Exam Review Modified True/False
Indicate whether the sentence or statement is true or false. If false, change the identified word or phrase to make the sentence or statement true.
____ 1. The combustion of 10 g of glucose in oxygen gives the same amount of energy compared to the metabolism of 10 g of glucose by human muscle cells under aerobic conditions. ______________________________
____ 2. The organelle that is unique to eukaryotic photoautotrophs is the chromoplast. _________________________
____ 3. A photosystem contains chlorophyll molecules, accessory pigments, and proteins embedded in a thylakoid membrane. _________________________ ____ 4. CAM plants have the same amount of photorespiration as C3 plants. _________________________
____ 5. Microsatellites often consist of numerous repeats of short sequences of base pairs. _________________________
____ 6. During the polymerase chain reaction, RNA primers are used that are complementary to part of the DNA to be copied. These primers act as starting points for Taq polymerase, which builds the new DNA strands in the 5'–3' direction. ______________________________
____ 7. It is important to select a restriction nutrient that does not cut in the plasmid's origin of replication, otherwise the plasmid will fail to replicate properly. _________________________
____ 8. You have a DNA sequence three thousand base pairs long, which you are going to cut using a particular restriction endonuclease. The longer the recognition site of this enzyme, the more fragments you would expect after digestion. _____________________________________________
____ 9. Gel electrophoresis separates DNA fragments on the basis of their size. _________________________
____ 10. During gel electrophoresis, DNA fragments migrate through the gel at a rate that is inversely proportional to the logarithm of their size.
_________________________________________
____ 11. If only a small or degraded sample of DNA is available, PCR analysis is used because it has the capacity to amplify the genetic material available.
___________________________________
____ 12. Some animals sun themselves or retreat to shade as a way of regulating their body temperature. ______________________________ ____ 13. An increase in body temperature is detected by sensors in the brain. The brain sends a nerve message to the hypothalamus.
______________________________
____ 14. A cross section of the kidney shows an outer layer called the medulla, an inner layer called the cortex, and a hollow chamber called the renal pelvis. ____________________________________________________________
____ 15. Adaptations are any characteristics that allow an organism to reproduce more successfully. _________________________
____ 16. The wing of a bat, the arm of a man, and the flipper of a whale all have a similar number of bones and a similar structure. This is considered to be an example of parallel adaptation. _________________________
____ 17. A species is a group of individuals that are reproductively compatible with each other but not with individuals from other groups. _________________________
____ 18. Australian marsupials show similar body plans to placental mammals. These are examples of homology. ______________________________ ____ 19. Darwin’s finches have a similar body plan, but increasingly different traits. These are examples of adaptive radiation. _________________________ ____ 20. The maximum number of organisms that can be sustained by available resources over a given period of time is known as the ecological load.
______________________________
____ 21. Barnacles are small crustaceans often found attached to whales. The barnacles are filter feeders and do not appear to harm the whales in any way. This relationship can best be classified as commensalism. _________________________
____ 22. A protist lives in the gut of a termite, digesting cellulose that the termite cannot. This allows the termite to use these nutrients. If the protist is removed, both the protist and termite will die. This is an example of obligatory mutualism. _________________________
____ 23. An agricultural lifestyle allows for less population growth than for a hunter-gatherer lifestyle. _________________________ ____ 24. The dispersion pattern of the world's human population can best be described as random. _________________________
____ 25. The majority of wild plants that are suitable for domestication are distributed uniformly around the globe. ______________________________ Multiple Choice
Identify the letter of the choice that best completes the statement or answers the question.
____ 26. Which of the following is the essential characteristic of a polar molecule? a. contains double or triple bonds
b. is formed at extremely low temperatures c. contains ions as part of the structure
d. has an asymmetrical distribution of electrical charge e. contains the element oxygen
____ 27. Isomers are molecules that a. react readily with one another b. have the same molecular formula c. have different molecular masses d. differ in the number of unsaturated bonds e. must contain the same functional group
____ 28. Choose the element that is found in all organic compounds.
a. nitrogen d. hydrogen
b. carbon e. oxygen
c. sulphur
____ 29. What name is given to compounds in which a carbon atom only bonds to hydrogen and other carbon atoms?
a. fatty acids d. nucleic acids
b. hydrocarbons e. carbohydrates
____ 30. From the following list, which is an example of a monosaccharide?
a. maltose d. glucose
b. glycogen e. sucrose
c. cellulose
____ 31. When a molecule of glycerol reacts with one or more fatty acids an ester linkage results. The formation of this linkage is a result of a reaction between a. an amino acid and a carboxylic acid d. two carboxylic acids
b. two alcohols e. two amino acids
c. an alcohol and a carboxylic acid
____ 32. When two organic molecules are joined together and a water molecule is removed, the reaction is
called which of the following?
a. dehydration synthesis (condensation) d. oxidation
b. hydrogenation e. reduction
c. hydrolysis
____ 33. The hydrolysis (breakdown) of an ester results in
a. a sugar and an acid d. two sugars
b. two acids e. an acid and an alcohol
c. an acid and an amine
____ 34. The hydrolysis (breakdown) of a dipeptide results in the production of which of the following?
a. a sugar and an amino acid d. two sugars
b. two amino acids e. an amino acid and an alcohol
c. an acid and an amine
____ 35. The extremely large diversity of structure seen in proteins is mainly due to a. the disulfide and hydrogen bonds that determine molecular shape b. the action of the ribosomes
c. the precise location of specific amino acids, common to all proteins d. different numbers, kinds, and sequences of amino acids
e. different kinds of bonds between successive amino acids ____ 36. An oxidation/reduction is best shown by which of the following?
a. an amino and carboxyl group form a peptide bond
b. two small molecules chemically combine to form a large one c. a base reacts with an acid to form water and a salt
d. electrons are transferred from one substance to another e. a large molecule is broken into two smaller molecules ____ 37. In the following, what kind of chemical reaction is shown?
R-CHO + H2O + NAD+ R-COOH + NADH + H
+
a. deamination d. neutralization
b. hydrolysis e. oxidation/reduction
c. dehydration synthesis (condensation)
____ 38. During photosynthesis, water molecules are split according to the following reaction: H2O + NADP+ NADPH + H+ + O2
In the reaction, which substance undergoes reduction?
a. the hydrogen ions (protons) d. the NADP+
b. the NADPH e. the water molecules
c. the oxygen that is released
____ 39. In most cellular processes, oxidation involves
a. the loss of oxygen atoms d. the gain of electrons
b. free oxygen e. the loss of hydrogen atoms
c. the gain of hydrogen atoms
____ 40. The activity of an enzyme can be altered by changing the pH of its surroundings slightly. This change in pH works by a. causing the enzyme to precipitate
b. masking its active site
c. increasing the activation energy of the reaction d. breaking its peptide bonds
e. altering its three dimensional shape
____ 41. Which of the following statements about enzymes is not true? a. They are proteins with tertiary or quaternary structures. b. They are very specific for the substrate to which they bind. c. They will bind their substrate and any isomer of their substrate. d. Their names usually end in 'ase.'
e. All of the above statements are true.
