Arch. Biol. Sci., Belgrade, 64 (4), 1301-1309, 2012 DOI:10.2298/ABS1204301N
1301
PRIMARY HIV-1 RESISTANCE – PERSISTENCE OF TRANSMITTED DRUG RESISTANCE MUTATIONS
VALENTINA NIKOLIĆ1, D. SALEMOVIĆ2, Đ. JEVTOVIĆ1,2, I. PEŠIĆ-PAVLOVIĆ2, S. ZERJAV2,
J. RANIN, M. SILJIĆ1 and M. STANOJEVIĆ1
1 University of Belgrade Faculty of Medicine, Institute of Microbiology and Immunology, 11000 Belgrade, Serbia 2 Infectious Diseases Institute, University of Belgrade Faculty of Medicine, HIV/AIDS Unit, 11000 Belgrade, Serbia Abstract - Transmitted drug resistance (TDR) is one of the consequences of the high variability of HIV-1. The widespread use of antiretroviral therapy for the treatment of HIV-1 infection results in a large circulating pool of resistant virus vari-ants. It is known that TDR mutations can persist for extended periods and may pose an important problem to the overall success of antiretroviral therapy. Factors that determine the duration of continuous persistence of resistance-associated mutations are the number and type of these mutations and their impact on viral fitness. Here we describe the follow-up of a case study of prolonged persistence of resistance-associated mutations, namely RT mutations Q151M, K65KR and Y181C conferring an intermediate-to-high level resistance to multiple NRTIs and NNRTIs that lasted for seven years. The infection was caused by subtype G virus.
Key words: HIV-1, primary resistance, Q151M complex, viral fitness, persistence
INTRODUCTION
Transmitted drug resistance (TDR) is one of the consequences of the high variability of human im-munodeficiency virus type 1 (HIV-1) (Martinez-Picado and Martinez, 2008; Sanabani et al., 2011). The main characteristics of this RNA virus are its enormous genetic variability (3 x 10-5 mutations per
nucleotide per replication cycle) (Mansky, 1996) and rapid turnover in vivo (10.3x109 particles per
day) (Perelson et al., 1996). The widespread use of antiretroviral therapy for the treatment of HIV-1 infection results in a large circulating pool of resist-ant virus variresist-ants (Vandamme et al., 2011; Wittkop et al., 2011). Another consequence of the genetic di-versity of HIV-1 is the existence several genetically distinct groups (M, N, O, P). In particular, within the M group a number of pure subtypes (A to K) and circulating recombinant forms exist, with
dif-fering geographical representation (Hemelaar et al., 2011).
The three main antiretroviral drug classes in use, nucleoside reverse-transcriptase inhibitors (NRTIs), non-NRTIs (NNRTIs) and protease inhibitors (PIs), are the main causes of TDR (Chan and Kantor, 2009). Highly active antiretroviral therapy (HAART), based on a combination of three or more antiretroviral drugs (ARV), was initiated in 1996. The main aim of this therapy was to suppress the plasma viral load to undetectable levels, i.e. <50 copy HIV RNA/ml plasma (Ceccherini-Silberstein et al., 2010). Imple-mentation of HAART has significantly improved life quality and reduced morbidity and mortality of HIV infected patients in the last decades (Gallego et al., 2003; Lemey et al., 2005; Jakobsen et al., 2010). On the other hand, long-term use of this therapy has caused additional problems, of which the appearance
of drug resistance-associated mutations assumes central place (Nijhuis et al., 2001).
Considering the aforementioned, the number of studies related to the subject of transmitted drug resistance has constantly grown in the past decade (van de Vijver et al., 2006; Sagir et al., 2007; Smith et al., 2007; Wittkop et al., 2011). The results of these studies indicate that the overall prevalence of TDR was increasing in developed countries until a few years ago. Recent data appoints to the stabilization of the number of patients infected with HIV-1 re-sistant strains. According to data from the SPREAD program, covering the period from September 2002 through December 2005, the overall prevalence of TDR was 8.4% in Europe (Vercauteren et al., 2009). These results are similar to those published in pre-vious reports of SPREAD program (during 1996-2002, 10.4% and 2002-2003, 9.1%) (Wensing et al., 2005; SPREAD program AIDS, 2008), as well as other studies (van de Vijver et al., 2006; Sagir et al., 2007; Smith et al., 2007; Wittkop et al., 2011). Exist-ing data obtained over a period of 10 years have con-firmed the stabilization in the number of patients who are infected with resistant strains. Moreover, several studies indicate that some risk behaviors, such as men who have sex with men (MSM), are related to the higher prevalence of TDR (Weinstock et al., 2004).
