends on the ability of molecules to penetrate the cell membranes and pass into the bloodstream. Because hydrophobic molecules are more likely to be absorbed than hydrophilic or charged molecules, the absorption of orally administered drugs may depend on their pKa values and the pH in the digestive organs. If aspirin has an ionizable carboxyl group (pKa = 3.5). The fraction of aspirin available for absorption in the stomach (if pH=4.5) is
240 0.945 a) 1 /11## 4 0.016 b) 10/11 6 0.024 c) 1/101 1 0.004 d) 100/101 3 0.012 e) 1/1
- henderson hasselbach
- figure out what is A- what is HA, and what question wants
11. Which of the following species is not Bronsted-Lowry acids? 0 0.000 a) HCOOH
4 0.016 b) NH4(+) 1 0.004 c) H2O 247 0.972 d) NH3## 2 0.008 e) H2PO4(-)
acid can donate H, so d cannot
12. The pH of a 100 mL solution containing 50 mL of 1M acetic acid and 4.1g of sodium acetate (formula weight 82g/mol; pK=4.76) is
5 0.020 a) 2.76 18 0.071 b) 3.76 212 0.835 c) 4.76## 15 0.059 d) 5.76 4 0.016 e) 6.76
13. Which of the following restriction enzymes produce blunt ends (see Table 2)? 1 0.004 a) BamHI, HaeIII, PvuII, AluI
4 0.016 b) AluI, PvuII, BglI, EcoRV 0 0.000 c) EcoRV, EcoRI, HaeIII, PvuII 247 0.972 d) PvuII, EcoRV, HaeIII, AluI## 2 0.008 e) all of the rest
blunt ends are symmetrical
14. Which of the following restriction enzymes produce identical sticky ends (see Table 2)? 167 0.657 a) BamHI and BglII##
3 0.012 b) HpaII and XhoI 1 0.004 c) SalI and TaqI
50 0.197 d) All of the answer pairs 33 0.130 e) none of the rest
sticky ends must be identical to each other
15. Which of the followings is true when a foreign DNA is being inserted into the PstI site of pBR322 (refer to Figure 1 for a map of pBR322) and introduced into E. coli cells?
13 0.051 a) Clones transformed with the recombinant plasmid are resistant to ampicillin 3 0.012 b) Clones transformed with the recombinant plasmid are sensitive to tetracycline 208 0.819 c) Clones transformed with pBR322 are resistant to both ampicillin and
tetracycline##
7 0.028 d) Clones transformed with the recombinant plasmid are not sensitive to ampicillin 23 0.091 e) all of the rest
difference between recombinant plasmid and transformed with pBR322 plasmid?
16. Which of the following primers can amplify the following DNA segment by PCR?
GACTGGTCGCGGATAGCGTATAATATTTCGGAATACGGTATACCCGGATACGGATA 8 0.031 a) 5'ATAGGCATAGGC and 5'TATCCGTATCCG
34 0.134 b) 5'ATAGGCATAGGC and 3'CTGACCAGCGCC 16 0.063 c) 5'CTGACCAGCGCC and 5'GACTGGTCGCGG 191 0.752 d) 5'TATCCGTATCCG and 3'GGCGCTGGTCAG## 5 0.020 e) 5'ATAGGCATAGGC and 5'CCGCGACCAGTC
5' will be opposite of 3'; cannot have two different 5' for same strand; why is 3' not opposite for d?
17. Which of the following is always true concerning the base composition of DNA? 1 0.004 a) In each single strand, the number of A = T
0 0.000 b) In each single strand, the number of A = G
241 0.949 c) In a molecule of double stranded DNA, A + C = T + G##
5 0.020 e) none of the rest
A=T, and G=C, so need to be on separate sides of equation
18. When compared to RNA, DNA lacks OH groups on the ______ of the pentoses: 1 0.004 a) 5' carbon
246 0.969 b) 2' carbon## 5 0.020 c) 3' carbon 0 0.000 d) 1' carbon 2 0.008 e) none of the rest
on the 2' carbon
19. After a DNA molecule is cut into fragments by restriction endonucleases, these fragments are separated by Electrophoresis based on their:
249 0.980 a) size## 1 0.004 b) charge 1 0.004 c) shape
2 0.008 d) charge and shape 1 0.004 e) none of the rest
size separates things by electrophoresis
20. Which of the followings is not likely to cause problem in a PCR experiment? 2 0.008 a) both primers are inadvertently omitted from the reaction mixture
8 0.031 b) both primers are complementary to several sites in the starting DNA sample 223 0.878 c) there are two single-stranded breaks in one strand of the template DNA molecule##
14 0.055 d) there is a double-stranded break in the template DNA molecule 7 0.028 e) the temperature of the reaction mixture stayed constant all the time
review PCR
21. Which one of the following processes do bacteria use to protect against restriction endonuclease activity?
1 0.004 a) Hydroxylation 2 0.008 b) Acetylation 251 0.988 c) Methylation## 0 0.000 d) Carboxylation 0 0.000 e) Amination
read up on restriction endonucleases
22. In gel electrophoresis of DNA, the fragment that travels the furthest is the ________. 0 0.000 a) least non-polar
2 0.008 c) medium size 1 0.004 d) largest 250 0.984 e) smallest##
smallest since can get through matrix easiest
23. DNA pol I can sequentially add deoxynucleotides to the ____ end of polynucleotides. 4 0.016 a) 5'
249 0.980 b) 3'## 0 0.000 c) 2' 1 0.004 d) 1'
0 0.000 e) None of the rest
review DNA replication
24. Select the answer that arranges bond strength from weakest to strongest: 1 0.004 a) covalent, ionic, hydrogen bonds, van der Waals
2 0.008 b) van der Waals, ionic, hydrogen bonds, covalent 249 0.980 c) van der Waals, hydrogen bonds, ionic, covalent## 0 0.000 d) ionic, covalent, hydrogen, van der Waals
2 0.008 e) none of the rest
review intermolecular forces
25. Which of the following DNA sequences is palindromic? 1 0.004 a) ACTAATGA
202 0.795 b) ACGATCGT## 1 0.004 c) CGATTTGC 0 0.000 d) AGATTACA 50 0.197 e) AGATTAGA