____ 42. Which of the following statements regarding enzyme inhibition is incorrect? a. Competitive inhibitors have a similar structure to the normal substrate. b. Competitive inhibitors bind to the active site of an enzyme.
c. Noncompetitive inhibition can be overcome by adding more substrate.
d. Noncompetitive inhibitors do not have a similar structure to the normal substrate. e. Noncompetitive inhibitors do not bind to the active site of an enzyme.
____ 43. Which of the following statements concerning allosteric regulation is not true? a. Allosteric sites are usually located next to, but separate from, the active site. b. Alosterically controlled enzymes usually have quaternary structure. c. 'Activators' tend to keep all the active sites available to the normal substrate. d. 'Allosteric inhibitors' stabilize the inactive form of the enzyme.
e. Allosteric regulators attach to their sites using weak bonds.
____ 44. Which of the following is not an application of enzymes for commercial or industrial use? a. starch hydrolysis for the food industry
____ 45. During aerobic cellular respiration, which of the following is the most common type of reaction to
take place in the cell?
a. hydrolysis d. redox
b. condensation e. dehydration
c. neutralization
____ 46. The following molecules can be found at various stages during cellular respiration: I. acetyl-CoA
II. carbon dioxide III. glucose IV. glyceraldehyde
V. pyruvate
Which of the following sequences represents the above molecules in order from the largest to the smallest amount of chemical energy?
a. II, I, V, IV, III d. III, I, V, IV, II
b. III, IV, V, I, II e. IV, III, II, I, V
c. III, IV, I, V, II
____ 47. What is the name of the process in which energy is released in a cell in the presence of sufficient oxygen?
a. anaerobic respiration d. glycolysis
b. aerobic respiration e. anabolism
c. fermentation
____ 48. Proteins are to ribosomes as ATP is to which of the following cell organelles?
a. centrioles d. chromosomes
b. mitochondria e. nucleus
c. Golgi apparatus
____ 49. During aerobic cellular respiration, which of the following molecules activates Krebs cycle?
a. citrate d. acetyl coenzyme A
b. pyruvate e. carbon dioxide
c. cytochrome oxidase
____ 50. Anaerobic respiration is less efficient than aerobic respiration for which of the following reasons? a. less ATP is produced in anaerobic respiration
b. aerobic respiration allows for rapid oxidation during strenuous exercise c. blood carries more than enough oxygen to support aerobic respiration d. only bacteria and yeast use anaerobic respiration
e. most animals have to breathe air in order to survive
____ 51. When muscles cells do work under anaerobic conditions, the muscle cells a. use lactate to synthesize glycogen for glycolysis
b. use the pyruvate-acetyl-CoA shunt as an alternative energy source c. get their energy from oxidative phosphorylation instead
d. produce lactate and release energy that way e. stop functioning, which results in cramping
____ 52. Anaerobic and aerobic respiration are similar in all but one of the following ways. Which one is the exception? a. NAD+ is reduced
b. carbon dioxide is a product
c. ADP is combined with inorganic phosphate to form ATP d. acetaldehyde is converted into ethanol
e. both can release energy from glucose
____ 53. Amino acids can enter cellular respiration, but first they have to be
a. deaminated d. converted to glucose
b. hydrolyzed e. converted into protein
c. phosphorylated
____ 54. Ethanol fermentation at a brewery is most likely limited by a. the availability of a carbohydrate source
b. the availability of ATP c. the build up of carbon dioxide d. the build up of alcohol e. the availability of reductant
____ 55. When photosynthetic membranes are stacked in a chloroplast they are called which of the following?
a. stroma d. cristae
b. lamellae e. vesicles
c. grana
____ 56. In an investigation of the pigments in the leaves of a particular plant, one spot moved 8.0 cm from the origin, while the solvent front moved 10.0 cm. What would the Rf value of the pigment be?
a. 80.0 d. 1.25
b. 8.0 e. 0.8
c. 2.0
____ 57. A high Rf value in paper chromatography implies that the solute
a. is relatively small
b. is structurally similar to the solvent c. has a high molar mass
d. has a greater attraction to the paper than the solvent e. has a greater attraction to the solvent than the paper
____ 58. When isolated chlorophyll re-emits light as fluorescence, this shows which of the following? a. When electron transport is disrupted, electron energy is released as light.
b. Chlorophyll must work with molecules like ATP to trap lig.
c. Whole chloroplasts are needed in order for photosynthesis to take place.
____ 59. Which one of the following is not a characteristic of the light reactions? a. electrons are displaced
b. carbon fixation happens c. reduction happens
d. energy is converted from a physical to a chemical form e. they take place in the thylakoids of chloroplasts
____ 60. A kind of herbicide works by disrupting the structure of the internal membranes of a chloroplast. Which segment of photosynthesis would be the most affected?
a. activation of the photosystems d. manufacture of ATP
b. reduction of chlorophyll e. evolution of oxygen
c. absorption of light
____ 61. Electrons released as a result of photolysis
a. combine with H+ ions and oxygen to form water
b. are used directly in the fixation of carbon during the Calvin cycle c. reduce photosystem I chlorophyll molecules
d. reduce photosystem II chlorophyll molecules e. oxidize NADP+
____ 62. Photon energy, captured by chlorophyll a
, is transferred as chemical energy to
a. carbon dioxide d. carotenoids
b. glucose e. a series of hydrogen acceptors
c. other chlorophylls
____ 63. Photophosphorylation involves which of the following? a. chlorophyll
b. a proton gradient across the thylakoids c. production of ATP
d. photons e. all of the above
____ 64. Which of the following statements concerning photolysis is correct? I. it can take place during the fixation of carbon
II. it involves NADP
III. it occurs in the thylakoid of the chloroplast IV. oxygen gas is produced
V. in involves at least one carbon-containing compound
a. I and III only d. III and IV only
b. II and IV only e. none of the above
c. I, II, and III only
____ 65. When photosynthesis occurs, the oxygen that is released comes from
a. chlorophyll d. water
b. an intermediate of the Calvin cycle e. carbon dioxide c. a carbohydrate
____ 66. Which of the following is/are characteristics of CAM plants? I. special leaf anatomy
II. stomata open at night
III. more likely to occur at lower temperatures. IV. pineapples
V. pyruvate kinase
a. I, II and III d. I, III, V
b. I and III e. none of the above
c. II and IV
____ 67. Temporal separation refers to
a. the Calvin cycle d. cellular respiration
b. the C4 pathway e. oxidative phosphorylation
c. the CAM pathway
The table below summarizes data obtained in an experiment on oxygen evolution by different plants
species grown under different lighting conditions. Assume that the plants are of comparable size.
Plant Type of light Volume of oxygen given off
(mL) Temperature (C) Time (days)
Corn incandescent 200 20 5
Corn fluorescent 400 22 10
Barley incandescent 200 22 5
Barley fluorescent 150 22 5
____ 68. Which of the following is a reasonable interpretation?
a. oxygen production is more rapid in barley in incandescent light than fluorescent light b. less oxygen is evolved per day in incandescent light than in fluorescent light c. in incandescent light, both corn and barley give off he same amount of oxygen d. at 22°C, corn gives off more oxygen than oats
e. in incandescent light, corn gives off more oxygen per day than does oats
Imagine you have five small glass jars that are sealed to the atmosphere. All the jars are filled with a bicarbonate solution (as a source of carbon dioxide) and an indicator. The differences between each jar are described below:
Jar #1: Has a small fish.