The transmission of drug-resistant viruses has been revealed to occur through several different routes, including heterosexual and homosexual in-tercourse, intravenous drug use and vertically, from mother to child (Erice et al., 1993; Veenstra et al., 1995; Boden et al., 1999). Potential sources for the transmission of primary resistance are people who do not know their infection status, patients who do not use antiretroviral therapy because of a high CD4 cell count and patients with HAART failure.
The most widely used markers of primary re-sistance are Surveillance Drug Rere-sistance
Muta-tions (SDRM). In 2007, the list of SDRMs was
estab-lished by the World Health Organization (WHO), and expanded further in 2009, as a result of both
the emergence of new antiretroviral drugs and new-ly recognized resistance mutations (Bennett et al., 2009).
Within the survey of primary resistance in Serbia as part of the SPREAD program since 2002, multi-ple cases of resistance mutations have been revealed, among others a case of transmission of the multid-rug resistance (MDR) thymidine analog mutations (TAMs) complex mutation Q151M. Here we describe the follow-up of this case, which is characterized by the persistence of primary resistance for seven years, prior to therapy initiation.
MATERIALS AND METHODS
Clinical and epidemiological data were collected with informed patient consent. Genotypic resist-ance testing was done on a sample taken upon diag-nosis of HIV infection, and repeated subsequently, using an in-house genotypic resistance assay. HIV RNA extraction was done from 500 μl blood plas-ma (kept at -80˚C). After centrifugation, 220 μl of plasma was removed; the rest was used for RNA extraction with the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) according to the manu-facturer’s instructions. Extracted RNA was reverse-transcribed and amplified by the nested RT-PCR protocol, using a One Step RNA PCR Kit (Qiagen, Hilden, Germany) for the outer reaction and a Taq PCR Core Kit (Qiagen, Hilden, Germany) for inner PCR reaction. The outer primer pair, HIV_AV159 and HIV_AV192, was used first. Nested reactions were performed with the primer pair HIV_AV190 and HIV_AV 191 (Table 1) (Snoeck et al., 2005). The obtained product was sequenced by dye-termi-nator sequencing on an ABI 310 automated DNA sequencer (Applied Biosystem, Foster City, CA, USA), using seven different primers (HIV_AV36, HIV_AV191, HIV_AV75, HIV_RVP3, HIV_AV22, HIV_AV44, HIV_AV190) (Table 1.). The obtained sequence was examined for mutations in the re-verse transcriptase (RT) and protease (PR) gene using the algorithm provided by the HIV Drug Re-sistance Database (available at http://hivdb.stan-ford.edu).
RESULTS
A 21 year-old female patient (patient A) was diag-nosed as HIV positive in August 2003 at the Center for HIV/AIDS, Belgrade. Her HIV status was discov-ered after an episode of lymphadenopathy and fever. At the time of inclusion in the study, the patient was in the CDC stage A. The plasma HIV-1 RNA levels and CD4 cell counts were 482/mm3 and 1000 c/ml,
respectively. Genotypic resistance testing upon HIV infection diagnosis revealed the presence of primary resistance mutations. It contained Q151M, K65R, Y181C and other PI and RT mutations and polymor-phisms (Table 2.). Detailed sequence analysis also revealed the subtype G of HIV-1.
Patient A was infected from a known source who is on ARV therapy. The source patient (patient B) was diagnosed in June 2002 and immediately be-gan anti-TB therapy for disseminated tuberculosis. ARV therapy, including abacavir (ABC), lamivudine (3TC) and stavudine (d4T) was also initiated (Fig 1.). Five months later, in November 2002, due to vi-rologic failure the therapy was switched to abacavir (ABC), didanosine (ddI) and lamivudine (3TC). Initial genotypic testing revealed that patient B’s ptreatment sample was not associated with drug re-sistance mutations; however, an identical pattern of mutations was found in the on-treatment sample of the same patient and the recipient sample.
Subsequently, patient A was followed-up for sev-eral years; her clinical status did not progress signifi-cantly, with the CD4 cell count always >350/ml and pVL constantly in the range of log3. Periodical geno-typic-resistance testing (Fig 1.) revealed the continu-ous presence of previcontinu-ously detected resistance muta-tions. In this case, the persistence of RT mutations Q151M, K65R and Y181C lasted for over seven years. In June 2010, the patient became pregnant, with CD4 431/ml, pVL 1702 c/ml and still detectable primary resistance mutations, seven years after diagnosis. The patient was not on an antiretroviral regime until the second trimester of pregnancy. Antiretroviral ther-apy was initiated in the second trimester consisting of lopinavir/ritonavir (LPN/RTN), saquinavir (SQV)
and lamivudine (3TC), which led to an undetectable viral load. Finally, in December 2010, she gave birth to a healthy boy; her pVL<50, and peripheral CD4 count was 482/ml.
DISCUSSION
To the best of our knowledge, this is the first report of primary resistance caused by the Q151M complex. The infection was caused by HIV-1 subtype G. This case is characterized by its prolonged persistence of transmitted multi-drug resistance mutations, which lasted for seven years, namely RT mutations Q151M, K65R and Y181C.
Q151M, an NRTI resistance mutation, causes intermediate-to-high level resistance to zidovu-dine (AZT), didanosine (ddI), stavuzidovu-dine (d4T) and abacavir (ABC) and low-level resistance to tenofovir (TDF). With changes at the associated RT positions 75, 77, and 116, Q151M confers high-level resistance to zidovudine (AZT), didanosine (ddI), stavudine (d4T) and abacavir (ABC), intermediate resistance to tenofovir (TDF), and low-level resistance to lami-vudine (3TC) and emtricitabine (FTC). K65R is also an NRTI resistance mutation that causes intermedi-ate resistance to abacavir (ABC), didanosine (ddI), lamivudine (3TC) and emtricitabine (FTC) and low-level resistance to stavudine (d4T). the single NNRTI resistance mutation that appeared in our patient was Y181C. This drug resistant mutation causes high-lev-el resistance to nevirapine (NVP) and intermediate-level resistance to efavirenz (EFV), etravirine (ETR) and rilpivirine (RPV).
Drug resistance-associated mutations are classi-fied into two classes based on their features. Primary mutations are responsible for drug susceptibility re-duction regardless of the reduced replicative capac-ity of the virus, while secondary mutations increase viral fitness with almost no effect on drug resistance (Devereux et al., 2001). It is known that TDR muta-tions may persist for prolonged periods of time and may pose an important hindrance to the overall suc-cess of antiretroviral therapy. Factors that determine the duration of resistance-associated mutations are
the number and type of these mutations and their impact on viral fitness (García-Lerma et al., 2004).
The differing duration and scope of persistence of transmitted HIV-1 drug-resistance mutations in the absence of therapy has been described. Here we describe the case of a seven year prolonged persist-ence of resistance mutations, caused by the Q151M complex. Other studies have shown the persistence of other mutations for over two years, without antiret-roviral therapy (Delaugerre et al., 2004).
Phylogenet-ic analysis of several thousands of HIV-1 sequences containing drug-resistance mutations, revealed five different clusters in the United Kingdom (UK), orig-inating from both drug-naïve and drug-treated pa-tients (Hué et al., 2008). Detailed analysis of these clusters uncovered their persistence for up to eight years (Hué et al., 2008). Mathematical modeling al-lowed the estimation of the average duration of TDR persistence, showing that, on average, 4.1 years are required for a complete reversion of drug resistance mutation (Little et al., 2008).
Fig. 1. Results of periodical genotypic resistance testing. The white arrow denotes the transmission event. Black arrows denote time of genotypic resistance testing and mutations found in genes for reverse transcriptase (RT) (Q151M, K65R, Y181C) and protease (PR) (K20I, M36L, V82I, I93L) (the first letter denotes the amino acid in wild type strain, the number relates to the codon position, the second letter denotes the mutated amino acid). The patient’s bars filled in blue indicate an on therapy status, with the therapy history (abacavir (ABC), lamivudine (3TC), stavudine (d4T), didanosine (ddI), lopinavir/ritonavir (LPN/RTN), saquinavir (SQV)). Patient A-recipient, patient B-source.
A possible explanation for the persistence of primary resistance mutations may be the long-term process of reversion to wild type. Namely, the mech-anisms that allow this are the genetic reversion of re-sistance mutation and viral recombination. Further-more, the number of resistance-associated mutations is in correlation with the required period of time for their complete reversion (Delaugerre et al., 2004). Moreover, the patient in our study infected with a resistant HIV-1 strain had a relatively high number of CD4 cells and a low viral load. This may be the
result of the low replicative capacity of the resistant virus (Brenner et al., 2002; Grant et al., 2002; Chaix et al., 2003).