Jar #2: Has one small fish in addition to some aquatic plants. Jar #3: Has three small fish in addition to some aquatic plants. Jar #4: Has some aquatic plants.
Jar #5: Has some aquatic plants, but the jar is completely surrounded by aluminum foil.
The indicator shows you how much carbon dioxide is in each jar. The following table shows the
relative amounts:
Colour of pH indicator solution Relative amount of carbon dioxide
green medium (equivalent to atmosphere)
blue low
The following table shows the results of an experiment where the tubes were allowed to stand under
natural light for several hours.
Observation Jar #1 Jar #2 Jar #3 Jar #4 Jar #5
Starting colour of indicator green green green green green
Final colour of indicator red green red blue green
____ 69. Under what circumstance would the indicator change from red to green in Jar#3? a. removing some of the aquatic plants
b. illuminating the jar with green light c. adding some aquatic plants to the jar d. adding some fish to the jar e. covering the jar with tin foil
____ 70. During DNA replication, the function of RNA primers is to a. open replication bubbles
b. serve as starting points for DNA strand elongation by DNA polymerase I in the 3' - 5' direction c. serve as starting points for DNA strand elongation by DNA polymerase III in prokaryotes d. prevent new-separated strands of DNA from rejoining
e. serve as a binding site for DNA ligase
____ 71. If a free phosphate is found at the 5' end of a DNA strand, what is found at the other end of the same strand? a. a hydroxyl group on the 5' carbon of a deoxyribose sugar
b. a hydroxyl group on the 3' carbon of a deoxyribose sugar c. a phosphate group on the 5' carbon of a deoxyribose sugar d. a phosphate group on the 3' carbon of a deoxyribose sugar e. a base attached to the 3' carbon of a deoxyribose sugar
____ 72. In their experiment that showed that DNA replication in E. coli was semi-conservative, Meselson and Stahl used a. a radioactive isotope of nitrogen
b. nitrogen isotopes having different mass c. ultraviolet light
d. radioactive phosphorus
e. nitrogen isotopes which had different numbers of protons ____ 73. In DNA, phosphodiester bonds join
a. two phosphate groups d. phosphate groups and bases
b. bases and sugars e. two sugar molecules
c. phosphate groups and sugars
____ 74. A section of mRNA 9 codons long would most likely result in the addition of how many amino acids to a growing polypeptide (the stop codon is absent from the section of mRNA)?
a. 9 d. 27
b. 5 e. 3
c. 10
____ 75. The temperatures at which two segments of DNA unwind has been established. Segment A unwinds at 71.6 C, while segment B unwinds at 80.7 C. The difference is due to the fact that
a. A is more phosphorylated than B b. B is richer in adenine-thymine pairs than A c. B is richer in adenine-uracil pairs than A d. B is richer in cytosine-guanine pairs than A e. A is richer in adenine-cytosine pairings than B
____ 76. If transcription could proceed in both directions along both DNA strands of a gene, how many different polypeptides could be coded for by a single gene?
a. 1 d. 4
b. 2 e. none
c. 3
____ 77. There are differences in the amino acid sequence of rabbit and frog haemoglobin polypeptides. If mRNA for rabbit haemoglobin is extracted from rabbit red blood cells, and is then placed in frog eggs, the cells will produce rabbit haemoglobin polypeptides. This shows that
a. rabbit haemoglobin mRNA is the same as frog haemoglobin mRNA
b. the genetic code and the machinery of translation are substantially the same in widely-different organisms c. the gene for haemoglobin is identical in all organisms
d. the DNA for rabbit hemoglobin is reverse transcribed into DNA in the frog eggs e. frog ribosomes are incapable of binding to mammalian RNA
____ 78. The repressor protein of the lac operon has two different recognition and binding sites for other molecules. Which of the following pairs of molecules do you think it likely that these sites would bind?
a. RNA polymerase and lactose b. RNA polymerase and DNA
c. a DNA sequence on the operator and lactose d. a DNA sequence on the regulator gene and lactose e. lactose and DNA polymerase
____ 79. If you were shown an electron micrograph of a cell in which mRNA was being translated while it was still being transcribed from the DNA, you would know
a. the gene product was in high demand at the point in the cell cycle at which the image was captured b. the cell was prokaryotic
c. transcription was occurring extremely fast
d. the electron micrograph showed the nucleus of the cell e. the cell was eukaryotic
____ 80. It is thought possible that the evolution of modern eukaryotic cells involved an endosymbiotic relationship between the prokaryotic cell ancestral to mitochondria and a host prokaryotic cell. Which of the following is not true?
a. Mitochondria have DNA organized into a few tiny chromosomes held in a mini-nucleus. b. The sequence of the DNA of mitochondria is similar to that of bacterial DNA. c. Mitochondria divide by fission.
e. Mitochondria have replication, transcription, and translation systems distinct from those of the host cell.
____ 81. Which of the following is not an example of noncoding DNA?
a. VNTRs d. SINES
b. telomeres e. histones
c. LINES
____ 82. Compare the two mRNA sequences below. AUAUUCGGCAAUCCG
AUAUUCCGCAAUCCG
This change could be the result of a
a. nonsense mutation d. translocation
b. addition mutation e. point mutation
c. deletion mutation
____ 83. Mutations can be inheritable if they effect cells in the
a. placenta d. testes
b. fallopian tubes e. skin
c. prostate
____ 84. There are three kinds of RNA polymerase in eukaryotes—RNA polymerases I, II, and III. RNA
polymerases I, II, and III are used, respectively, to transcribe
a. mRNA, tRNA, rRNA d. tRNA, rRNA, mRNA
b. tRNA, mRNA, rRNA e. all transcribe mRNA
c. rRNA, mRNA, tRNA
____ 85. In a eukaryotic cell, the sizes of the large and small ribosome subunits are, respectively
a. 50S, 40S d. 80S, 60S
b. 60S, 50S e. 80S, 70S
c. 60S, 40S
____ 86. The following are all steps in the production of a bacterium having recombinant DNA, which includes an inserted nonbacterial gene. They are in random order.
1. gel electrophoresis of plasmid DNA from bacteria in colonies showing antibiotic resistance 2. sticky ends are allowed to pair up
3. a restriction endonuclease is used to remove the gene to be inserted from its source and also to cut open a plasmid that includes a gene for antibiotic resistance
4. the bacterial colonies are treated with antibiotic 5. treatment with ligase
6. transformation
The correct order of these steps is
a. 2,5,1,3,4,6 d. 3,2,5,6,4,1
b. 4,3,6,2,5,1 e. 6,3,5,2,4,1
c. 5,1,2,3,4,6
____ 87. Gel electrophoresis separates fragments of DNA using
a. a sieving medium through which DNA fragments are moved by gravitational forces b. repulsion of charged DNA molecules by the electrically charged gel beads c. a sieving medium through which DNA molecules are moved by electrical forces
d. movement through a sieving medium by positively charged DNA molecules attracted by a negative pole e. movement of DNA fragments of different sizes at different speeds as a result of ultracentrifugation
____ 88. The recognition sites of five restriction endonucleases are shown below. Which would make cuts in the following DNA fragment? You will need to draw in the complementary DNA strand before attempting this question.