The action mechanism of the Q151M complex is based on the modification of the dNTP biding site, decreasing the catalytic rate constant of incorpora-tion of the analogue into DNA (Menéndez-Arias, 2008; Hachiya et al., 2011). These mutations lead to intermediate-to-high level resistance to multi-ple NRTIs. First studies have revealed that Q151M
Table 1. Specific primers used for detection 1500nt of pol region
PRIMER SEQUENCE (5’→3’) HIV_AV159 GGGGTTAAATAAAATAGTAAG HIV_AV192 AATTGTTTTACATCATTAGTGTG HIV_AV190 GCTACACTAGAAGAAATGATGAC HIV_AV191 CTTGATAAATTTGATATGTCCATTG HIV_AV75 TGTACTGAGAGACAGGCTAATTTTTTAGGG HIV_RVP3 GGCAAATACTGGAGTATTGTATGG HIV_AV22 CACCTGTCAACATAAT HIV_AV44 TACTAGGTATGGTAAATGCAGT HIV_AV36 CAGTACTGGATGTGGGTGATG
Table 2. List of transmitted drug-associated mutations, as interpreted by the Stanford HIV database algorithm.
PI Major Resistance
Mutations None
PI Minor Resistance
Mutations None
PI Other Mutations I13V, K14R, K20I, M36Qi, R41K, I64L, C67E, H69K, V82I, L89M, I93L NRTI Resistance
Mutations K65R, Q151M
NNRTI Resistance
Mutations Y181C
complex mutations have the same replication fitness as the wild type of HIV-1 (Maeda et al., 1998). Fur-ther investigation has revealed that a single Q151M mutation and Q151M complex have better fitness compared to a wild-type strain (Dykes and Demeter, 2007). These results may point to the cause of the slow- and long-term reversion of Q151M complex mutations. The emergence of the Q151M complex requires the development of two intermediate mu-tations, Q151L and Q151K. These mutations have significant lower replication fitness compared with the wild type, creating a high genetic barrier for de-veloping Q151M complex (Kosalaraksa et al., 1999; García-Lerma et al., 2000).
New reports indicate the existence of three evo-lutionary pathways of viral evolution after the trans-mission of drug-resistant HIV-1 to a new host. The first pathway is explained by a complete reversion of the major drug-resistant mutations to wild type, which is caused by the lower replicative capacity of strains with mutations compared to the wild type. The second mechanism proposes the appearance of atypical variants with a higher replicative capac-ity than transmitted drug-resistant forms. The last evolutionary pathway is explained by the persistence of transmitted drug-resistant viruses (Pingen et al., 2011). The evolutionary pathway of the HIV-1 strain described here, after transmission has led to long-term persistence of RT mutations. The proposed mechanism that allows the maintenance of primary resistance assumes that the replicative capacity of a transmitted drug-resistant strain is higher compared to a wild-type strain.
The first antiretroviral drug approved by the Food and Drug Administration (FDA), azidothymidine (AZT), belongs to the NRTI drug class (Whitcomb et al., 2003). Long-term use of these drugs represents one of the major causes of them being the most com-mon TDRs. Broad cross-resistance acom-mong all NRTI drugs adds to the clinical relevance of these primary mutations. Q151M, as a thymidine analog mutation, has been found to be associated with multidrug re-sistance mutations in the reverse transcriptase gene (Shafer et al., 1994; Schmit et al., 1996). Nevertheless,
this complex of mutations does not have high rate of cross-resistance and is seen rather rarely (Van Vaer-enbergh et al., 2000; Masquelier et al., 2001).
The highest risk for mother-to-child transmis-sion is in the third trimester of pregnancy and dur-ing delivery (Delaugerre et al., 2009); therefore, the third trimester of pregnancy is an indication for the initiation of ARV therapy. However, reports reveal that drug resistance was detected in 20% of infants, if they become infected (Delaugerre et al., 2009). This resistance is a consequence of either mother-to-child transmission or an infant’s exposure of ARV therapy immediately after birth.
Assessment of the primary resistance in non-B subtypes is very difficult because of limited sources. The baseline resistance of non-B infections increased from 2.0% in 1996-1998, to 3.0% in 1999-2000 and to 8.2% in 2000-2001 (Wensing et al., 2005). These figures match the increased number of patients in-fected with non-B subtype who are at present being undertaking therapy. The problem of primary resist-ance of B-subtype was apparent a few years before its appearance in non-B subtypes. This discrepancy is probably due to the different distribution of B and non-B subtypes. The predominant subtype in Western Europe and the United States is B, while in Africa, Asia and Eastern Europe widespread non-B subtypes exist. The higher prevalence of TDR in Western Europe and the United States compared to other regions is a consequence of the long history of antiretroviral therapy use in developed countries (Chan and Kantor, 2009).
Herein we report a unique case of persistence of transmitted RT Q151M complex mutations along with other important resistance mutations in a sub-type G-infected patient during a seven-year period. This case confirms the necessity of resistance geno-typing in both primary and chronic infections, as well as in pregnancy, in order to avoid HAART fail-ure.
Acknowledgments - This work was supported in part by
LSHP-CT-2006-518211 and by Republic of Serbia Ministry of Edu-cation and Science, project No 175024.
REFERENCES
Bennett, D. E., Camacho, R. J., Otelea, D., Kuritzkes, D. R., Fl-eury, H., Kiuchi, M., Heneine, W., Kantor, R., Jordan, M. R., Schapiro, J. M., Vandamme, A. M., Sandstrom, P., Boucher, C. A., van de Vijver, D., Rhee S. Y., Liu, T. F., Pillay, D., and R. W. Shafer (2009). Drug resistance mutations for surveil-lance of transmitted HIV-1 drug-resistance: 2009 Update. PLoS ONE. 4, e4724.
Boden, D., Hurley, A. Zhang, L., Cao, Y., Guo, Y., Jones, E., Tsay, J., Ip, J., Farthing, C., Limoli, K., Parkin, N., and M. Markow-itz (1999). HIV-1 drug resistance in newly infected indi-viduals. JAMA. 282, 1135-41.
Brenner, B. G., Routy, J. P., Petrella, M., Moisi, D., Oliveira, M., Detorio, M., Spira, B., Essabag, V., Conway, B., Lalonde, R., Sekaly, R. P., and M. A. Wainberg (2002). Persistence and fitness of multidrug-resistant human immunodeficiency virus type 1acquired in primary infection. J. Virol. 76, 1753-61.
Ceccherini-Silberstein, F., Cento, V., Calvez, V., and C. F. Perno (2010). The use of human immunodeficiency virus resis-tance tests in clinical practice. Clin. Microbiol. Infect. 16, 1511-7.
Chaix, M. L., Descamps, D., Harzic, M., Schneider, V., Deveau, C., Tamalet, C., Pellegrin, I., Izopet, J., Ruffault, A., Mas-quelier, B., Meyer, L., Rouzioux, C., Brun-Vezinet, F., and D. Costagliola (2003). Stable prevalence of genotypic drug resistance mutations but increase in non-B virus among patients with HIV-1 primary infection in France. AIDS. 17, 2635-43.
Chan, P. A. and R. Kantor (2009). Transmitted drug resistance in nonsubtype B HIV-1 infection. HIV Ther. 3, 447-65. Delaugerre, C., Chaix, M. L., Blanche, S., Warszawski, J., Cornet,
D., Dollfus, C., Schneider, V., Burgard, M., Faye, A., Man-delbrot, L., Tubiana, R., and C. Rouzioux; ANRS French Perinatal Cohort (2009). Perinatal acquisition of drug-resistant HIV-1 infection: mechanisms and long-term outcome. Retrovirology. 19,6:85.
Delaugerre, C., Morand-Joubert, L., Chaix, M. L., Picard, O., Marcelin, A. G., Schneider, V., Krivine, A., Compagnucci, A., Katlama, C., Girard, P. M., and V. Calvez (2004). Persis-tence of multidrug-resistant HIV-1 without antiretroviral treatment 2 years after sexual transmission. Antivir Ther. 9, 415-21.
Devereux, H. L., Emery, V. C., Johnson, M. A., and C. Loveday (2001). Replicative Fitness In Vivo of HIV-1 Variants With
Multiple Drug Resistance-Associated Mutations. J. Med. Virol. 65, 218-24.
Dykes, C., and L. M. Demeter (2007). Clinical significance of hu-man immunodeficiency virus Type 1 replication fitness. Clin. Microbiol. Rev. 4, 550-78.
Erice, A., Mayers, D. L., Strike, D. G., Sannerud, K. J., McCutchan, F. E., Henry, K., and H. H. Balfour Jr (1993). Primary infec-tion with zidovudine-resistant human immunodeficiency virus type 1. N. Engl. J. Med. 328, 1163-5.
Gallego, O., d Mendoza, C., Labarga, P., Altisent, C., González, J., García-Alcalde, I., Valer, L., Valencia, E., and V. Sorino (2003). Long-term outcome of HIV-infected patients with multinucleoside-resistant genotypes. HIV Clin. Trials. 4, 372-81.
García-Lerma, J. G., Gerrish, P. J., Wright, A. C., Qari, S. H., and W. Heneine (2000). Evidence of a role for the Q151L muta-tion and the viral background in development of multiple dideoxynucleoside-resistant human immunodeficiency virus type 1. J. Virol. 74, 9339-46.