5'-GCAAGCTTGCTGCAGAATTACCCGGA-3'
Recognition Sites:
EcoRI 5'-GAATTC-3'3'-CTTAAG-5'
SmaI 5'-GGGCCC-3'
3'-CCCGGG-5'
AluI 5'-AGCT-3'
3'-TCGA-5'
HindIII 5'-AAGCTT-3'
3'-TTCGAA-5'
a. HindIII and SmaI d. EcoRI and HindIII
b. EcoRI and AluI e. AluI and HindIII
c. EcoRI and SalI
____ 89. Restriction endonuclease digestion of a DNA sequence yielded fragments of the following sizes: 1. 5.2 kb
2. 0.8 kb 3. 1.2 kb 4. 3.8 kb 5. 3.1 kb
After gel electrophoresis, what would be the order in which these fragments would be found—the last fragment listed being furthest from the negative pole.
a. 1,2,5,4,3 d. 3,2,4,5,1
b. 2,3,4,5,1 e. 1,4,5,3,2
____ 90. The competency of bacterial cells to take up plasmids from the environment can be enhanced by treating them with calcium chloride. Which of the following statements is true regarding this process?
a. Calcium ions neutralize charges on the phospholipids of the bacterial cell membrane and on the DNA of the plasmid. b. Chloride ions adhere to the cell membrane and calcium ions to the plasmid DNA, thus increasing the attractive force
between them.
c. Chloride ions neutralize charges on the phospholipids and DNA.
d. Chloride ions enter the cell through protein pores in the membrane, carrying plasmid DNA with them. e. The calcium ions change the structure of the cell membrane and, as a result, the pores are enlarged.
____ 91. A plasmid was treated with a methylase enzyme and then with two restriction endonucleases. If the resulting DNA fragment(s) were run on a gel using electrophoresis, how many band(s) would you expect to see?
a. 0 d. 3
b. 1 e. 4
c. 2
____ 92. The use of the hormone bovine somatotropin has not been approved in Canada. This is because
a. tests showed that the hormone failed to boost milk production in cows experiencing long, cold Canadian winters b. there were concerns regarding the economic consequences to small dairy producers of the use of the hormone c. there were concerns that the hormone might contaminate the milk produced
d. cows treated with the hormone grew so quickly that they were weakened and more susceptible to disease e. insufficient supplies of the hormone were available
____ 93. Two DNA primers are shown below 3'CCGT5' 5'ATCG3'
With which of the following strands of DNA could these primers be successfully used in the polymerase chain reaction? 1. 5'ATCGATTGGGCTTGGCA3'
2. 5'ACGGTTCGGGTTAGCTA3' 3. 3'TAGCTAACCCGAACCGT5' 4. 3'TGCCAAGCCCAATCGAT5'
a. 1 and 2 d. 3 and 4
b. 1 and 3 e. 1 and 4
c. 2 and 4
____ 94. All of the following are performed during restriction fragment length polymorphism analysis. 1. splitting of double-stranded into single-stranded DNA
2. gel electrophoresis 3. autoradiography
4. immersion in radioactive probes
5. digestion of DNA with restriction endonucleases
6. use of a positive charge to transfer single-stranded DNA from a gel to a membrane. The correct sequence of these operations is
a. 5,1,2,6,4,3 d. 5,6,4,3,1,2
b. 5,1,2,6,3,4 e. 1,4,3,2,6,5
c. 5,2,1,6,4,3
____ 95. In the Sanger technique for sequencing DNA, growth of a newly synthesized strand of DNA requires a. radioactive nucleoside monophosphates
b. nucleoside diphosphates c. dideoxynucleoside diphosphates d. nucleoside triphosphates e. only adenine triphosphate
____ 96. A fragment of DNA with a primer attached, which is going to be sequenced using the Sanger technique, is shown below. 5'ATGGAATTCGCCGATTGATT3'
3' TAA 5'
How many different lengths of fragment will be produced in the reaction tube that contains a small proportion of dideoxycytosine triphosphate as well as cytosine triphosphate?
a. 5 d. 1
b. 6 e. 7
c. 3
____ 97. Plant cells are hard to transform because they have a. a rigid cell wall
b. more chromosomes than other life forms c. a rigid cell membrane
d. more restriction endonucleases in their cells e. larger cells than other life forms
____ 98. When gel electrophoresis is undertaken, one well always contains DNA-marker molecules. The purpose of these markers is to a. serve as a guide to the length of the fragments in the other wells
b. indicate when the DC current is turned on
c. indicate when the DNA has completely crossed the gel d. help visualize the DNA
e. serve as a channel for ethidium bromide
Renal Patient Blood Test Results
Urea Uric Acid Glucose Amino Acid Proteins
Normal Person 0.03 0.004 0.10 0.05 8.00
Patient I 0.030 0.004 0.50 0.05 8.00
Patient II 0.030 0.005 1.70 0.05 8.00
Patient III 0.03 0.050 0.10 0.05 8.00
Patient IV 0.03 0.004 0.10 0.06 4.00
____ 99. From the above table, which patient has probably just eaten some sugar?
b. Patient II d. Patient IV
Composition (g/100 mL)
Component Plasma Filtrate Urine
I Urea 0.030 0.030 2.00
II Uric acid 0.004 0.004 0.05
III Glucose 0.100 0.100 0.00
IV Amino acids 0.050 0.050 0.00
V Salts 0.720 0.720 1.50
VI Proteins 8.000 0.036 0.00
____ 100. A patient's test results are shown in the table above. According to the table above, which items are completely reabsorbed into the plasma?
a. I, II, V d. III, IV, VI
b. III, V, VI e. II, IV, V
c. I, III, IV
____ 101. A patient's test results are shown in the table above. According to the above table, which items are excreted?
a. I, II, V d. III, IV, VI
b. III, V, VI e. II, IV, V
c. I, III, IV
____ 102. The term used to describe the ability of a living organism to adjust to changing environmental conditions by regulating their internal processes is
a. regulation d. feedback
b. homeostasis e. metabolism
c. inhibition
____ 103. The nitrogen that must be excreted comes from a. the metabolic breakdown of carbohydrates b. the nitric buffer system
c. the deamination of proteins d. the atmosphere
____ 104. The collecting ducts in the kidney
a. can actively transport water molecules actively into the urine
b. are responsible for most of the reabsorption of water that occurs in the kidney c. determine to a large extent the final osmolality of urine
d. are rendered impermeable to water by aldosterone
____105. A person who has experienced a considerable loss of mass, has a low blood calcium level, has
protruding eyes, is easily agitated, and always feels cold is likely suffering from which of the
following?
a. diabetes insipidus d. a hyperactive parathyroid
b. diabetes mellitus e. an adrenal tumor
c. a hyperactive thyroid
____ 106. Which graph illustrates a person who may secrete too little glucagon?
a. III c. IV
b. I d. II and IV
____ 107. Which graph illustrates a person with a healthy pancreas?
a. III c. IV
b. I d. II and IV
____ 108. Which of the following statements about hormones is incorrect? a. they are produced by glands such as the thyroid
b. they travel to different areas of the body c. they are carried by the blood
e. they elicit specific biological responses from target cells ____ 109. Steroid hormones exert their effect by
a. interacting with receptors on cell membranes b. a direct effect in the nucleus of a cell c. initiating formation of cyclic AMP d. initiating formation of cyclic GMP
____ 110. The graph below compares the rate absorption of glucose in the small intestine when thyroxine in the blood is either high (solid line) or low (broken line). The Y axis represents percent glucose absorbed, and the X axis indicates time.