García-Lerma, J. G., MacInnes, H., Bennett, D., Weinstock, H., and W. Heneine (2004). Transmitted human immunodefi-ciency virus type 1 carrying the D67N or K219Q/E muta-tion evolves rapidly to zidovudine resistance in vitro and shows a high replicative fitness in the presence of zidovu-dine. J. Virol. 14, 7545-52
Grant, R. M., Hecht, F. M., Warmerdam, M., Liu, L., Liegler, T., Petropoulos, C. J., Hellmann, N. S., Chesney, M., Busch, M. P., and J. O. Kahn (2002). Time trends in primary HIV-1 drug resistance among recently infected persons. JAMA. 288, 181-8.
Hachiya, A., Kodama, E. N., Schuckmann, M. M., Kirby, K. A., Michailidis, E., Sakagami, Y., Oka, S., Singh, K., and S. G. Sarafianos (2011). K70Q adds high level tenofovir resis-tance to “Q151M complex“ HIV reverse transcriptase through the enhanced discrimination mechanism. PLoS ONE. 6, e16242.
Hemelaar, J., Gouws, E., Ghys, P. D., Osmanov, S. and WHO-UNAIDS Network for HIV Isolationand Characterisation (2011). Global trends in molecular epidemiology of HIV-1 during 2000-2007. AIDS. 25, 679-689.
Hué, S., Gifford, R. J., Dunn, D., Fernhill, E., and D. Pillay; UK Collaborative group on HIV drug resistance (2008). Dem-onstration of sustained drug-resistant human immunode-ficiency virus type 1 lineages circulating among treatment-naïve individuals. J Virol. 83, 2645-54.
Jakobsen, M. R., Tolstrup, M., Søgaard, O.S., Jørgensen, L. B., 2 Gorry, P. R., Laursen, A., and L. Østergaard (2010). Trans-mission of HIV-1 drug-resistant variants: prevalence and effect on treatment outcome. Clin. Infect. Dis. 50, 566-73.
Kosalaraksa, P., Kavlick, M. F., Maroun, V., Le, R. and H. Mitsuya (1999). Comparative fitness of multi-dideoxynucleoside-resistant human immunodeficiency virus type 1 (HIV-1) in an in vitro competitive HIV-1 replication assay. J. Virol. 73, 5356-63.
Lemey, P., Derdelinckx, I., Rambaut, A., Van Laethem, K., Du-mont, S., Vermeulen, S., Van Wijngaerden, E., and A. M. Vandamme (2005). Molecular footprint of drug-selective pressure in a human immunodeficiency virus transmis-sion chain. J. Virol. 18, 11 981-9.
Little, S. J., Frost, S. D., Wong, J. K., Smith, D. M., Pond, S. L., Igna-cio, C. C., Parkin, N. T., Petropoulos, C. J., and D. D. Rich-man (2008). Persistence of transmitted drug resistance among subjects with primary human immunodeficiency virus infection. J. Virol. 11, 5510-18.
Maeda, Y., Venzon, D.J., and H. Mitsuya (1998). Altered drug sensitivity, fitness, and evolution of human immunode-ficiency virus type 1 with pol gene mutations conferring multi-dideoxynucleoside resistance. J. Infect. Dis. 177, 1207-13.
Mansky, L.M. (1996). The mutation rate of human immunodefi-ciency virus type 1 is influenced by the vpr gene. Virology. 222, 391-400.
Martinez-Picado, J., and M. A. Martíınez (2008). HIV-1 reverse transcriptase inhibitor resistance mutations and fitness: A view from the clinic and ex vivo. Virus Res. 134, 104-23. Masquelier, B., Race, E., Tamalet, C., Descamps, D., Izopet, J.,
Buf-fet-Janvresse, C., Ruffault, A., Mohammed, A. S., Cottalor-da, J., Schmuck, A., Calvez, V., Dam, E., Fleury, H., and F. Brun-Vézinet; ANRS AC11 Resistance study group. French Agence Nationale de Recherches sur le SIDA (2001). Ge-notypic and pheGe-notypic resistance patterns of human im-munodeficiency virus type 1 variants with insertions or deletions in the reverse transcriptase (RT): multicenter study of patients treated with RT inhibitors. Antimicrob. Agents. Chemother. 45, 1836-42.
Menéndez-Arias, L. (2008). Mechanisms of resistance to nucleo-side analogue inhibitors of HIV-1 reverse transcriptase. Virus Res. 134, 124-46.
Nijhuis, M., Deeks, S., and C. Boucher (2001). Implications of an-tiretroviral resistance on viral fitness. Curr. Opin. Infect. Dis. 14, 23-8.
Perelson, A. S., Neumann, A. U., Markowitz, M., Leonard, J. M., and D. D. Ho (1996). HIV-1
dynamics in vivo: virion clearance rate, infected cell life-span, and viral generation time. Science. 271, 582-6.