The graph shows that glucose absorption
a. occurs more rapidly when there is a low level of thyroxine in the blood b. occurs more slowly when there is a high level of thyroxine in the blood c. occurs more rapidly when there is a high level of thyroxine in the blood d. is independent of thyroxine level in the blood
____ 111. Which of the following endocrine glands is a direct extension of the nervous system?
a. anterior pituitary gland d. thymus gland
b. posterior pituitary gland e. adrenal cortex
c. thyroid gland ____ 112. In an emergency situation
a. digestions of sugars is accelerated b. glycogen is converted to glucose c. glucose is converted to glycogen
d. endocrine suppression of glucose metabolism is experienced ____ 113. Adrenaline affects the flow of blood by which of the following?
a. stimulating the blood cells b. stimulating the muscle of the heart c. increasing the amount of blood in the system d. causing the veins and arteries to constrict
____ 114. Small concentrations of hormone are needed to cause an effect on target cells. This occurs because a. hormones are fat soluble and easily penetrate the membranes of the nucleus
b. hormones are huge molecules that remain active for years and can repeatedly stimulate the same cell c. the mechanism of hormonal action involves an enzyme cascade that amplifies the response to a hormone
d. the mechanism of hormonal action involves the rapid replication of the hormone within the target cell to quickly magnify the hormone's effect
e. the mechanism of hormonal actin involves memory cells that have had prior contact with the hormone, and immediately respond to its presence
____115. Progesterone is produced primarily in which of the following?
a. adrenal cortex d. developing follicle
b. anterior pituitary e. placenta
c. corpus luteum
____ 116. Menstruation starts by which one of the following? a. sudden release of FSH from the pituitary
b. lack of estrogen and progesterone due to degeneration of the corpus luteum c. sudden drop in LH
d. increased release of estrogen and progesterone from the corpus luteum ____ 117. The growing follicle secretes which of the following hormone?
a. LH d. estrogen
b. testosterone e. FSH
c. GnRH
____ 118. Charles Darwin is important to the study of evolution because he a. conducted genetic experiments with garden peas
b. proposed that the environment could drive evolutionary change c. proposed a theory of evolution called natural selection d. proposed a theory of evolution called adaptations e. constructed a modern system used to classify organisms
____ 119. Thomas Malthus wrote a paper on the rate of population growth and the rate of the increase in food supply. Malthus proposed that a. at some point in the future, population will exceed food supply
c. the distribution of food is a problem, but the supply of food is not.
d. the rate of population growth has exceeded food production for at least 200 years e. population increases steadily, but food supply increases rapidly
____ 120. Charles Lyell wrote Principles of Geology. This book was important to the formation of the Theory of Evolution because it a. described how rocks form
b. described how fossils form c. suggested that species do not change
d. stated that natural processes that take place today are the same as those that took place in the past e. stated that organisms change by acquiring new characteristics during their life span
____121. The most desirable adaptations are
a. structural adaptationsb. behavioral adaptations c. physiological adaptations
d. those that give an organism a survival advantage e. mutations
____ 122. The biochemical evidence for evolution is based on the concept that a. all organisms share identical DNA molecules and similar proteins
b. the more similar the DNA of two species is, the more distantly they are related
c. comparisons of the DNA and proteins of different species indicate the degree to which those species are related
d. identical DNA molecules shared by present and extinct organisms suggest that they are descended from a common ancestor e. the DNA in all organisms came from their parents
____ 123. The term radioactive dating refers to
a. the release of subatomic particles from an element b. atoms that have an unstable nuclear arrangement c. an element that is found in rock as it forms d. an element that is found in rock as it ages
e. the time that is calculated by an examination of the elements present in a rock sample
____ 124. In zoos, lions and tigers can mate and produce fertile offspring. This does not occur in natural settings because of which of the following? a. Prezygotic mechanisms such as geographic isolation separated the populations.
b. Postzygotic mechanisms such as geographic isolation separate the populations. c. Their DNA is too different to combine.
d. Prezygotic mechanisms such as ecological isolation separate the populations. e. Postzygotic mechanisms such as ecological isolation separate the populations.
____ 125. One type of raspberry flowers in May and has fruit in June. Another type of raspberry flowers in July and has fruit in September. Greenhouse owners have been able to crossbreed these two types to produce a hybrid that has fruit in June and again in September. This hybrid does not occur in natural settings because of which of the following?
a. Prezygotic mechanisms such as temporal isolation separate the populations. b. Postzygotic mechanisms such as temporal isolation separate the populations. c. Their DNA is too different to combine.
d. Prezygotic mechanisms such as geographic isolation separate the populations. e. Postzygotic mechanisms such as geographic isolation separate the populations.
____ 126. Corn is a wind-pollinated plant. Pollen from many different types of plant are blown onto the stigma of the corn, but only corn pollen can fertilize the corn egg cells and hybrids do not form. This is because of which of the following?
a. Prezygotic mechanisms such as temporal isolation separate the populations. b. Postzygotic mechanisms such as temporal isolation separate the populations. c. Their DNA is similar and can combine.
d. Prezygotic mechanisms such as mechanical isolation separate the populations. e. Postzygotic mechanisms, such as mechanical isolation separate the populations.
____ 127. Mules and donkeys can be cross bred, but the offspring (mules) are sterile. Which of the following is an explanation for this? a. Prezygotic mechanisms such as behavioural isolation separate the populations.
b. Postzygotic mechanisms such as behavioural isolation separate the populations. c. Their DNA is too different to combine.
d. Prezygotic mechanisms such as mechanical isolation separate the populations. e. Postzygotic mechanisms such as mechanical isolation separate the populations. ____ 128. The term locus is defined as which of the following?
a. the portion of the DNA molecule that codes for a particular polypeptide sequence b. a particular form of a DNA sequence that codes for a polypeptide
c. the location along a chromosome of a particular DNA sequence
d. the condition that exists when a pair of chromosomes has the same DNA sequence at the same location on each chromosome e. the condition that exists when a pair of chromosomes has different DNA sequences at the same location on each
chromosome
____ 129. The term population is defined as of which of the following? a. the proportion of gene copies in a population of a given allele b. the total of all alleles within a species in a given location c. a gene that has only a single type of allele
d. the proportion of a gene pair that is homozygous dominant, homozygous, recessive, or heterozygous e. the total of all individuals of the same species living in the same region
____ 130. The term genotype frequency is defined as of which of the following? a. the proportion of gene copies in a population of a given allele b. the total of all alleles within a species in a given location c. a gene that has only a single type of allele
d. the proportion of gene pairs (homozygous dominant, homozygous,recessive, or heterozygous) in a group or population e. the total of all individuals of the same species living in the same region
____ 131. Recessive genes that produce harmful effects may remain in a gene pool because of which of the following? a. they are influenced by the Hardy-Weinberg principle
b. they are not affected by the normal selection pressures c. they are transmitted to the offspring by heterozygous individuals d. their genotypes, and not their phenotypes, are usually expressed e. they are advantageous in most environments
b. each species lives in different habitats
c. the two species evolved from a common ancestral population
d. they did not diverge enough genetically while separated to evolve reproductive isolation mechanisms e. jack pine is wind pollinated, but lodgepole pine is pollinated by moths
____ 133. Unlike the North American forests, grasslands were not separated during the Pleistocene glaciation. Grasshopper sparrows and vesper sparrows are two grassland bird species that are found in the same general localities and do not interbreed. The best explanation for this situation is which of the following?
a. the species are adapted to very different habitats b. the species have not diverged very much genetically c. the two sparrows should probably be considered one species d. the two species had already diverged before glaciation occurred e. the two sparrows nest during different seasons
____ 134. Lupinus tidestromii and Lupinus gracilentus belong to the legume family of plants. L. tidestromii is found in the coastal beach habitat and flowers from May to June, whereas L. gracilentus is found in subalpine habitats above 3000 m and flowers from July to August. Which statement describes these lupines?
a. They are reproductively isolated. b. They are geographically isolated.
c. They are the result of acquired characteristics.
d. They are both reproductively and geographically isolated.
e. They are actually one species that reacts differently to cold temperatures.
____ 135. Eriogonum latens and Eriogonum reniforme are two species of wild buckwheat. E. latens grows on dry, stony slopes above 2000 m and flowers from July to August. E. reniforme grows in sandy soils below 1500 m and flowers from March to June. Which statement describes these species of wild buckwheat?
a. they are reproductively isolated b. they are geographically isolated
c. they are the result of acquired characteristics
d. they are both reproductively and geographically isolated
e. they are actually one species that reacts differently to cold temperatures ____ 136. Macroevolution is defined as which of the following?
a. the evolution of organisms with tissues into organisms with organs b. the change in the characteristics that are most common in the population c. the formation of several very different new species from an old species d. adaptations to the environment
e. a series of random mutations in the population
____137. Fossil horses are much shorter than modern horses. This is considered to be an example of which of
the following?
a. parallel adaptation d. microevolution
b. homology e. analogous structures
c. vestigial structures
____ 138. The term used to include all of human-like species is which of the following?
a. anthropoid d. hominid
b. hominoid e. homo
c. prosimian
____139. Theories that propose explanations for the origin of life were formed by which of the following
scientists?
a. Charles Darwin d. J.B.S. Haldane
b. Alexander Oparin e. all of the above
c. Stanley Miller ____ 140. A thermal proteinoid is
a. a theory that proposes that life originated from nonliving matter
b. a theory that proposes that life originated from materials that came to Earth from space c. a polypeptide that forms when amino acids polymerize on the surface of hot liquids d. a RNA molecule that is able to catalyze a chemical reaction
e. a spherical lipid molecule that forms in water
____ 141. Australian marsupials show similar body plans to placental mammals. These are examples of which of the following?
a. convergent evolution d. microevolution
b. homology e. divergent evolution
c. vestigial structures
____ 142. Darwin’s finches have a similar body plan, but increasingly different traits. These are examples of which of the following?
a. convergent evolution d. microevolution
b. homology e. adaptive radiation
c. vestigial structures
____ 143. Which of the population dispersion patterns is most often found in natural populations? a. uniform dispersion
b. clumped dispersion c. random dispersion
d. all of these patterns are equally common e. none of the above
____144. The number of organisms of the same species living within the total area of their entire habitat is
best known as which of the following?
a. population size d. population dynamics
b. ecological density e. none of the above
c. crude density
____145. The most accurate method of determining the size of a group of stationary organisms is which of the
following?
b. mark-recapture sampling e. all of the above c. technological tracking
____ 146. In a small mark-recapture study, 10 animals are marked, then released. Later, of 10 animals trapped, only 1 has a mark. What is the total size of the population?
a. 10 animals d. there is no way to determine the size
b. 100 animals e. none of the above
c. 1000 animals
____ 147. An orchard contains 20 apple trees in an area of 2.0 ha. Determine the density of the tree population.
a. 20 trees /ha d. 10 trees/ha
b. 40 trees/ha e. 4.0 trees/ha
c. 0.10 ha/tree
____ 148. In a population of birds being studied over a limited time period, 4 eggs hatch, 6 birds leave the area, 3 are eaten by cats, and 5 move into the area. What is the population change over the period of study?
a. an increase of 2 birds d. a decrease of 2 birds
b. an increase of 4 birds e. the population size did not change
c. a decrease of 4 birds
____ 149. Under ideal conditions, a population of bacteria can grow to more than 10 in 24 h. This is a statement of the population's
a. density d. growth rate
b. carrying capacity e. logistic growth
c. biotic potential
____ 150. A population showing low mortality rates until the individuals are past their reproductive years demonstrates which of the following?
a. type I survivorship d. type IV survivorship
b. type II survivorship e. none of the above
c. type III survivorship
____ 151. Elephants are slow to reach sexual maturity and few offspring. An elephant population exhibits which of the following? a. a type I survivorship pattern d. a type IV survivorship pattern
b. a type II survivorship pattern e. none of the above c. a type III survivorship pattern
____152. The following equation:
[(births + immigration) (deaths + emigration)]100 initial population size
is used to calculate
a. population change d. exponential growth rate
b. growth rate e. all of the above
c. geometric expansion
____ 153. A smooth curve showing the long-term exponential growth of a population is usually which of the following?
a. a straight line d. negatively sloped
b. a J-shaped curve e. none of the above
c. an S-shaped curve
____ 154. A smooth curve showing the long-term logistical growth of a population is usually which of the following?
a. a straight line d. negatively sloped
b. a J-shaped curve e. none of the above
c. an S-shaped curve
____ 155. Polar bears kill and eat seals for survival. This is described as which of the following?
a. predation d. resource partitioning
b. parasitism e. the niche of the polar bear
c. interspecific competition
____156. An ecological relationship between two species, where one species benefits and the other is harmed
is which of the following?
a. competition d. commensalism
b. predation e. both b and c
c. parasitism
____ 157. When attacked, the sea cucumber ejects its intestines. The predator attacks these allowing the animal an opportunity to escape. It will grow a new digestive system. This is an example of which of the following?
a. chemical defence d. camouflage
b. passive defence e. mimicry
c. active defence
____ 158. The present estimate of the world's human population is closest to
a. 60 million d. 6 billion
b. 6 million e. 60 billion
c. 600 million
____ 159. The three plants domesticated first by early humans are which of the following?
a. wheat, peas, and oats d. wheat, oats, and rice
b. rice, oats, and corn e. wheat, corn, and rice
c. beans, corn, and wheat
____ 160. The present distribution of the world's human population can best be described as
a. clumped d. random
b. uniform e. controlled
c. planned
____ 161. Which of the following is not a result of the Industrial Revolution? a. increased food supply
b. higher percentage of farming
____ 162. A population pyramid showing rapid growth
a. has a narrow base, and bulges as it extends upward b. shows an even age distribution for many decades c. narrows steadily from its base upward
d. has a broad base and curves sharply upward e. has a narrow base and gradually widens
____ 163. A population pyramid that slopes steadily upward indicates which of the following?
a. negative growth d. rapid growth
b. zero growth e. an even population distribution
c. slow growth
____ 164. A population pyramid having a narrow base, which bulges outwards as age increases, indicates which of the following?