Pingen, M., Nijhuis, M., de Bruijn, J. A., Boucher, C. A. B., and A. M. J. Wensing (2011). Evolutionary pathways of
transmit-ted drug-resistant HIV-1. J. Antimicrob. Chemother. 66, 1467-80.
Sagir, A., Oette, M., Kaiser, R., Däumer, M., Fätkenheuer, G., Rockstroh, J. K., Knechten, H., Schmutz, G., Hower, M., Emmelkamp, J., Pfister, H., and D. Häussinger; RESINA Study Team (2007). Trends of prevalence of primary HIV drug resistance in Germany. J. Antimicrob. Chemother. 60, 843-8.
Sanabani, S. S., Pastena, É. R., da Costa, A. C., Martinez, V. P., Kleine-Neto, W., de Oliveira, A. C., Sauer, M. M., Bassi-chetto, K. C., Oliveira, S. M., Tomiyama, H. T., Sabino, E. C., and E. G. Kallas (2011). Characterization of partial and near full-length genomes of HIV-1 strains sampled from recently infected individuals in São Paulo, Brazil. PLoS One. 6; e25869.
Schmit, J. C., Cogniaux, J., Hermans, P., Van Vaeck, C., Spre-cher, S., Van Remoortel, B., Witvrouw, M., Balzarini, J., Desmyter, J., De Clercq, E., and A. M. Vandamme (1996). Multiple drug resistance to nucleoside analogues and non-nucleoside reverse transcriptase inhibitors in an efficiently replicating human immunodeficiency virus type 1 patient strain. J Infect. Dis. 174, 962-8.
Shafer, R. W., Kozal, M. J., Winters, M. A., Astrid K. N. Iversen, A. K. N., Katzenstein, D. A., Ragni, M. V., Meyer III, W. A., Gupta, P., Rasheed, S., Coombs, R., Katzman, M., Fiscus, S., and T. C. Merigan (1994). Combination therapy with zidovudine and didanosine selects for drug-resistant hu-man immunodeficiency virus type 1 strains with unique patterns of pol gene mutations. J. Infect. Dis. 169, 722-9. Smith, D. M., Wong, J. K., Shao, H., Hightower, G. K., Mai, S. H.,
Moreno, J. M., Ignacio, C. C., Frost, S. D., Richman, D. D., and S. J. Little (2007). Long-term persistence of transmit-ted HIV drug resistance in male genital tract secretions: Implications for Secondary Transmission. J. Infect Dis. 196, 356-60.
Snoeck, J., Riva, C., Steegen, K., Schrooten, Y., Maes, B., Vergne, L., Van Laethem, K., Peeters, M., and A. M. Vandamme (2005). Optimization of a genotypic assay applicable to all human immunodeficiency virus type 1 protease and re-verse transcriptase subtypes. J. Virol. Methods. 128, 47-53. The SPREAD programme (2008). Transmission of drug-resistant
HIV-1 in Europe remains limited to single classes. AIDS. 22, 625-35.
Vandamme, A. M., Camacho, R. J., Ceccherini-Silberstein, F., de Luca, A., Palmisano, L., Paraskevis, D., Paredes, R., Poljak, M., Schmit, J.C., Soriano, V., Walter, H., and A. Sönnerborg; European HIV Drug Resistance Guidelines Panel (2011). European recommendations for the clinical use of HIV drug resistance testing: 2011 update. AIDS Rev. 13, 77-108.
van de Vijver, D. A., Wensing, A. M., Angarano, G., Asjö, B., Ba-lotta, C., Boeri, E., Camacho, R., Chaix, M. L., Costagliola, D., De Luca, A., Derdelinckx, I., Grossman, Z., Hamouda O, Hatzakis A., Hemmer R., Hoepelman A., Horban A., Korn K., Kücherer C., Leitner T., Loveday, C., MacRae, E., Maljkovic, I., de Mendoza, C., Meyer, L., Nielsen, C., Op de Coul, E. L., Ormaasen, V., Paraskevis, D., Perrin, L., Puchhammer-Stöckl, E., Ruiz, L., Salminen, M., Schmit, J. C., Schneider, F., Schuurman, R., Soriano, V., Stanczak, G., Stanojevic, M., Vandamme, A. M., Van Laethem, K., Vio-lin, M., Wilbe, K., Yerly, S., Zazzi, M., and C. A. Boucher (2006). The calculated genetic barrier for antiretroviral drug resistance substitutions is largely similar for different HIV-1 subtypes; on behalf of the SPREAD Programme. J Acquir Immune Defic Syndr. 41, 352-60.