a. negative growth d. rapid growth
b. zero growth e. none of the above
c. slow growth
____ 165. According to Thompson's Demographic Transition Model, a country in the "transitional stage" will show which of the following? a. slow population growth due to high natality and mortality
b. rapid population growth
c. little population growth due to declining birth rates d. zero population growth or a decline
e. an unpredictable growth pattern
____ 166. Increased agricultural use of appropriate regions of the world lead to which of the following?
a. increased human birth rate d. all of the above
b. increased human migration e. a and c only
c. decreased human death rate
____ 167. Which of the following statements does not fit the findings of human demographics? a. Since the Industrial Revolution, birth rates have remained relatively stable. b. Since the Industrial Revolution, the population has grown uniformly in all regions. c. Since the Industrial Revolution, the population has increased by 1.6% per year. d. Since the Industrial Revolution, death rates have declined by over 50%. e. All of the above statements are supported by demographics.
____ 168. In countries with a high standard of living, the most important factor influencing population growth is which of the following?
a. decreased infant mortality d. emigration
b. decreased birth rate e. a and b only
c. decreased mortality among adults
____ 169. According to Thompson's demographic transition model, a highly industrialized and economically secure country such as Canada should a. have a slow growth due to high birth rates and high death rates
b. have a rapidly growing population
c. show a stable population with little change in numbers d. have a slowly decreasing growth rate
e. show exponential growth ____ 170. According to Thomas Malthus
a. human growth is geometric; food production is geometric b. human growth is arithmetic; food production is arithmetic c. human growth is logistic; food production is arithmetic d. human growth is geometric; food production is arithmetic e. human growth is arithmetic; food production is geometric
____ 171. As the world's population grows, increased food production is necessary for survival. Which of the following is true of world grain production over the last 15 years?
a. Total food production has increased. b. Food production per capita has decline. c. Total food production has decreased. d. Total food production has stabilized. e. Both a and b are true.
____ 172. Which of the following regions are showing signs of malnutrition?
a. Africa d. all of the above
b. Latin America e. a and b only
c. South Asia
____ 173. A food chain consists of grain, cattle, and human populations. If 700 kJ in harvested grain is fed to the cattle, how much energy is available for the human population?
a. 70 kJ d. 0.70 kJ
b. 7.0 kJ e. 700 kJ
c. 63 kJ
____ 174. Which of the following food chains would be best from an energy-transfer point of view? a. grain human
b. grain cattle human c. algae insect trout human d. algae insect fish human e. algae insect frog fish human
____ 175. A large city such as Toronto attracts many people who demand low-density housing surrounding the high-density city. This is a description of which of the following?
a. ecological footprint d. density-dependent housing
b. urban sprawl e. an eco-city
c. suburban over-population Completion
176. ____________________ is a measure of an atom's ability to attract a shared electron pair when it is participating in a covalent bond with another atom. The ____________________ (larger/smaller) this number, the stronger the atom attracts the electrons of a covalent bond. These numbers are given the symbol ____________________. For all noble gases, the value of these numbers is ____________________. When an electron pair is unequally shared, the atom that attracts the pair more strongly takes on a partial ____________________ charge and the atom that attracts the pair more weakly takes on a partial ____________________ charge. This forms a ____________________ bond.
177. The ____________________ ion has been characterized as a substance that gives rise to the properties of acidic solutions. The
____________________ ion has been identified as having the properties of a base. Whenever an acid and a base mix a ____________________ reaction occurs. An acid that ionizes completely is aqueous solution is called a ____________________ acid while an acid tat partially ionizes in aqueous solution is called a ____________________ acid. According to the Brønsted-Lowry concept an acid is a proton donor. According to this theory, if acetic acid ( ) were to lose a proton it would leave the acetate ion ( ), which can also be referred to as a ____________________. Acid-base pairs in equilibrium can act as ____________________ to resist significant changes in pH.
178. Carbohydrates are the most common organic materials of Earth. They contain carbon, hydrogen, and oxygen in a _________________________ ratio. Carbohydrates are classified into three groups. The monosaccharides are partly classified by the number of carbons in their backbone. For example five-carbon sugars are called _________________________ while six-carbon sugars are called _________________________. When two or three monosaccharides join together they are called _________________________. The bond that links them together is called a(n)
_________________________ linkage. When only two sugars bond together they are called a _________________________. When several hundred to several thousand sugars link together they are called a(n) _________________________. These substances are important either for energy storage such as _________________________ or structural support such as _________________________.
179. Lipids are a large group of hydrophobic molecules composed of carbon, hydrogen and oxygen. They are divided into four families: fats, phospholipids, steroids and waxes. Fats are the most common _________________________ molecules in living things. The most common fats in plants and animals are the _________________________. These contain _________________________ fatty acids and _________________________ molecule of glycerol. Fatty acids are long hydrocarbon chains with a single _________________________ group at one end. Fatty acids can be either saturated, if all the carbons have _________________________ single bonds, or unsaturated if they have one or more carbon-carbon double bonds. When glycerol reacts with a fatty acid a(n) _________________________ linkage is formed along with the production of _________________________. The membranes of cells are composed of phospholipids, molecules in which one of the fatty acids has been replaced by a(n) _________________________ group which is _________________________ polar and therefore very _________________________ with respect to water. The sterols contain four fused hydrocarbon rings and several different functional groups. One of the most well known sterols is _________________________, which is important in cell membrane structure, but has been linked to atherosclerosis. Waxes contain long-chain fatty acids linked to alcohols or carbon rings. They are good water-proofing substances. An example in plants would be _________________________, which forms a water-resistant coating on leaves.
180. The process of glycolysis occurs in the ____________________ and begins with a molecule of ____________________. Glycolysis is a(n) ____________________ process, as it does not require oxygen. Glycolysis is a ten step process the highlights of which involve
____________________ molecules of ATP being used to "prime" the beginning portion of the pathway. Fructose 1,6-bisphosphate is split into ____________________ carbon units. Each of these units reacts in the same way and ____________________ NADH are produced in total. ATP production involves a total of ____________________ molecules from substrate level phosphorylation for a net production from glycolysis of ____________________ ATP.
181. Cyanobacteria, formerly known as ______________________________, make up the largest group of photosynthesizing ______________________________. Cyanobacteria were probably the first organisms to use sunlight in the production of
______________________________ compounds from ______________________________ and ______________________________. Being the first to produce ______________________________ on a large scale, they paved the way for ______________________________ life on
Earth.Cyanobacteria are closely related to the ______________________________ of higher plants and the ______________________________ theory gives an explanation as to how this association could have arisen.