Van Vaerenbergh, K., Van Laethem, K., Albert, J., Boucher, C. A., Clotet, B., Floridia, M., Gerstoft, J., Hejdeman, B., Niels-en, C., Pannecouque, C., Perrin, L., Pirillo, M.F., Ruiz, L., Schmit, J. C., Schneider, F., Schoolmeester, A., Schuurman, R., Stellbrink, H. J., Stuyver, L., Van Lunzen, J., Van Re-moortel, B., Van Wijngaerden, E., Vella, S., Witvrouw, M., Yerly, S., De Clercq, E., Destmyer, J., and A. M. Vandamme (2000).Prevalence and characteristics of multinucleoside-resistant human immunodeficiency virus type 1 among European patients receiving combinations of nucleoside analogues. Antimicrob. Agents. Chemother. 44, 2109-17. Veenstra, J., Schuurman, R., Cornelissen, M., van’t Wout, A.B.,
Boucher, C. A., Schuitemaker, H., Goudsmit, J., and R. A. Coutinho (1995). Transmission of zidovudine-resistant human immunodeficiency virus type 1 variants following deliberate injection of blood from a patient with AIDS: characteristics and natural history of the virus. Clin. Infect. Dis. 21, 556-60.
Weinstock, H. S., Zaidi, I., Heneine, W., Bennett, D., Garcia-Lerma, J. G., Douglas, J. M. Jr, LaLota, M., Dickinson, G., Schwarcz, S., Torian, L., Wendell, D., Paul, S., Goza, G.A., Ruiz, J., Boyett, B., and J. E. Kaplan (2004). The epidemi-ology of antiretroviral drug resistance among drug-naive HIV-1-infected persons in 10 US cities. J. Infect. Dis. 189, 2174-80.
Vercauteren, J., Wensing, A. M., van de Vijver, D. A., Albert, J., Balotta, C., Hamouda, O., Kücherer, C., Struck, D., Schmit, J. C., Asjö, B., Bruckova, M., Camacho, R.J., Clotet, B., Coughlan, S., Grossman, Z., Horban, A., Korn, K., Kostri-kis, L., Nielsen, C., Paraskevis, D., Poljak, M., Puchhammer-Stöckl, E., Riva, C., Ruiz, L., Salminen, M., Schuurman, R., Sonnerborg, A., Stanekova, D., Stanojevic, M., Vandamme, A. M., and C. A. Boucher (2009). Transmission of drug-resistant HIV-1 is stabilizing in Europe. J. Infct. Dis. 200, 1503-8.
Wensing, A. M., van de Vijver, D. A., Angarano, G., Asjö, B., Ba-lotta, C., Boeri, E., Camacho, R., Chaix, M.L., Costagliola, D., De Luca, A., Derdelinckx, I., Grossman, Z., Hamouda, O., Hatzakis, A., Hemmer, R., Hoepelman, A., Horban, A., Korn, K., Kücherer, C., Leitner, T., Loveday, C., MacRae, E., Maljkovic, I., de Mendoza, C., Meyer, L., Nielsen, C., Op de Coul, E. L., Ormaasen, V., Paraskevis, D., Perrin, L., Puchhammer-Stöckl, E., Ruiz, L., Salminen, M., Schmit, J. C., Schneider, F., Schuurman, R., Soriano, V., Stanczak, G., Stanojevic, M., Vandamme, A. M., Van Laethem, K., Vio-lin, M., Wilbe, K., Yerly, S., Zazzi, M., and C. A. Boucher; SPREAD Programme (2005). Prevalence of drug-resistant HIV-1 variants in untreated individuals in Europe: impli-cations for clinical management. J. Infct. Dis. 192, 958-66. Whitcomb, J. M., Parkin, N. T., Chappey, C., Hellmann, N. S., and
C. J. Petropoulos (2003). Broad nucleoside reverse-tran-scriptase inhibitor cross-resistance in human immuno-deficiency virus type 1 clinical isolates. J. Infect. Dis. 188, 992-1000.
Wittkop, L., Günthard, H., de Wolf, F., Dunn, D., Cozzi-Lepri, A., de Luca, A., Kücherer, C., Obel, N., von Wyl, V., Masquelier, B., Stephan, C., Torti, C., Antinori, A., García, F., Judd, A., Porter, K., Thiébaut, R., Castro, H., van Sighem, A., Colin, C., Kjaer, J., Lundgren, J., Paredes, R., Pozniak, A., Clotet., B, Phillips, A., Pillay, D., and G. Chêne; for the EuroCoord-CHAIN study group (2011). Effect of transmitted drug resistance on virological and immunological response to initial combination antiretroviral therapy for HIV (Eu-roCoord-CHAIN joint project): a European multicohort study. Lancet Infect. Dis. 11, 363-71.