182. Two ways in which plants have evolved to reduce the amount of photorespiration that can occur are the C4 and CAM pathways of photosynthesis. Both
of these make use of the enzyme _________________________, which fixes carbon dioxide into a four carbon molecule. In the case of C4 plants, these
molecules are made during the day in the _________________________ cells of the plant and then transferred to the _________________________ cells where it is decarboxylated to release _________________________, which then enters the Calvin cycle. The C4 mode of photosynthesis
represents a _________________________ separation of the main events of photosynthesis. In CAM photosynthesis carbon dioxide is fixed during the _________________________ and stored as an organic acid in the _________________________. During the day, when the stomata are
_________________________, the organic acids are decarboxylated and the Calvin cycle continues. The CAM mode of photosynthesis represents a _________________________ separation of the main events of photosynthesis.
183. After transcription, the first-formed mRNA is modified in eukaryotic cells. A ____________________ is added at the 5' end and a _____________________ made up of many ____________________ nucleotides is added at the 3' end.
184. At the end of translation, a ______________________________ protein causes the dismantling of the ______________________________ complex. 185. Pronociceptive _____________________ are signal molecules that amplify ____________________ sensation.
186. Sticky ends are short _________________________ lengths of DNA sticking out from double-stranded DNA that has been cut using certain restriction _________________________.
187. Blood vessel constriction and the release of aldosterone are controlled by the activated enzyme ____________________. 188. The scientist ____________________ organized a system still used today to classify organisms.
189. ____________________ is the process by which the remains or traces of an organism or its activity become part of sedimentary rock.
190. The theory that the same geological forces occurring in the present also occurred in the past is called ____________________ and was proposed by the scientist ____________________.
191. Individuals that have two copies of each type of chromosome are referred to as diploid. Those with more than two copies are ____________________. 192. Although physical separations are thought to be the most important form of ____________________ among populations, behaviour and habitat
preferences may be important in some groups of organisms.
193. Darwin’s finches have a similar body plan, but increasingly different traits. These are examples of ______________________________ evolution. 194. The maximum rate at which a population can increase under ideal conditions is known as _________________________.
195. The most accurate method of estimating the number of fish in a large school in the ocean would be ___________________________________. 196. When two members of the same species rely on the same resources, ____________________ competition results.
198. The amount of energy lost between each level of an energy pyramid is ____________________, which means that we could support more people if we consumed more food from the ____________________ level of the pyramid.
199. Much of our agricultural land in Southern Ontario has been lost to housing in order to support the large, industrial and economic cities. This growth of low-density development is known as ____________________.
200. The slogan, "Act Locally, Think Globally" is an application of a way of thinking proposed by David Suzuki and others in which the implications for the whole environment and not just part of it are considered. This is known as _________________________.
Matching
Match each item with the correct statement below.
a. London dispersionb. polar covalent bonds and symmetrical structure c. intermolecular
d. hydrophobic e. van der Waals forces f. hydrogen bond
g. polar covalent bonds and asymmetrical structure h. intramolecular
i. hydrophilic j. dipole-dipole
____ 201. What are bonds between molecules called?
____ 202. What dipole-dipole force results between H and either N, O or F? ____ 203. What is a property of polar molecules?
Match each item with the correct statement below.
a. catalysts g. facultative anaerobes
b. free energy h. entropy
c. chemoautotrophs i. enzymes
d. anaerobic cellular respiration j. heterotrophs
e. aerobic cellular respiration k. redox
f. photoautotrophs l. hydrolysis
____ 204. What organisms use light energy to build organic compounds? ____ 205. What organisms consume other organisms for chemical energy? ____ 206. What organisms build organic compounds without using light? ____ 207. What process releases energy from organic compounds using oxygen? ____ 208. What lowers the activation energy in cellular reactions?
____ 209. What type are most of the reactions that occur in cellular respiration? ____ 210. What increases during cellular respiration?
____ 211. What decreases during cellular respiration?
Match each item with the correct statement below concerning the Krebs cycle.
a. 1 f. 6
b. 2 g. ATP
c. 3 h. GTP
d. 4 i. acetyl-CoA
e. 5 j. pyruvate
____ 212. What molecule, derived from glycolysis, is at the start of the cycle? ____ 213. At how many sites does decarboxylation occur?
____ 214. How many NADH are produced in each turn of the cycle? ____ 215. How many FADH2 are produced in each turn of the cycle?
____ 216. How many carbons are in a molecule of malate at the end of the cycle? ____ 217. How many carbons are in oxaloacetate at the beginning of the cycle?
Match each item with the correct statement below.
a. light compensation point g. irradiance
b. increases h. fluctuates
c. decreases i. oxygen compensation point
d. carbon dioxide compensation point j. photorespiration e. CAM (crassulacean acid metabolism) k. remains steady
f. carbon dioxide limited l. light-limited
____ 218. Another name for light intensity. ____ 219. The quantum yield of a typical C4 plant...
____ 220. As ambient oxygen concentration increases, photorespiration...
a. template strand i. single-stranded binding proteins
b. ligase j. leading strand
c. primase k. gyrase
d. DNA polymerase I l. helicase
e. lagging strand m. annealing
f. replication fork n. mitosis
g. semi-conservative replication o. DNA polymerase III
h. Okazaki fragment
____ 221. process which results in each new DNA molecule consisting of one parental strand and one newly synthesized strand ____ 222. unwinds DNA
____ 223. new DNA strand synthesized in fragments ____ 224. division of a nucleus to form two daughter nuclei
____ 225. short lengths of DNA produced during synthesis of lagging strand ____ 226. keep newly separated strands of DNA apart
____ 227. new DNA strand which is synthesized continuously ____ 228. links sugars and phosphates together
____ 229. area where DNA polymerase is bound to unwound DNA ____ 230. DNA strand which directs synthesis of a complementary strand ____ 231. builds RNA primers
____ 232. relieves tension in DNA during unwinding
____ 233. pairing of complementary strands of DNA due to hydrogen bonding ____ 234. responsible for building new DNA strands during replication
Match each item with the correct statement below.
a. plasmid e. copy number
b. competent cell f. vector
c. ligase g. cloned DNA
d. host cell h. recombinant DNA
____ 235. a fragment of DNA, many copies of which have been produced ____ 236. a circular piece of DNA that is able to enter and leave bacterial cells ____ 237. a cell that has taken up a plasmid or virus
____ 238. joins cut ends of DNA together
____ 239. containing sequences from more than one source ____ 240. number of copies of a plasmid in a bacterial cell
____ 241. vehicle by which DNA may be introduced into bacterial cells
Match the
word or phrase with its best definition.
a. carrying capacity d. fecundity
b. biotic potential e. emigration
c. immigration
____ 242. potential of a species to produce large number of offspring in a lifetime ____ 243. intrinsic rate of natural increase
____ 244. maximum number of organisms that can be sustained by the available resources ____ 245. number of individuals that move away from an existing population
____ 246. number of individuals that move into an existing population
Population dynamics applies models in an attempt to understand the growth of populations. Match
each of the models below with the description that best applies.
a. geometric growth c. arithmetic growth
b. exponential growth d. logistic growth
____ 247. organisms reproduce continually at a constant rate ____ 248. growth rate declines as the carrying capacity is approached ____ 249. the amount of growth is constant